ID: 977071618

View in Genome Browser
Species Human (GRCh38)
Location 4:92396889-92396911
Sequence TTATTTGCTTCTCTGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977071615_977071618 28 Left 977071615 4:92396838-92396860 CCAATATAGTAGTGTTGACCTAG 0: 1
1: 0
2: 0
3: 0
4: 41
Right 977071618 4:92396889-92396911 TTATTTGCTTCTCTGAAGCATGG 0: 1
1: 1
2: 0
3: 36
4: 350
977071616_977071618 10 Left 977071616 4:92396856-92396878 CCTAGCAACAATTTAAATAAAAT 0: 1
1: 0
2: 6
3: 68
4: 797
Right 977071618 4:92396889-92396911 TTATTTGCTTCTCTGAAGCATGG 0: 1
1: 1
2: 0
3: 36
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977071618 Original CRISPR TTATTTGCTTCTCTGAAGCA TGG Intronic
901310435 1:8265416-8265438 CTATGTGCTTCTCTGGAGCCTGG - Intergenic
901906453 1:12416170-12416192 CTGTTTCTTTCTCTGAAGCAGGG - Intronic
901984662 1:13064979-13065001 TTTTTTACTTTTCTCAAGCATGG + Intronic
901997148 1:13161791-13161813 TTTTTTACTTTTCTCAAGCATGG - Intergenic
902629364 1:17695596-17695618 TTATTTCTTTCTCTGGAGCCTGG - Intronic
902890545 1:19440152-19440174 CTTTTTGTTTTTCTGAAGCAGGG + Intronic
905354820 1:37374140-37374162 TCAATTGCTGCTCTGGAGCAGGG - Intergenic
905978089 1:42195279-42195301 TTCTTTCCTTCTGTGAAGTATGG - Intronic
905986426 1:42287379-42287401 AAATTTACTTCTCTGTAGCAAGG - Intronic
908401726 1:63777548-63777570 TGTTTTGCTTCTCTGATGCCTGG + Intronic
909570624 1:77105868-77105890 ATTTTTGTTTCTCTGTAGCAAGG - Intronic
909821522 1:80068521-80068543 TTATTTACTTTTTTGAGGCAGGG + Intergenic
911558629 1:99377629-99377651 TTATCTGCTTCTATGAGGGAAGG - Intergenic
913989675 1:143599339-143599361 TTAGTTGCATCTCAGAACCAAGG + Intergenic
914380633 1:147112900-147112922 TGATTTGCATCTCAGAACCAAGG + Intergenic
914734576 1:150402992-150403014 TTCTTTGCTTTTCTGAAACGGGG - Intronic
915292149 1:154892345-154892367 TTGATTTCTTCTCTGAACCATGG - Intergenic
915704383 1:157830001-157830023 TTCTTTCCTTCTCTGAAGCTAGG + Intergenic
915732502 1:158064069-158064091 TTATTTGCTTATCTGAATTAAGG - Intronic
916986439 1:170197131-170197153 TTACATGCTTCTCTGAAGGAGGG - Intergenic
918138991 1:181704241-181704263 GTGTTTGCTTCTCTGAAAAATGG + Intronic
918334400 1:183493992-183494014 TTTTTTGCTTGTTTGAAACAGGG + Intronic
918823651 1:189293191-189293213 ATTTTTGTTTGTCTGAAGCAGGG - Intergenic
922184097 1:223258746-223258768 TTGTTTGCTTTTCCGAAACAGGG - Intronic
922617641 1:226972325-226972347 TTATTTGATTCTGTGTAGAAAGG + Intronic
924885051 1:248206053-248206075 TTATTTGCTTCTGTCATGAAAGG + Intergenic
1062951700 10:1508365-1508387 TTGTTTCCTTCTCTCAAACATGG + Intronic
1063469958 10:6276384-6276406 TTTTTTTTTTTTCTGAAGCATGG - Intergenic
1064304461 10:14152831-14152853 TTTTTTTCTTCTCAGAGGCAAGG - Intronic
1064882978 10:20077945-20077967 TTTTCTTCTTCTTTGAAGCATGG + Intronic
1066638482 10:37531822-37531844 TTCTTTGTTTCTCTGAAAAAAGG - Intergenic
1068175617 10:53453805-53453827 GTATGTGCCTATCTGAAGCACGG + Intergenic
1068823468 10:61406175-61406197 TTATTTTCTTTTCTGGAGAAAGG - Intergenic
1069790117 10:71014115-71014137 TTGTTTTCTTCTCTGAAGGCAGG - Intergenic
1070169893 10:73925063-73925085 TTTTTTTCTTTTTTGAAGCAGGG + Intergenic
1070490147 10:76968493-76968515 TTATTTGCTTCTCTAAATTTAGG + Intronic
1071973519 10:90931861-90931883 TTTGTTGTTTCTCTGATGCAGGG - Intergenic
1074070618 10:110065035-110065057 TTTTTTTCTTTTCTGAAACAGGG - Intronic
1074465516 10:113678570-113678592 TTAGTTGCTTCCCTGAGCCAGGG + Intergenic
1075554078 10:123417006-123417028 TTATCTCCATCTTTGAAGCAGGG - Intergenic
