ID: 977071682

View in Genome Browser
Species Human (GRCh38)
Location 4:92397957-92397979
Sequence ACACAGGTGCTTCAGACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977071679_977071682 27 Left 977071679 4:92397907-92397929 CCAAGTTAATGTGGCCTGGGGAA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 977071682 4:92397957-92397979 ACACAGGTGCTTCAGACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 157
977071680_977071682 13 Left 977071680 4:92397921-92397943 CCTGGGGAAACTAGAATCACTTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 977071682 4:92397957-92397979 ACACAGGTGCTTCAGACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977071682 Original CRISPR ACACAGGTGCTTCAGACTGT AGG Intronic