ID: 977073344

View in Genome Browser
Species Human (GRCh38)
Location 4:92421368-92421390
Sequence GAGGAAATACAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 1, 2: 4, 3: 75, 4: 834}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977073341_977073344 1 Left 977073341 4:92421344-92421366 CCTTATACAATTGTGGGAGGAGC 0: 1
1: 2
2: 7
3: 18
4: 98
Right 977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG 0: 1
1: 1
2: 4
3: 75
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977073344 Original CRISPR GAGGAAATACAGATGGAAAA AGG Intronic
901113215 1:6816308-6816330 GGGGGAAGACAGATGGTAAATGG - Intronic
901439581 1:9269598-9269620 GAGCAAATGCAGATGGACACTGG - Exonic
901879079 1:12183337-12183359 GAGATAACAGAGATGGAAAAAGG - Intronic
903118605 1:21198521-21198543 GCAGAAATACAGATGCAAAGTGG - Intergenic
903426208 1:23256292-23256314 GAGGAAACAGTGATGGAGAAAGG + Intergenic
904352659 1:29918976-29918998 GAAGAAACAGAGATGGAGAAAGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905291902 1:36927632-36927654 GAGGGAAAAAAGAGGGAAAAGGG + Intronic
905293107 1:36936597-36936619 GAGTAAATAAAGCTGGAGAATGG - Intronic
905480210 1:38256617-38256639 GAGGAAACAAAGATGCAAAGCGG - Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906058163 1:42931846-42931868 AGAGAAATACAGAAGGAAAAGGG + Intronic
906339311 1:44964346-44964368 GAGTAAATACAGTTGGTCAAGGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906871251 1:49483965-49483987 GAAGACATACAAATGGCAAATGG + Intronic
906935051 1:50207457-50207479 GAGGCAATACAGATAGTGAAAGG - Intergenic
907279591 1:53337996-53338018 GATGAAAAATAGGTGGAAAAAGG - Intergenic
908057380 1:60304165-60304187 GAGGAAAGAGAGATGGGAATAGG + Intergenic
908471383 1:64447292-64447314 GAGAAAATAAAGAAGAAAAATGG - Intergenic
908744899 1:67367083-67367105 GAGGCTATAGAAATGGAAAAAGG + Intronic
908791066 1:67782107-67782129 AAGGCAAAACAGATGTAAAAGGG + Intronic
908988156 1:70051187-70051209 GAGGAAATACAGATAGAGTTGGG + Intronic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909367921 1:74849857-74849879 GAAGAAATACAAATGGAAACAGG - Intergenic
909544085 1:76824605-76824627 GAGGAGCTACAGAAAGAAAAAGG - Intergenic
909637302 1:77830882-77830904 GATGAAATTCAGATGAAATAAGG + Intronic
909650558 1:77971595-77971617 TAGGAAATACAGTTGGTATATGG - Intronic
909745710 1:79094886-79094908 GTGGAAATACTGAAGTAAAAAGG + Intergenic
909922452 1:81399374-81399396 GAAGGAAGAAAGATGGAAAAAGG - Intronic
910272268 1:85409581-85409603 CAGGAGATCCAGGTGGAAAAAGG - Intronic
910313103 1:85850026-85850048 AAGGAAATACAGAGAGAAAAAGG + Intronic
910489141 1:87748771-87748793 GAGGTAATACAGAGAGTAAATGG + Intergenic
911277939 1:95886249-95886271 GAGGAGAGACAGATGGGATAAGG - Intergenic
911332574 1:96542265-96542287 GAGGAAAAAGGGATGGAGAAGGG - Intergenic
911726426 1:101246117-101246139 GTGGACATAGAGATGGAAACAGG - Intergenic
912023848 1:105141238-105141260 TAGTAAATATAGATTGAAAAGGG + Intergenic
912171497 1:107106030-107106052 GAAAGAATACAAATGGAAAAAGG - Intergenic
912301569 1:108522099-108522121 GATGAAATAGAGATGATAAAAGG + Intergenic
912585803 1:110763928-110763950 GAGAAAAAACATAAGGAAAATGG + Intergenic
912760740 1:112365137-112365159 TAGGAAAGACAGATGGCAAAGGG + Intergenic
912966375 1:114240610-114240632 GAGGAAACACCAATGCAAAAAGG + Intergenic
913035172 1:114957646-114957668 GAAGACATACAGATGGAAACAGG + Intronic
913062747 1:115222938-115222960 GAGGAAATGCACGTGGAAACTGG - Intergenic
913484370 1:119320259-119320281 GAGGAAGGAAAGAAGGAAAAAGG - Intergenic