1077982289 11:7312273-7312295 TTATTTCATTGTCTGAAGAAAGG + Intronic
1078061319 11:8046795-8046817 TCAGTGGATTCTCTGAAGCAGGG + Intronic
1079633948 11:22712127-22712149 TTTTTTCCTTCTTCGAAGCAGGG - Intronic
1080417249 11:32080272-32080294 TGTTTTTCTTCTCTGATGCATGG - Intronic
1080421443 11:32114597-32114619 TTATTTTCTTCCCTGTAGAATGG - Intergenic
1080719791 11:34837805-34837827 TGATTTGCTTAGCTGGAGCAGGG - Intergenic
1080989185 11:37509193-37509215 TTCTTTTGTTCTGTGAAGCAAGG - Intergenic
1082735358 11:56849209-56849231 TTGTTTGATTATATGAAGCAGGG - Intergenic
1082831466 11:57621571-57621593 TTATTTCCTCCACTGGAGCAGGG + Intergenic
1083056005 11:59820423-59820445 TTATCTCTTTGTCTGAAGCAGGG + Intergenic
1083693078 11:64423376-64423398 TTGTTTGTTTCTTTGAAACAAGG - Intergenic
1085294771 11:75425236-75425258 TCATTTCCTTCCCTGAAACATGG + Intronic
1088219059 11:107548112-107548134 TTATTGGTTACTCTGAAGCCAGG + Intronic
1088462455 11:110095197-110095219 TTATGGGCTTCTCTGGAGCTAGG + Intronic
1088827320 11:113506900-113506922 TGATTTAATTCTGTGAAGCAGGG + Intergenic
1089062915 11:115640783-115640805 TTCTCTTTTTCTCTGAAGCAAGG + Intergenic
1089333339 11:117705371-117705393 TTTTTTGCTTTTGTGAAGCAAGG + Intronic
1090040451 11:123286018-123286040 TTTTTTTTTTCTCTGAAACATGG - Intergenic
1090433812 11:126669143-126669165 TTTTTTGCTTCTCTGGGGTATGG + Intronic
1091176758 11:133565640-133565662 TTTTTTTCTTCTGTGAAGAAGGG + Intergenic
1092215463 12:6678710-6678732 TTCTTTCCTTCTCTGAATCAAGG - Exonic
1092351331 12:7758274-7758296 TGCTTAGCTTCTCTGAAGAATGG - Intergenic
1092719206 12:11424259-11424281 TTATTTTCTTCTCTCAAATAGGG + Intronic
1092778994 12:11967999-11968021 TTATTTGCTTTTCTCAACAAAGG - Intergenic
1095433538 12:42162136-42162158 GTATTTCCTTCTCTGAAGGAGGG - Intronic
1096783266 12:54002981-54003003 GTACTGGCTTCTCTGAAGAAAGG - Exonic
1097727683 12:63093547-63093569 TTGTTTGCTTCGCTGAGGTAGGG + Intergenic
1098237912 12:68435829-68435851 TTATTTCCTTAACTGAAACATGG + Intergenic
1098688365 12:73454830-73454852 TTATTTTCTTCTCTTAAGTAAGG - Intergenic
1099505994 12:83476671-83476693 TTGTTTTCTTCTTTGAAGGAGGG + Intergenic
1099938752 12:89159921-89159943 TTAGATGCTTCTCTGGGGCAAGG - Intergenic
1100058864 12:90547112-90547134 TCATTTGCTGCTCTGAAGAATGG - Intergenic
1100281512 12:93122667-93122689 TTCTCTGCGTGTCTGAAGCAGGG + Intergenic
1100865866 12:98856040-98856062 TGATTTTCTTATCTGAATCATGG + Intronic
1103502907 12:121418531-121418553 TAATTTTCTTCTCTGAAGAAGGG + Intronic
1104071836 12:125352702-125352724 TTCTTTGCATCTGTAAAGCAAGG - Intronic
1104354129 12:128070511-128070533 TTTTTTGTTTCTCTGAGACACGG + Intergenic
1107503162 13:41001861-41001883 TTTTTTTTTTCTTTGAAGCAAGG - Intronic
1107791739 13:44009048-44009070 TTATCTTCTTCTGTGAAGAAAGG - Intergenic
1108769865 13:53686695-53686717 TTATTTACTTTTGTAAAGCAAGG - Intergenic
1108973097 13:56401869-56401891 TTGTGTGCTTCTCTTCAGCATGG - Intergenic
1109013497 13:56979149-56979171 TTATTTGCTACTCTATAACAAGG - Intergenic
1109640033 13:65179705-65179727 TTCTTTGGTTTTCTGAAGCTCGG - Intergenic
1109776942 13:67053051-67053073 CTACTGGCTTCTCTGAAACAAGG - Intronic
1111901631 13:94206844-94206866 TTATTTTCTTTTTTGAAACAGGG - Intronic
1112071132 13:95851609-95851631 TTATGTGCCTCTTTGCAGCACGG - Intronic
1112393973 13:99011826-99011848 TTATTTGTTTGTCTGAGACATGG + Intronic
1112970257 13:105252990-105253012 TTATTTATTTTTCTGAGGCAGGG - Intergenic
1113140428 13:107142312-107142334 TTATTTGTGACTCTGAAGCTAGG - Intergenic
