ID: 977071681

View in Genome Browser
Species Human (GRCh38)
Location 4:92397941-92397963
Sequence TTGCAAATTTGTGTTCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977071679_977071681 11 Left 977071679 4:92397907-92397929 CCAAGTTAATGTGGCCTGGGGAA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 977071681 4:92397941-92397963 TTGCAAATTTGTGTTCACACAGG 0: 1
1: 0
2: 0
3: 28
4: 320
977071675_977071681 17 Left 977071675 4:92397901-92397923 CCTACTCCAAGTTAATGTGGCCT No data
Right 977071681 4:92397941-92397963 TTGCAAATTTGTGTTCACACAGG 0: 1
1: 0
2: 0
3: 28
4: 320
977071680_977071681 -3 Left 977071680 4:92397921-92397943 CCTGGGGAAACTAGAATCACTTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 977071681 4:92397941-92397963 TTGCAAATTTGTGTTCACACAGG 0: 1
1: 0
2: 0
3: 28
4: 320
977071673_977071681 28 Left 977071673 4:92397890-92397912 CCATCACTATACCTACTCCAAGT 0: 1
1: 0
2: 0
3: 11
4: 118
Right 977071681 4:92397941-92397963 TTGCAAATTTGTGTTCACACAGG 0: 1
1: 0
2: 0
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977071681 Original CRISPR TTGCAAATTTGTGTTCACAC AGG Intronic