913671348 1:121099169-121099191 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914023117 1:143886589-143886611 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914661603 1:149794531-149794553 GGGGAAGTACAGATAGAAAAAGG + Intronic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
915867061 1:159513907-159513929 GAGGAAATATGGATGTAATAAGG - Intergenic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916270087 1:162931509-162931531 GAGGAAACACAGAGGTAAACAGG + Intergenic
916311765 1:163406295-163406317 GAGGACATACTTATGGATAAAGG - Intergenic
916400236 1:164439944-164439966 GAGGAAGGAAAGAGGGAAAATGG + Intergenic
916406402 1:164501519-164501541 GAGGAAAAACCAATGCAAAAAGG + Intergenic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
916559176 1:165918151-165918173 GAGGATATACTGATGGGAGATGG + Intergenic
916710621 1:167403504-167403526 GAGGAAAAACAAATTAAAAAGGG - Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917807476 1:178626633-178626655 GAGGAAAGACAACTGCAAAAGGG + Intergenic
918230987 1:182531628-182531650 GAGGAAATACAGAGGAGAAAAGG - Intronic
918303348 1:183223972-183223994 TGGGAAATAAAGATGGAACATGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919431788 1:197503022-197503044 GAGGAAACCAAGATAGAAAAAGG - Intergenic
919644476 1:200080107-200080129 GAGAACAGACAGTTGGAAAAAGG + Intronic
919664622 1:200280005-200280027 GAGGAAATGGGGATGGAATATGG + Intergenic
919674427 1:200367324-200367346 TTGGAAATACAGATTGAAAGAGG + Intergenic
919857769 1:201717466-201717488 GAGGAAATACAACTGGAATCTGG - Intronic
920009599 1:202858374-202858396 GAGGAGATCCAGATGCAGAAGGG + Intergenic
920081178 1:203373842-203373864 GAGGAAATACAGAAGGGAAAAGG - Intergenic
920154549 1:203937746-203937768 GAGGAAAGAAAGAAAGAAAAAGG + Intergenic
921009119 1:211123633-211123655 GAAGACAGACAGATGGAGAAAGG + Intronic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921485846 1:215714612-215714634 GGGGAAATGGAGAAGGAAAAAGG + Intronic
921517102 1:216108077-216108099 GAGGAAAAAATGAAGGAAAATGG - Intronic
921567572 1:216738462-216738484 GAGTAAAAACAGATGTGAAATGG + Intronic
921882527 1:220271675-220271697 GGGGAAATGCAGATGAAAGAAGG + Intronic
922310341 1:224382785-224382807 GAGGAAGAACAGAAAGAAAAAGG + Intergenic
922370786 1:224908781-224908803 GAGTAAAAAGAGATAGAAAAAGG - Intronic
923027138 1:230214019-230214041 AATGAAATACAGAAGGAATATGG - Intronic
923169122 1:231396679-231396701 GTGGACATCCAGATGGAAATTGG - Intronic
923356947 1:233166591-233166613 GGAGATATACAGATGGCAAATGG + Intronic
923488920 1:234465501-234465523 GAAGAATAACAGATAGAAAAAGG + Intronic
923901507 1:238330893-238330915 GAAGACATATACATGGAAAATGG - Intergenic
924854536 1:247863134-247863156 AAGGAGGTAGAGATGGAAAATGG + Intronic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1063460276 10:6211175-6211197 GAGTAAATACACAGGGCAAAAGG - Intronic
1063515851 10:6694545-6694567 GAGGAAGGACAGGTAGAAAAGGG - Intergenic
1063761152 10:9078529-9078551 GAGGAGATACACAGGGCAAATGG + Intergenic
1065476019 10:26138865-26138887 GAGGACACACAGAAGGAAATGGG + Intronic
1066283989 10:33946075-33946097 GAGAAAATCCAAGTGGAAAATGG - Intergenic
1066596188 10:37052567-37052589 GAGAAAAAACAGAGGGAGAAAGG + Intergenic
1067179701 10:43975315-43975337 GTGTCAATAAAGATGGAAAATGG + Intergenic
1067466779 10:46505663-46505685 TAGGAAAGAAAGATGTAAAATGG + Intergenic
1067620408 10:47878942-47878964 TAGGAAAGAAAGATGTAAAATGG - Intergenic
1067674667 10:48362089-48362111 CAGGAAATAAAGCTGGAAAAAGG - Intronic
1067735234 10:48845379-48845401 CAGGGAATACTGATGAAAAAGGG + Intronic
1067920881 10:50456109-50456131 GATGTAAAAGAGATGGAAAATGG - Intronic