1114407313 14:22468824-22468846 TACTCTGCTTCTCTGAAGCCAGG + Intergenic
1114760515 14:25308820-25308842 TTTTTTTCCTCTTTGAAGCAGGG - Intergenic
1115321824 14:32088778-32088800 TTATTTGATTCTTGGAACCATGG - Intronic
1115637109 14:35300463-35300485 TTATTTTCTTTTCTGAGACAAGG - Intronic
1115810012 14:37097105-37097127 TTTTTTGTTTTTCTGAAACAAGG + Intronic
1118261349 14:64250110-64250132 ATATTTGCTTCTGTGACACACGG - Intronic
1119398001 14:74342238-74342260 TTTTTTTTTTTTCTGAAGCAGGG - Intronic
1119536360 14:75405862-75405884 TTTTTTTCTTCACTGGAGCATGG + Intergenic
1120592505 14:86392170-86392192 GTATTTACTTCTTTGAAGCCAGG + Intergenic
1121043723 14:90772941-90772963 TTATTTACTTTTTTGAAACAGGG - Intronic
1121444002 14:93967237-93967259 TTTGTTGCTTCTCTGAGGCTGGG + Intronic
1121883566 14:97522497-97522519 TTCTTTTCTTCACTGAGGCAAGG + Intergenic
1122393857 14:101408874-101408896 TTTCTCCCTTCTCTGAAGCATGG + Intergenic
1124769131 15:32515201-32515223 TTTTTTTTTTCTCTAAAGCAGGG + Intergenic
1126243710 15:46476671-46476693 TCATATGCTTATCTGAAGCTGGG + Intergenic
1126454146 15:48842922-48842944 TTCTTTTTTTTTCTGAAGCAGGG - Intronic
1127250420 15:57230489-57230511 TAGTTTGCTTATCTAAAGCAAGG + Intronic
1127423919 15:58836623-58836645 TTATTTTTTTCCCTGAAACAGGG + Intronic
1127666941 15:61157032-61157054 TTGTTTGGTTTTCTGAAGCTTGG - Intronic
1128381232 15:67114511-67114533 TTTTTTGTTTCTCTTAAGAAAGG - Intronic
1129289681 15:74555334-74555356 TTTTTTTCTTTTTTGAAGCAGGG + Intronic
1129538424 15:76332731-76332753 TTAGTTTCTTCTTTGAAACATGG + Intergenic
1130014692 15:80177476-80177498 TTATTTTCCTCCCTGATGCATGG + Intronic
1130122691 15:81065008-81065030 TTATTTGTTTGTTTGAGGCAGGG - Intronic
1130579608 15:85124229-85124251 TCATTTGCTTATCTGTAGAATGG + Intronic
1130648115 15:85746119-85746141 TTTTTTGCCCCTCGGAAGCATGG + Intronic
1131368225 15:91857369-91857391 CTATTGGTTTATCTGAAGCATGG - Intronic
1134817320 16:17216289-17216311 TTATTTACTTCTCAGAGGGAGGG + Intronic
1139869174 16:70090411-70090433 TTCTTTGCCTGTATGAAGCATGG + Intergenic
1140386206 16:74541726-74541748 TTCTTTGCCTGTATGAAGCATGG - Intronic
1142396149 16:89832787-89832809 TTGTTTGCTCCTCTGATGAAGGG + Intronic
1142780080 17:2174925-2174947 TTATTTTCTTCTCTGCAGATGGG - Intronic
1149588556 17:57810612-57810634 TTTTTTTCTTCCCTGAAGCAAGG - Intergenic
1150355617 17:64482108-64482130 TTTTTTTTTTTTCTGAAGCAGGG + Intronic
1150967052 17:69983121-69983143 TGATTTTCTTCTCTAAATCAAGG - Intergenic
1151511025 17:74560258-74560280 TTATTTGTTTATCTGAGACAGGG + Intergenic
1153518137 18:5924085-5924107 TTATTTGCATCACTGGAGTATGG + Intergenic
1155433223 18:25783770-25783792 TTATTTACTTATCTGCAGTATGG - Intergenic
1157981156 18:52381966-52381988 TTATTTGTTTCTCCAAAGCATGG - Intronic
1158113832 18:53972457-53972479 TAATTTCTTTCTCTGAAACATGG - Intergenic
1158370054 18:56791044-56791066 TTATTTTCATCTCTAAATCAAGG - Intronic
1158539743 18:58342244-58342266 ATATTTGCATCTCTGCATCATGG + Intronic
1158763214 18:60415415-60415437 AAATTTGCTTCTCAGAAGGAAGG - Intergenic
1159144704 18:64439763-64439785 TTATTTTCTTTTTTGAGGCAAGG + Intergenic
1160406212 18:78648147-78648169 TTATTTGCATCTAAGAAGCAAGG + Intergenic
1162157939 19:8692512-8692534 TTTTTTTCTTTTCTGAAACAGGG - Intergenic
1167062628 19:47159556-47159578 TTTTTTTTTTCTTTGAAGCAGGG + Intronic
1167898235 19:52598901-52598923 TTATTTGCTTGTTTGAGACAGGG - Intronic
1167990446 19:53356529-53356551 TTATTTGCTTGTTTGAGACAGGG - Intergenic
925110084 2:1327298-1327320 TCATTTGTTTCTCTGAAATAAGG + Intronic
