ID: 977071680

View in Genome Browser
Species Human (GRCh38)
Location 4:92397921-92397943
Sequence CAAGTGATTCTAGTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977071680_977071682 13 Left 977071680 4:92397921-92397943 CCTGGGGAAACTAGAATCACTTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 977071682 4:92397957-92397979 ACACAGGTGCTTCAGACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 157
977071680_977071681 -3 Left 977071680 4:92397921-92397943 CCTGGGGAAACTAGAATCACTTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 977071681 4:92397941-92397963 TTGCAAATTTGTGTTCACACAGG 0: 1
1: 0
2: 0
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977071680 Original CRISPR CAAGTGATTCTAGTTTCCCC AGG (reversed) Intronic