1068682351 10:59833892-59833914 GAAGCAATACAGCTGGAAAGTGG + Intronic
1068768581 10:60794957-60794979 GAGGAGATATAGTTGGAAAAAGG - Intergenic
1069693683 10:70371620-70371642 ACGGAAACCCAGATGGAAAAGGG + Intronic
1070183191 10:74034334-74034356 CAGGAAACATAGCTGGAAAATGG - Intronic
1070361696 10:75696670-75696692 GAGGAAATAAAGATCCAGAAAGG + Intronic
1070373423 10:75806911-75806933 GGGGAAAGACAGATGCAGAAAGG - Intronic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071429229 10:85593237-85593259 GAGTAGAGAAAGATGGAAAATGG - Intergenic
1071450201 10:85786704-85786726 CAGTAATTACAGATGGGAAAGGG + Intronic
1072084029 10:92060728-92060750 GAAGACATACAGATGGCAAACGG + Intronic
1073704925 10:105972327-105972349 GAGGAAAGAGATAGGGAAAATGG + Intergenic
1073707832 10:106006147-106006169 GAGGAAAAAAAGCTGGAAAGAGG - Intergenic
1074024364 10:109618968-109618990 TAGGAAACACAGCTGTAAAATGG - Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074665781 10:115721824-115721846 GAGGAAAGACAAAGGAAAAACGG - Intronic
1074736775 10:116443134-116443156 GATGGAAAACAGATGGCAAATGG + Exonic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1076327952 10:129643054-129643076 GATGACTTACGGATGGAAAAGGG + Intronic
1077682753 11:4259673-4259695 GAAGACATACAAATGGCAAATGG - Intergenic
1077687286 11:4307080-4307102 GAAGACATACAAATGGCAAATGG + Intergenic
1077692448 11:4358257-4358279 GAAGACATACAAATGGCAAATGG + Intergenic
1078127251 11:8579831-8579853 GAAGACATACAAATGGCAAACGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079460078 11:20670835-20670857 AAGGAAATAAGGATGGTAAAGGG - Intronic
1079596661 11:22258128-22258150 GAGGGAACACATTTGGAAAAAGG - Intronic
1079677777 11:23252776-23252798 GAGGAAATAGAGACTTAAAAGGG - Intergenic
1079929688 11:26542430-26542452 GAGGGCATAGAGAGGGAAAATGG + Intronic
1079943123 11:26706996-26707018 GAGGAGATACTGTGGGAAAAAGG - Intronic
1080278723 11:30531956-30531978 AAGGAAATACACTTGGAAATTGG + Intronic
1080382061 11:31782301-31782323 GGGGAAAAACAGATGAAAAAGGG - Intronic
1081722694 11:45301938-45301960 GAGGAACTACTGAGGCAAAAAGG - Intergenic
1082089789 11:48079901-48079923 GAGGAAGCACAGAGTGAAAAGGG + Intronic
1082670817 11:56034137-56034159 GAGGAAAAACCAATGCAAAAAGG + Intergenic
1082897352 11:58205928-58205950 GAGGAAAAACACATGCAGAAGGG + Intergenic
1082897473 11:58207156-58207178 GGTGTAATAGAGATGGAAAAAGG + Intergenic
1082915040 11:58424335-58424357 GAGGAAAGACAAATTGAAGAAGG - Intergenic
1084469693 11:69351334-69351356 GAGGAAAAAAAGATTGAAGAAGG - Intronic
1084507620 11:69578681-69578703 GAAGATATACAGATGGCAATTGG - Intergenic
1084651441 11:70491770-70491792 GAGGGCACACAGCTGGAAAAGGG - Intronic
1085980853 11:81722935-81722957 AAGGATATCCAAATGGAAAAGGG + Intergenic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1086240937 11:84690127-84690149 GGGGAAAAAGAGATGGGAAAAGG + Intronic
1087161036 11:94948353-94948375 GAGGAAATGCAGTTGGAATGGGG - Intergenic
1087757525 11:102070499-102070521 CAGGAACTCCAGATGGAGAAAGG - Intronic
1088329761 11:108639219-108639241 GAGGAAATATACATGGTAAAAGG + Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088987521 11:114922895-114922917 CAGGAAACAAAGATGGAAAGTGG + Intergenic
1091195342 11:133726163-133726185 GAGGAAACACACGTGTAAAATGG + Intergenic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091530093 12:1346361-1346383 GGAGAAAAACAGATGGAAAAGGG - Intronic
1091789816 12:3265460-3265482 GTGGAGATACAGGTGCAAAAAGG + Intronic
1091860615 12:3778932-3778954 GAGGAGAGACTGATGGTAAAAGG - Intergenic