926732677 2:16048915-16048937 TTATTTACTTTTCTGAGACAGGG + Intergenic
927831226 2:26352131-26352153 TTTTTTTCTTCTCTGAGACAGGG - Intronic
928310690 2:30207253-30207275 TTATTTACTTATTTGAAACAAGG + Intergenic
928748053 2:34438445-34438467 ACATTTACTTCTCTGAAGCTAGG - Intergenic
929147065 2:38715927-38715949 TGCTTAGCTTCTCTGAAGCTTGG - Intronic
930790410 2:55321100-55321122 TTTTTTTCTTCTCTGAGACAGGG - Intronic
931119709 2:59202774-59202796 TTATTTGCTTCTCTTCAGGTGGG + Intergenic
931559608 2:63545617-63545639 TAATTTGTTCCTCTAAAGCAGGG + Intronic
931564935 2:63606070-63606092 TTATATGTTTCTCTTAAGAATGG + Intronic
931743843 2:65274430-65274452 TTAATTGATTCTTTGAATCAAGG - Intergenic
932011250 2:67979693-67979715 GTGTTTGCTTCTGGGAAGCATGG - Intergenic
932799822 2:74731122-74731144 TTTTTCGCTTCTCTGAGGCCAGG + Intergenic
933164398 2:79060098-79060120 TCATCTGTTTCTCTGAAGCAGGG + Intergenic
933557862 2:83852554-83852576 TTCTTTGTTTCTCTTGAGCATGG + Intergenic
934042426 2:88138979-88139001 TTATTTGTATCTCTGGAGCTTGG + Intergenic
934685768 2:96320753-96320775 TTATTTGCTTCTCTGATTCTTGG + Intergenic
935869758 2:107433851-107433873 ATTTTTGTTTCTGTGAAGCATGG - Intergenic
936925100 2:117728920-117728942 TTATTTGTTTATCTGAAGAATGG + Intergenic
937757294 2:125555886-125555908 TTTTTTACTTTTATGAAGCATGG + Intergenic
939743106 2:145935011-145935033 ATATTGGCTGCTCTGAAGCAGGG + Intergenic
940397274 2:153204346-153204368 TTATTTGTTTCACAGAAGAAAGG + Intergenic
941408653 2:165124948-165124970 CTATTTTCTGTTCTGAAGCAGGG - Intronic
941420986 2:165282392-165282414 TTATCTTCTGCTCTGAATCAGGG + Intronic
942851957 2:180497690-180497712 TTCTTTTCTTCTCTCATGCAAGG - Intergenic
943122634 2:183756049-183756071 TTTTGTGCTTCTGTGAAGAATGG - Intergenic
946654451 2:221930753-221930775 TTATTTGCTTCACTGGAGAGAGG - Intergenic
948333014 2:237185012-237185034 TTATTTCCTGACCTGAAGCAAGG - Intergenic
1170200581 20:13739355-13739377 ATATTTGATTCTAAGAAGCAGGG - Intronic
1170759078 20:19233661-19233683 TTATTTTCTGCTATGAAGGACGG + Intronic
1172467613 20:35167701-35167723 TTATTTTTTTGTCTGTAGCATGG + Intergenic
1173057177 20:39625963-39625985 GTACTTGCTTCTCTGAAGACTGG + Intergenic
1173290957 20:41714900-41714922 TTCTTTTCTTCTCTGCAACAGGG + Intergenic
1173402906 20:42740607-42740629 TCTTTTGCATCTCGGAAGCAGGG - Intronic
1173411497 20:42814779-42814801 TTATTCACTTCTCAGAAGGAAGG + Intronic
1173534316 20:43797804-43797826 TTCTTTTCTTCCCTAAAGCAAGG - Intergenic
1174820606 20:53723695-53723717 CTATTCACTTCTCTGAAACAAGG + Intergenic
1176658649 21:9613273-9613295 TTTTCTCCTTCTATGAAGCAGGG + Intergenic
1177312752 21:19418915-19418937 TGACTTGCTTCTCTAAATCATGG + Intergenic
1177814748 21:25963860-25963882 TTGTTTGCCTTTCTGAAGAAAGG - Intronic
1177978622 21:27883029-27883051 TTATTTGGTTCTCTGAACTTTGG + Intergenic
1178371958 21:32033777-32033799 CTATTTGGTTGTCTGGAGCAGGG + Intronic
1178624331 21:34202715-34202737 TTCTGTGCGTCTCTGAATCATGG - Intergenic
1178742305 21:35213217-35213239 ATATTTCCTTCTCTTAATCATGG + Intronic
1178743367 21:35224341-35224363 TGATTTGCTTCTCTAATGGATGG - Intronic
1178782069 21:35613175-35613197 TTAAATGCTTCTGTGAATCAGGG - Intronic
1179032614 21:37733824-37733846 TCATTTTCTTCTCTGAAACCTGG - Intronic
1179558499 21:42195714-42195736 TCACTTCCTTCTCTGGAGCATGG - Intergenic
1180631518 22:17233398-17233420 GTATTAGCTTCTCTGAAGTCAGG - Intergenic
1182045713 22:27272487-27272509 TTTTTTTCTTCTGTGAAACAGGG + Intergenic
1182457486 22:30461236-30461258 CTGTTTCCTTCTCTAAAGCATGG + Intronic
1184077792 22:42194340-42194362 TGATTTGCTTCAATGAAGAACGG + Intronic
950324563 3:12094236-12094258 TTATTTGCTTCTTGAAGGCAAGG + Intronic
950539496 3:13601806-13601828 TTATTTGTTTCTTTGAGACAAGG + Intronic
951597324 3:24332355-24332377 TTATTTTTTTCTCCAAAGCAGGG - Intronic
951940296 3:28070340-28070362 TTATTTGCTTCAGAGAAGCTTGG - Intergenic
952162559 3:30708733-30708755 TATTTAGCTTCTGTGAAGCAGGG - Intergenic
953533977 3:43763105-43763127 TTATTTATTTTTCTGAAACAGGG - Intergenic
953960827 3:47264441-47264463 TTATTTGTTTTTTTGAAACAGGG + Intronic
954416435 3:50395675-50395697 GCATTTCCTCCTCTGAAGCATGG + Intronic
954916953 3:54156583-54156605 TTCTCTGCCACTCTGAAGCAGGG + Intronic
955153892 3:56396785-56396807 TTGTGTGGTTCACTGAAGCATGG + Intronic
955551272 3:60087674-60087696 TTATTTGCTACTATGTAACAAGG + Intronic
955566939 3:60257595-60257617 ACATTTGCTTCACTGAAGTAGGG + Intronic
959385791 3:105704305-105704327 CTATTTGCTTCTATTAATCAGGG - Intronic
959417173 3:106089507-106089529 TTATTTAGTTCTCTCAACCATGG - Intergenic
959509842 3:107198406-107198428 TTCAATGCTTCTGTGAAGCAGGG - Intergenic
959552386 3:107676981-107677003 TTATTTTTTTCTCTGAAGGTTGG + Intronic
959938347 3:112054090-112054112 ATATTTCCTTCACAGAAGCAGGG - Intronic
960401577 3:117206042-117206064 TCCTTTGCATCTTTGAAGCAGGG - Intergenic
960661194 3:120060717-120060739 TTTTTTGTTTTTTTGAAGCAGGG - Intronic
961630980 3:128298168-128298190 TTTTTTGCTTTTCTGAGACAGGG + Intronic
961777724 3:129301522-129301544 TTCTCTGCTTTTCTGACGCATGG + Intronic
962042168 3:131718742-131718764 TTATAAGCTTTTCTGAGGCAGGG + Intronic
962119968 3:132551129-132551151 TCATTTGCTCCTCTCAAGAAGGG + Intergenic
962451841 3:135525782-135525804 TCATTTGCTCCTCAGAGGCAGGG - Intergenic
962549364 3:136473633-136473655 TTATTTGTATTTCTGAAGCAAGG - Exonic
964576830 3:158180472-158180494 TTTTTTGTTTCTTTGAGGCACGG + Intronic
964938281 3:162122158-162122180 TTGTTTGTTTTTCTGAAGCAGGG - Intergenic
965369737 3:167846816-167846838 ATAAATGCTACTCTGAAGCACGG - Intergenic
966630675 3:182070873-182070895 TTCTTTGCTGCTTTGTAGCAAGG + Intergenic
967203996 3:187102651-187102673 TTATTTGGTTCTCCAAAGGAGGG - Intergenic
968059713 3:195718029-195718051 TTATTTGCTTCCAAGAAGGAAGG + Intergenic
969654353 4:8487720-8487742 TTTTTTGCTTTTCTGAGGCAGGG - Intronic
970059085 4:12009911-12009933 CTAAATACTTCTCTGAAGCAAGG - Intergenic
970117062 4:12709063-12709085 TTATTTGCTACTGTAAAGCATGG - Intergenic
970249668 4:14101046-14101068 TTATTTGCTCCTTTGAAATAGGG - Intergenic
971516074 4:27488480-27488502 TTCTTTTCTTTTCTGAAACAGGG + Intergenic
971724063 4:30285547-30285569 TTTTTAGCTTCTCAGAAGAAAGG + Intergenic
972152343 4:36109148-36109170 TTATTTTCTTATCTGAAACTAGG - Intronic
972247865 4:37264591-37264613 TTCTTTGATTTTATGAAGCAGGG - Intronic
973832211 4:54773163-54773185 TTATGTGCTTCTCTGACAGATGG - Intergenic
973963604 4:56137263-56137285 TTTTTTTTTTCTTTGAAGCAGGG - Intergenic
974032278 4:56786844-56786866 TTGTTTGCTTTTTTGAAACAAGG - Intergenic
976185062 4:82435106-82435128 GTCTTTGTTTTTCTGAAGCAGGG + Intronic
976848868 4:89521897-89521919 TTACTTGTTTCACTGAAGCCAGG + Intergenic
977071618 4:92396889-92396911 TTATTTGCTTCTCTGAAGCATGG + Intronic
977710674 4:100120764-100120786 TTATGGGCATCTCTGAAGCTGGG + Intergenic
978134230 4:105237176-105237198 TTGTTTGCTGCTCTAAAGCTGGG - Exonic
978629509 4:110727586-110727608 TTTTTTGCGTCTTTGAAGAAAGG + Intergenic
978638686 4:110842827-110842849 TTCTTTGCTTCTCTGGACCTTGG + Intergenic