1091898540 12:4124015-4124037 AAGGAAATAGAGATTGCAAAGGG + Intergenic
1092090720 12:5801711-5801733 GAGGAAACCCAGATACAAAAGGG + Intronic
1092460708 12:8683532-8683554 AAAGATATACAGATGGCAAATGG - Intronic
1092509454 12:9139769-9139791 GAGGAAAGAAACATGAAAAATGG + Intergenic
1092639012 12:10482715-10482737 GAGGAAAAACTGGTGCAAAAAGG + Intergenic
1092791812 12:12076788-12076810 GAGGAGACAGTGATGGAAAAAGG + Intronic
1092969543 12:13678962-13678984 GAGGAAGGAAAGAAGGAAAAAGG + Intronic
1092969548 12:13678997-13679019 GAGGAAGGAAAGAAGGAAAAAGG + Intronic
1093441071 12:19197022-19197044 GAGGAAGTACAGATGGCAGGAGG - Intronic
1093441443 12:19202076-19202098 GAGTAAAGAAATATGGAAAAAGG - Intronic
1093487625 12:19668811-19668833 GAGGAAAAAAGGAAGGAAAAAGG - Intronic
1093607727 12:21113190-21113212 GAAGACATACAAATGGCAAATGG - Intronic
1093610651 12:21150734-21150756 GAGGAAAAACAAGTGCAAAAAGG + Intronic
1094350876 12:29523307-29523329 GAGGATTTACAGACAGAAAAAGG + Intronic
1094463971 12:30730742-30730764 GGGGAAATAAACATGGAAAATGG + Intronic
1094719711 12:33052044-33052066 GAGGATACACAGATGATAAATGG + Intergenic
1095565163 12:43614478-43614500 GAAGACATACAAATGGCAAATGG - Intergenic
1095749466 12:45695288-45695310 GAGGATTTATGGATGGAAAAGGG - Intergenic
1095801646 12:46275211-46275233 AAGGTGATACAGCTGGAAAAAGG + Intergenic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096424460 12:51489518-51489540 GAGGAAACAAAGAAGAAAAAGGG - Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1097807184 12:63978984-63979006 GATGATATACAAATGGCAAATGG - Intronic
1097864456 12:64547972-64547994 GAAGAAATACATATAGACAATGG - Intergenic
1097960184 12:65524644-65524666 AAGGAAATATAAATGGAGAATGG - Intergenic
1098369557 12:69742148-69742170 GAGGAAGGACAGATGGATAGTGG + Intronic
1099059930 12:77895092-77895114 GAAGAAAGAGAGATAGAAAAAGG + Intronic
1099216436 12:79859383-79859405 GATCAAAGAGAGATGGAAAAAGG + Intronic
1099339053 12:81403931-81403953 GATAAAGTACAGCTGGAAAAGGG - Intronic
1099464361 12:82964742-82964764 GAGAAAAGACAGCTAGAAAAGGG + Intronic
1099835160 12:87901213-87901235 GAGGAAACACAAAAGAAAAATGG + Intergenic
1099889709 12:88576153-88576175 TAGAAAATAGAAATGGAAAATGG - Intronic
1100018540 12:90041979-90042001 GAGGAGATAAAGAGGTAAAAAGG + Intergenic
1100086575 12:90918038-90918060 GAGAAAATACCTATGCAAAAAGG - Intronic
1100468253 12:94867895-94867917 GAGCATATACTGTTGGAAAATGG - Intergenic
1100470817 12:94891317-94891339 GAGGAAAGACAGATTGAATCCGG + Intergenic
1100548499 12:95625154-95625176 TATGAAACACAGATGCAAAATGG + Intergenic
1100643717 12:96507364-96507386 AAGTAAATATAGATGGAGAAGGG + Intronic
1100739788 12:97579433-97579455 GAGGAAAAAGAGAGGGAAAGAGG - Intergenic
1100923703 12:99519733-99519755 GAGAAAAGACAGAAGGAAAGAGG - Intronic
1101266187 12:103090379-103090401 GAAGAAACACAGATTGAAATGGG + Intergenic
1101570161 12:105946453-105946475 GAGGAGAAAAAGATGGGAAAGGG - Intergenic
1101575660 12:105994155-105994177 GAGGAAAGAGAGATTGAAGAAGG - Intergenic
1102688702 12:114743841-114743863 GAGGAAATTCAGGTGAAGAAAGG - Intergenic
1102864750 12:116365423-116365445 GAGGAAAGACAGAATGAACATGG + Intergenic
1102992476 12:117324980-117325002 GAGGAAAGAAAGAAAGAAAATGG + Intronic
1103038223 12:117673460-117673482 GAGGAAGGAAGGATGGAAAAGGG + Intronic
1103049784 12:117769004-117769026 TAGGAAATGCAGAAGGAAATTGG + Intronic
1103882424 12:124176333-124176355 GAGGAAATACACCTGAAAAACGG + Intronic
1104112981 12:125721567-125721589 GAGGAAAAAAAGGTGGAAAGGGG + Intergenic
1105618133 13:22040139-22040161 GAGGAAAGAAAGAAGGAAAGAGG + Intergenic
1106095848 13:26642513-26642535 TGGGAAATACAGAAGGAGAAAGG - Intronic
1106135843 13:26972918-26972940 GAGAAAGCACAGCTGGAAAATGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106591795 13:31104653-31104675 GCTGAAATGCAGATGGAAATGGG - Intergenic
1106963633 13:35032781-35032803 GAAGATATACAAATGGCAAATGG - Intronic
1107045011 13:35984705-35984727 AGGGGAATACAGATGGGAAAAGG - Intronic
1107090726 13:36476352-36476374 AAGGAAAGACACATTGAAAAGGG - Intergenic
1107165001 13:37273417-37273439 GAAGGAAGACAGATGGAGAAAGG - Intergenic
1107294016 13:38890523-38890545 GAGGAAAGAAACATGAAAAATGG - Intergenic
1107308852 13:39054131-39054153 GAGGAAATTGAGAGGAAAAATGG + Intergenic
1108025565 13:46173432-46173454 AAGGAAAGAAAGAAGGAAAAGGG + Intronic
1108281359 13:48865382-48865404 GAGGAAATATAGAGTTAAAAAGG + Intergenic
1108698797 13:52926256-52926278 GAGGAAACAAAGATGAGAAAGGG + Intergenic
1108866390 13:54928322-54928344 TAGGACATAGAGATTGAAAACGG + Intergenic
1108887981 13:55213086-55213108 AAAGAAATTCAAATGGAAAAGGG - Intergenic
1109190865 13:59322395-59322417 GAGGAAATAAAGATGCATAAAGG + Intergenic
1109343215 13:61088275-61088297 AAGGAAGTACAGTTGGAAGAGGG - Intergenic
1109379846 13:61544829-61544851 GAAGTAATACAGATGGTAAGTGG + Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109627162 13:64990985-64991007 GTGGAAATACAGACAGATAAAGG - Intergenic
1109751570 13:66699516-66699538 GAGGAGACACAGAGAGAAAAGGG + Intronic
1109991220 13:70060134-70060156 GAAGATATACAAATGGAAACAGG + Intronic
1110403389 13:75120596-75120618 AAGGAAATGAAGAAGGAAAAAGG + Intergenic
1110583025 13:77154353-77154375 GAGGAAGAAAAGAAGGAAAAAGG + Intronic
1110864687 13:80380840-80380862 GATGAAATACCTAGGGAAAATGG - Intergenic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1111036906 13:82686761-82686783 GAGCAAATACAGTTATAAAATGG + Intergenic
1111147755 13:84206581-84206603 GAGGGAATACAGATTAAATATGG + Intergenic
1111168273 13:84491558-84491580 GAGGAAAAACAGCTGGACATTGG + Intergenic
1111392829 13:87621050-87621072 GAGGTGATTAAGATGGAAAAAGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111655037 13:91141329-91141351 GAAGAAATACACTTGGAGAAGGG - Intergenic
1111871180 13:93834678-93834700 GTAGAAACAGAGATGGAAAATGG - Intronic
1111878800 13:93929833-93929855 GAAGAAAGACAGAGAGAAAAAGG + Intronic
1112971043 13:105263109-105263131 TAGGAGATACATATGGAAATTGG - Intergenic
1112992488 13:105531176-105531198 GATGAAATACAAAATGAAAAAGG + Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1114063906 14:19043876-19043898 GGGGAACTAAAGATGGAGAAGGG + Intergenic
1114098352 14:19356120-19356142 GGGGAACTAAAGATGGAGAAGGG - Intergenic
1114259862 14:21028704-21028726 GAGGTAATAGAGATGGATTATGG + Intronic
1114641458 14:24224831-24224853 CAGGAAATACAGAGGAAAAGAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114791674 14:25666524-25666546 AAGGAAATACACATGAGAAAGGG - Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115239588 14:31241433-31241455 GATTAAATAAAGATGGAAAGTGG - Intergenic
1115295765 14:31825120-31825142 GTAGAAATTCAGATGCAAAATGG - Intronic
1115442238 14:33449001-33449023 GAGGAAATAAAGGAGGAGAAGGG + Intronic
1116360168 14:43984201-43984223 GAGAAAATATAAAAGGAAAATGG - Intergenic
1116388108 14:44357746-44357768 TAAGAAATTCACATGGAAAAGGG + Intergenic
1116887473 14:50234835-50234857 GAAGACATACAAATGGCAAATGG + Intergenic
1116902342 14:50373333-50373355 GAGGAAATATAAATGATAAAGGG + Intronic
1117104051 14:52380973-52380995 GAAGAAATACGAATGGAAATGGG - Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117441647 14:55765819-55765841 GAGGAAACACAGAGGCAAAGAGG + Intergenic