979568548 4:122185901-122185923 TAATATGCTTCTCTGTATCATGG + Intronic
980338368 4:131505553-131505575 TTACTTGCTTCCCTAAAGAAAGG + Intergenic
980691927 4:136306313-136306335 TTGTTTGGTTATCTGAAACATGG - Intergenic
981032374 4:140138327-140138349 TCATTTTCTTCAATGAAGCATGG - Intronic
981192961 4:141885048-141885070 TTATTCTCTTCTCTGTACCAGGG + Intergenic
981269285 4:142825587-142825609 TTACTTGCTTCTTTGTAGTACGG - Intronic
981641757 4:146952046-146952068 TAATTTGCTTCTATGTAGCAGGG + Intergenic
982160034 4:152559208-152559230 TTATTTGCTTCTTTTAATGAGGG - Intergenic
983522645 4:168726499-168726521 TTTTTTTCTTCTCTGAGACAAGG + Intronic
983629971 4:169840369-169840391 TCATTTGCTTCTCTCCAGGAAGG + Intergenic
985187989 4:187338131-187338153 TTATTTGTTTATCTTAAGAATGG - Intergenic
985925499 5:3012865-3012887 TTATTTGCATGTCCGAAGAAAGG - Intergenic
986650015 5:9954035-9954057 TTATTTGGTTCCTTGAAGAAAGG - Intergenic
987169064 5:15234345-15234367 TTATTTCTTTCTTTGAAGCTTGG + Intergenic
988311877 5:29569259-29569281 TTATTTGCTTGTCTGTAATATGG - Intergenic
988708574 5:33750601-33750623 TTGTTTTTTTCTCTGAAGAAAGG + Intronic
988852552 5:35193944-35193966 TTTTCTGCTTCCCTGCAGCACGG + Intronic
989176151 5:38528413-38528435 TTCCCTGCCTCTCTGAAGCAAGG + Intronic
990023563 5:51159191-51159213 TCATTTTCTTCTCTTTAGCATGG - Intergenic
990534031 5:56702321-56702343 TTATTTCTCTATCTGAAGCATGG - Intergenic
991579520 5:68139700-68139722 TTGTTTGCTGGCCTGAAGCATGG + Intergenic
992114423 5:73525834-73525856 CTATTTGCTTCTTTGAAGATTGG + Intergenic
993690992 5:90999945-90999967 TTTGTAGCTTCTCAGAAGCAAGG + Intronic
994426210 5:99590883-99590905 TTATTTGTTTCTCAAAAACATGG - Intergenic
994887490 5:105582998-105583020 TTTTTTCCTTCTTTGTAGCACGG - Intergenic
996010130 5:118473085-118473107 TTATTTACTTCTAGGAAGCTGGG - Intergenic
997185648 5:131879249-131879271 TTATTTGCTTCTGTGAAACCTGG - Intronic
997496162 5:134327996-134328018 TTATTTGCTTGTTTGTATCATGG - Intronic
999608885 5:153347967-153347989 CTATTTGTTTGTTTGAAGCAAGG + Intergenic
1000045567 5:157519329-157519351 TTATTTATTTTTCTGAGGCAGGG + Intronic
1000651803 5:163827422-163827444 TTATGTGCTTCTCTGAATGTGGG - Intergenic
1000771132 5:165355915-165355937 TAATCTCCTTCTCTGAAGTAAGG + Intergenic
1002548485 5:179969186-179969208 ATACATGCTTCTCTTAAGCAAGG + Intronic
1002896124 6:1381651-1381673 TTATTTGGTTCTCTGAAGCAAGG - Intergenic
1003012010 6:2435209-2435231 ATATTTGCTTCTCTCAACCTAGG + Intergenic
1006017776 6:31095984-31096006 TTCTTTCCTTCTCTGAGACATGG - Intergenic
1006262915 6:32891808-32891830 TTCTTTGCTTTTCTGAGACAAGG - Intergenic
1006759946 6:36451493-36451515 TTATTTTCTTTTCTGAAATAAGG + Intronic
1008284784 6:49635872-49635894 CTATTTGCTTTTCTTAAGTAAGG - Intronic
1008677306 6:53833580-53833602 TAATTTGCTTCTCTGAAATTTGG + Intronic
1009358216 6:62778982-62779004 TTATTTGCGACTCAGAAACAAGG + Intergenic
1009569188 6:65359884-65359906 TTATTTCCTTATCTGAAGTATGG - Intronic
1009711374 6:67326104-67326126 TTATTTCCTTCACTAAAGCATGG - Intergenic
1011421069 6:87173958-87173980 TTATTTTCTGCCCTGAACCAGGG - Intronic
1011497087 6:87947609-87947631 CCATTTCCTTCTCTGAAGCTCGG + Intergenic
1012994651 6:105961151-105961173 TTATTTTCTTCTTGGAGGCATGG + Intergenic
1014583832 6:123172604-123172626 TTGTTTGATTCTCTGAAGGATGG + Intergenic
1014960798 6:127682130-127682152 TATTTTGCTGCTGTGAAGCAGGG - Intergenic
1015614003 6:135055521-135055543 TTATTTCCTTCTCTAAAGCTTGG - Intronic