1117549802 14:56823674-56823696 GACAAATTACAGAAGGAAAAAGG + Intergenic
1117770777 14:59132490-59132512 GATGAAATATAGGTTGAAAATGG - Intergenic
1117816753 14:59606708-59606730 GAGGAAATACAAAAATAAAAGGG - Intronic
1118000681 14:61520280-61520302 GAGGAAAGACAGGAGGAAAAAGG - Intronic
1118538821 14:66800788-66800810 GAGGAGATACAGAAAGAAATAGG - Intronic
1118582789 14:67320375-67320397 GAGGAACTGCAGATGCAAAGCGG - Exonic
1118921112 14:70150765-70150787 GAGGAACTCCAGAGGGAAAGGGG + Intronic
1119230748 14:72977578-72977600 GAGGAAAAAAAGCAGGAAAAAGG + Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119988096 14:79162846-79162868 GAGAAAATAGTGATGGAAAGGGG - Intronic
1120432321 14:84434765-84434787 GAGAAAATAGAGATGCAAACTGG + Intergenic
1120627984 14:86853057-86853079 GAGGAAATAGAGATAAGAAAAGG + Intergenic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121037045 14:90714888-90714910 GAGAAAATAGAGATGAAAATTGG - Intronic
1121637703 14:95465085-95465107 GAGGAAATGCAGACAGAGAATGG + Intronic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1121933768 14:97997534-97997556 GAGGAAACACAGCAGGAGAAAGG - Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123510289 15:20991989-20992011 GAGGAAATAGCCATGGAAATAGG - Intergenic
1123567506 15:21565739-21565761 GAGGAAATAGCCATGGAAATAGG - Intergenic
1123603769 15:22003032-22003054 GAGGAAATAGCCATGGAAATAGG - Intergenic
1124021695 15:25931304-25931326 GAGAAAAGACACATTGAAAAGGG - Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1125069993 15:35543512-35543534 GAGGAAAAAGAAATGTAAAAGGG - Intronic
1125086897 15:35740485-35740507 GGGGAAAGACAGGTAGAAAAGGG + Intergenic
1125136615 15:36351094-36351116 GAAGTAATAGAGATGGAAACAGG + Intergenic
1125245295 15:37629790-37629812 GGTGGAAGACAGATGGAAAAAGG - Intergenic
1125791382 15:42368959-42368981 GAGGAAAGAAACATGAAAAATGG + Intronic
1125874498 15:43132382-43132404 AAGGAAATACATGTGGAAATAGG - Intronic
1125934171 15:43620240-43620262 GGGGAGATATAGATGGAGAATGG - Intergenic
1125947276 15:43719706-43719728 GGGGAGATATAGATGGAGAATGG - Intergenic
1126052489 15:44699021-44699043 GAAGACATACAAATGGCAAACGG - Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126712414 15:51473777-51473799 GAAGAAACACACAAGGAAAATGG + Intronic
1127104476 15:55598291-55598313 GATGAAAGAAAGATGAAAAAAGG - Intergenic
1127120839 15:55770800-55770822 AAGGAAATACAGAGGTAAAGAGG - Intergenic
1127821712 15:62663638-62663660 GAGGAAATATAATTGAAAAAAGG + Intronic
1128058277 15:64717036-64717058 GAGGGAATACACAGGGAACAGGG - Intergenic
1128147153 15:65337989-65338011 GAGGAAATATACAAGGGAAAGGG + Intronic
1128690709 15:69722845-69722867 GAGGACACACAGCTGGAAAGGGG - Intergenic
1129275056 15:74439783-74439805 GAGGAGATACACATGCAAAAGGG + Intergenic
1129535672 15:76311818-76311840 GGGGAAATACAGGGGGAAATAGG - Intergenic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1131351130 15:91700926-91700948 GAAGAAATAGATAAGGAAAATGG + Intergenic
1132324005 15:100951268-100951290 ACAGAAAGACAGATGGAAAATGG + Intronic
1202975869 15_KI270727v1_random:292833-292855 GAGGAAATAGCCATGGAAATAGG - Intergenic
1132825318 16:1902139-1902161 GAGGAAGGAGAGAAGGAAAAAGG + Intergenic
1133828484 16:9300275-9300297 GAGGAAGTAGTGATGCAAAATGG - Intergenic
1133999930 16:10775060-10775082 TCGGAAAAACAGGTGGAAAAAGG + Exonic
1134231792 16:12435613-12435635 GAGGAAATACATATCTAAACTGG - Intronic
1135263908 16:21005206-21005228 AAGGAAATACAGAAGGAGAGAGG - Intronic
1135530416 16:23248316-23248338 GAGGAAATACATTAGGTAAAGGG + Intergenic
1136081336 16:27854307-27854329 GAGGAAAAGGAGAAGGAAAAGGG + Intronic
1136178901 16:28537679-28537701 GAGGAAAAGCAGGTGGTAAAAGG + Intronic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1137983901 16:53091796-53091818 GAGGAAGGAGAGAGGGAAAATGG - Intronic
1138373137 16:56543179-56543201 GAGGAAAGAAGGATGAAAAAAGG + Intergenic
1138764700 16:59587948-59587970 GAAGACATACAAATGGCAAACGG + Intergenic
1138900679 16:61265454-61265476 GGGGAAATAAGGAAGGAAAAAGG - Intergenic
1139277471 16:65741304-65741326 GAGGAAATGGAGGTGGAGAAAGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140779782 16:78284179-78284201 GAGGAAAATCAGATGGGAACGGG - Intronic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141650214 16:85388740-85388762 AAGGAAGGAAAGATGGAAAAAGG + Intergenic
1142013646 16:87731459-87731481 GGGGGAAAAAAGATGGAAAAAGG + Intronic
1142395470 16:89828954-89828976 GAGGAAAGAGAGAGGGAAAGAGG - Intronic
1142947992 17:3450880-3450902 GAGCACATACTGTTGGAAAATGG + Intronic
1143088927 17:4437015-4437037 GAGGAAGTGCTGATGGAGAAGGG - Intronic
1143311130 17:5990211-5990233 AAGGAAGTAGAGATGGAAAGAGG - Intronic
1144836814 17:18160867-18160889 GAGGTAGTACAGATGGAGACAGG - Intronic
1145118694 17:20236097-20236119 GTGGCAAGACAGCTGGAAAAGGG - Intronic
1145130255 17:20339567-20339589 GAGGAAATGCGGATTGAACAAGG + Intergenic
1146135251 17:30314436-30314458 TAGAAAAGACATATGGAAAAAGG + Intergenic
1146233741 17:31137529-31137551 GAGGAAATCCTCAAGGAAAATGG - Intronic
1146252607 17:31362532-31362554 AAGGAAATAAAGAAGGAGAAGGG - Intronic
1146463406 17:33066070-33066092 GAGGAAATCCTGATAGGAAATGG - Intronic
1148042046 17:44715517-44715539 AATGAAAGACAGATGCAAAATGG - Intronic
1148148730 17:45383545-45383567 GAGGAGATCCAGGTGGCAAACGG + Intergenic
1148246518 17:46034625-46034647 AAGGAAATAAAGATTGTAAAAGG - Intronic
1149096741 17:52850856-52850878 AATGAAATAAAGATGGAAGATGG - Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149576739 17:57719076-57719098 GAGGACTTACAGAAGGGAAAGGG + Intergenic
1150203586 17:63382299-63382321 GAGGAAAAAGAAATGGGAAAAGG - Intronic
1150490130 17:65568633-65568655 AAAGAAATAGAGCTGGAAAAGGG - Intronic
1150624716 17:66834576-66834598 GAGGACACACAGCTGGAAAATGG - Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150781549 17:68127053-68127075 GAGCAAATACTTCTGGAAAAGGG + Intergenic
1152773744 17:82187279-82187301 GAAGAAATAAAGGAGGAAAATGG + Intronic
1153140313 18:1964645-1964667 TGGGAAAAACAGCTGGAAAAAGG + Intergenic
1153559271 18:6354644-6354666 GAAGACATACAAATGGCAAATGG + Intronic
1153583134 18:6595605-6595627 AAGGTAACACAGATGGTAAATGG + Intergenic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1154130972 18:11736873-11736895 TAGGAAATACCTATGGACAAGGG + Intronic
1154175136 18:12082042-12082064 GTGGAAATAAAGATGGAATGGGG + Intergenic
1154279084 18:12985208-12985230 GACATAATACAAATGGAAAAGGG - Intronic
1155248206 18:23931338-23931360 GAAGAAATTGATATGGAAAAAGG - Intronic
1155937546 18:31769703-31769725 GAAGACATACACATGGCAAATGG + Intergenic
1155945696 18:31847919-31847941 GAAGAAAAACAGTTGAAAAAGGG - Intronic
1157056157 18:44231391-44231413 AAAGAAATACAGATAGAATATGG - Intergenic
1157266904 18:46232614-46232636 GAGGAAATAAAAATAGAAATCGG - Intronic
1157453146 18:47802788-47802810 GAGGGAAGACAGTTGGAGAAAGG + Intergenic
1157527668 18:48397275-48397297 GAGGAAATACATTTGGTTAAGGG - Intronic
1157902204 18:51529450-51529472 GAGGAAACACAAATGGCAAATGG + Intergenic
1158176259 18:54659964-54659986 GAAGAAATAAAGAGGTAAAAAGG + Intergenic