1015664090 6:135608168-135608190 TGTTTTTCTTCTCTGTAGCAGGG + Intergenic
1015755953 6:136606633-136606655 TTATTTGTATATCAGAAGCAGGG - Intronic
1016501533 6:144726036-144726058 TTTTTTTGTTTTCTGAAGCACGG + Intronic
1016522647 6:144963819-144963841 TCATTTGCATGTCTGATGCATGG - Intergenic
1017128407 6:151087373-151087395 TTCTTTCCTTCTCTGATGGATGG - Intronic
1017537574 6:155364650-155364672 TGATTTGCTCTTCTGAAGCCTGG + Intergenic
1017609480 6:156169914-156169936 CTTCTTTCTTCTCTGAAGCATGG + Intergenic
1017894431 6:158666978-158667000 TTATTTTTTGCTCTCAAGCAAGG - Intronic
1019050936 6:169183109-169183131 TGATTTGCTGCTATGAAGGAAGG - Intergenic
1020915985 7:14193158-14193180 TTTTCTATTTCTCTGAAGCAGGG - Intronic
1021360295 7:19704791-19704813 TTATTTTCTGCCCTGAACCAGGG - Exonic
1021507065 7:21397618-21397640 TTCTTTTCTTCTATGAAGAAGGG - Intergenic
1021783645 7:24131290-24131312 TTGTTTACTCCTGTGAAGCAAGG - Intergenic
1023261206 7:38359880-38359902 TTATTTTCATCTGTGAAGCCAGG - Intergenic
1023506905 7:40909366-40909388 TGACTTACTGCTCTGAAGCATGG + Intergenic
1026539849 7:71270131-71270153 TTAGTTGCTTCTCTGTAAAACGG - Intronic
1026798062 7:73378294-73378316 TTATTTTTTTCTCTGAGACAGGG + Intergenic
1027128017 7:75571001-75571023 TTATTTATTTTTCTGAAACAGGG - Intronic
1028914815 7:96246395-96246417 TTTTCTGAATCTCTGAAGCAAGG + Intronic
1028997672 7:97118935-97118957 TAATTCGCTTGCCTGAAGCAGGG + Intronic
1029461296 7:100695053-100695075 TTATTTATTTTTTTGAAGCAGGG + Intergenic
1029882475 7:103830115-103830137 TTTTTGGCATCTCTGAAGTAGGG - Intronic
1031103733 7:117513607-117513629 TTATTTACTTCCCTAAAGAAGGG + Intronic
1033371964 7:140717285-140717307 TTTTTTTTTTCTCTGAAACAGGG + Intronic
1034508382 7:151515030-151515052 TTATTTACTTTTCTGAGGCAGGG - Intronic
1035702992 8:1651503-1651525 TGAGCTGCTTCTCTAAAGCAGGG + Intronic
1036009568 8:4706930-4706952 TAATTTGCTCATCTGAAGCTTGG + Intronic
1036013452 8:4754234-4754256 TTATTTTCTTCTCTGAGACATGG - Intronic
1036637113 8:10558830-10558852 TTATTTGCTTCTGTCACTCAAGG + Intergenic
1038353156 8:26799550-26799572 TCATTTGATTCTTTGAGGCATGG + Intronic
1038960313 8:32510960-32510982 TTTTTTTTTTTTCTGAAGCAGGG + Intronic
1039005918 8:33036944-33036966 TGATTTGCTTCCCTTAAACACGG - Intergenic
1039142813 8:34412190-34412212 CTATTTGCTGCTGAGAAGCAAGG + Intergenic
1039522435 8:38182466-38182488 TTATTTATTTCTCAGAAGAAAGG + Intronic
1040533039 8:48281622-48281644 TTATTTCCTTCTGTCAAACAGGG + Intergenic
1040845408 8:51832851-51832873 TTATTTTCTTTTCTGAGACAGGG + Intronic
1041609984 8:59834436-59834458 TAAAATTCTTCTCTGAAGCATGG - Intergenic
1042345786 8:67726352-67726374 TTTCTTGCCTCTGTGAAGCATGG - Intronic
1044217716 8:89632274-89632296 TTAATTGCTTCTCTGAAGTGTGG - Intergenic
1044389950 8:91638433-91638455 TTATTTTTTTCTCTGAAACAGGG + Intergenic
1044560742 8:93609687-93609709 TTATTTATTTTTCTGAAACAGGG + Intergenic
1044817323 8:96126402-96126424 TTATTTGTTTTTCTGGAGAAGGG - Intergenic
1045698509 8:104838555-104838577 TTTTTAGCTTGTCTGAGGCATGG + Intronic
1045989977 8:108295618-108295640 TTGTTTGTTTCTCTGAGACAGGG + Intronic
1046477490 8:114765760-114765782 TTCTTTTCTTTTTTGAAGCATGG + Intergenic
1047199670 8:122754448-122754470 TTATTCTCTTCTCTAATGCAAGG - Intergenic
1047227292 8:122967707-122967729 TTGTTTGCTCCTTTGAAGCAAGG + Intronic
1047528354 8:125653247-125653269 ATATTTGCTTACCTGAGGCAAGG - Intergenic
1048240664 8:132738583-132738605 TTTTTTGATTCTCTTAAGCAGGG - Intronic
1048698613 8:137057926-137057948 TAATCTGCTTCTCTGAACAAAGG - Intergenic
1049147075 8:141008425-141008447 TTATTTATTTCTCTGAGACAGGG - Intergenic
1049822287 8:144643004-144643026 TTGTTTGCTTGTTTGAAACAGGG - Intergenic
1050397437 9:5214393-5214415 GTAGTTGCTGCTCTGCAGCATGG - Intergenic
1051202999 9:14650468-14650490 TTATTTTGTTCACTGAAGAATGG - Intronic
1051225160 9:14891552-14891574 TGTTTTGCTTTTCTGAGGCAGGG - Intronic
1051671237 9:19512788-19512810 CTCTTTGCTTCTCTGGAGCAGGG - Exonic
1051944758 9:22554635-22554657 TTAATTGGTTCACTGAAACATGG + Intergenic
1052158750 9:25228478-25228500 TTATTTTCTTCTGTGAAGTGGGG - Intergenic
1052276639 9:26684143-26684165 TTATCTGCTGCTGTTAAGCAGGG - Intergenic
1052621382 9:30914282-30914304 TAATTTGCTTGTGTGAAGAAGGG + Intergenic
1053149590 9:35734597-35734619 TTATTTGCTTGTTTGAAGACAGG + Intronic
1053190851 9:36066622-36066644 TCTTTTACTTCTCTGTAGCAGGG - Intronic
1055109068 9:72541790-72541812 TTATGTACTTCTCAGAAACAAGG + Intronic
1056047662 9:82735606-82735628 ATGTTTTCTTCTCTTAAGCAAGG - Intergenic
1056768145 9:89457719-89457741 TTATTTGCTTTTTTGAGACAGGG - Intronic
1056820144 9:89835668-89835690 TTTTTTTCTTTTCTGAAACAAGG - Intergenic
1057502461 9:95606403-95606425 TTTTTTGTCTCTCTGAATCAAGG + Intergenic
1057585176 9:96322510-96322532 TTATTTATTTTTCTGAGGCAGGG - Intronic
1058344063 9:103938017-103938039 TAATTTGCTTCTCTGTAAAATGG - Intergenic
1059200172 9:112407421-112407443 TTTTTTTCTTCTTTGAAACAGGG + Intronic
1203636376 Un_KI270750v1:116852-116874 TTTTCTCCTTCTATGAAGCAGGG + Intergenic
1185953834 X:4466970-4466992 TGATTTGTCTCTCAGAAGCACGG + Intergenic
1186044014 X:5514284-5514306 AGATTTGCTTCTCTGGAGCCAGG + Intergenic
1186192477 X:7078897-7078919 GTATTTGCTTCTTTGCAGCATGG - Intronic
1186258246 X:7746322-7746344 TTTTTTTTGTCTCTGAAGCAAGG + Intergenic
1186288151 X:8067953-8067975 ACATTTGCTGGTCTGAAGCAAGG + Intergenic
1186948736 X:14598260-14598282 TGATCTGCTTCCCTAAAGCAAGG - Intronic
1188314922 X:28661903-28661925 GTATTTGCTACTCTTATGCAGGG - Intronic
1188448271 X:30280681-30280703 TTTTTTGATTCTTTGAAGCCCGG - Intergenic
1188786655 X:34354797-34354819 TTATATGGTTCTCTGAGCCATGG - Intergenic
1192484618 X:71514312-71514334 TTGTTTGCTTTTCTGAGACAGGG - Intronic
1192853410 X:74981371-74981393 TTTTCTCCTTCTTTGAAGCAGGG - Intergenic
1193052933 X:77120426-77120448 TTATTTTCTTCTCTGAAATGTGG - Intergenic
1193234801 X:79093682-79093704 TTGTTTCCTTCTCTGAAATAAGG - Intergenic
1193474904 X:81951388-81951410 TTGTTTGCATTTCTGAATCAAGG + Intergenic
1195160762 X:102168428-102168450 TGTTTTGCTTTTCTGAAGCAGGG - Intergenic
1195519515 X:105815023-105815045 TTATCTGTTTCTCTGAAGAATGG + Intergenic
1196347697 X:114684466-114684488 TTATTTTCTTCTTAGAAGCCAGG + Intronic
1197050473 X:122051905-122051927 TTTTTTTCTTCTCTGCACCATGG + Intergenic
1199069153 X:143456466-143456488 TTATTTGCGTCCCTGATGAAGGG + Intergenic
1200207206 X:154325299-154325321 TTGTTTGCTTTTCTAAACCATGG + Intronic
1202278699 Y:23153481-23153503 CTTTTTCCTTCTCTGAACCATGG - Intronic
1202286040 Y:23248128-23248150 CTTTTTCCTTCTCTGAACCATGG + Intronic
1202286505 Y:23255283-23255305 CTTTTTCCTTCTCTGAACCATGG + Intronic
1202431523 Y:24784821-24784843 CTTTTTCCTTCTCTGAACCATGG - Intronic
1202431826 Y:24789578-24789600 CTTTTTCCTTCTCTGAACCATGG - Intronic
1202432129 Y:24794334-24794356 CTTTTTCCTTCTCTGAACCATGG - Intronic
1202438139 Y:24868584-24868606 CTTTTTCCTTCTCTGAACCATGG + Intronic
1202438442 Y:24873341-24873363 CTTTTTCCTTCTCTGAACCATGG + Intronic
1202438598 Y:24875717-24875739 CTTTTTCCTTCTCTGAACCATGG + Intronic