1158297563 18:56015656-56015678 GAGGAAAAACCGGTGCAAAAAGG - Intergenic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158611797 18:58947128-58947150 GAGGAAATACAGATGCCCATAGG + Intronic
1158701179 18:59748653-59748675 GAGGGAGTAAAGAAGGAAAAAGG - Intergenic
1158743200 18:60167221-60167243 GGGGAAGTACAGATGTGAAAGGG - Intergenic
1159084135 18:63768791-63768813 GAGGGAGGACAGATGGCAAAGGG - Intronic
1159112244 18:64072990-64073012 TAGAAAAGACAGGTGGAAAAAGG - Intergenic
1159553266 18:69918825-69918847 TGGAAAATACAGATGGAAAGTGG + Intronic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159710827 18:71757485-71757507 GAAGATATACAAATGGCAAAAGG + Intronic
1159859123 18:73626115-73626137 GAGGAGAGAGAGATAGAAAAGGG + Intergenic
1161640012 19:5416400-5416422 GAGGAGATACAGATGGCAAATGG - Intergenic
1161999793 19:7736480-7736502 GAGGAAAGAAAGAAAGAAAAAGG - Intergenic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162779273 19:12998170-12998192 GGAGAAAGAGAGATGGAAAAGGG - Intronic
1162788694 19:13052019-13052041 AAGGAAAGACAGAAGGGAAATGG - Intronic
1163420109 19:17209616-17209638 GAGGAAATACAAAGTGAAGATGG + Exonic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164219465 19:23180211-23180233 GAGTCAATTCAGGTGGAAAAAGG + Intergenic
1164324460 19:24179717-24179739 GAGGAAGTAAAGAGGGAAGAAGG + Intergenic
1164896678 19:31882973-31882995 GAAGAAATTCAAATGAAAAATGG - Intergenic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1165935640 19:39386924-39386946 GAATAAATACAGATTGAATAAGG + Intronic
1166224865 19:41388605-41388627 GAGGAACTAGAGGAGGAAAAAGG - Intronic
1167133522 19:47602970-47602992 GAGGAAAGAGAGAAAGAAAAAGG + Intergenic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168102296 19:54147734-54147756 AAGGAAAAACAGCTGGAAATTGG - Intronic
1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG + Intronic
925175131 2:1777758-1777780 GAAGCAAAGCAGATGGAAAACGG - Intergenic
925232054 2:2242080-2242102 GAGGAAAAACAGAGAGGAAAAGG + Intronic
925634502 2:5929929-5929951 GAACAAATAGAGATGGAATAGGG + Intergenic
926091582 2:10054412-10054434 GAGGAGATACATGTTGAAAACGG + Exonic
926297287 2:11577945-11577967 GAGGAAATAAGGGTGGAAGATGG + Intronic
926898405 2:17721553-17721575 TAGGGAATAAAGAGGGAAAATGG - Intronic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927017578 2:18981232-18981254 GAGGAGAAAAAAATGGAAAAAGG + Intergenic
927091219 2:19714176-19714198 GGAGAAATACAGATGAAAAACGG + Intergenic
927294451 2:21438316-21438338 GGAGAAATACAGAAGGAAGAGGG - Intergenic
927395467 2:22645819-22645841 GAAGAAATAAAGAAGGAAAAAGG + Intergenic
927512412 2:23652547-23652569 GAGGACATGCACATGGTAAAGGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928741555 2:34359931-34359953 GCAGAAATATAGATGGAAACAGG + Intergenic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
930178033 2:48320063-48320085 GAGGAAATACAGAAAAAAAGGGG + Intronic
930406478 2:50963326-50963348 AAGGAAATAAGGAGGGAAAAGGG - Intronic
931386300 2:61800708-61800730 GAGTAAATACAATGGGAAAATGG + Intergenic
931599081 2:63984424-63984446 GAGGAAAGACAGATACATAAAGG - Intronic
931884003 2:66596062-66596084 GAATAAATAAAGTTGGAAAAAGG - Intergenic
932310789 2:70738588-70738610 GAGGCAATACAGGTGTGAAATGG - Intronic
932626991 2:73305355-73305377 GAAGTAATAAATATGGAAAAGGG + Intergenic
932896277 2:75643731-75643753 GAGGCAATAGAGATAGAAAGTGG - Intergenic
933221949 2:79700711-79700733 GAGGGAATAGAGGTGGGAAAAGG + Intronic
934061178 2:88295730-88295752 GAGGATGTACAGTTTGAAAAGGG + Intergenic
935129716 2:100252554-100252576 GAGGAACTAAAGATGTAAAAAGG - Intergenic
935803965 2:106728530-106728552 TGGGAAATGGAGATGGAAAAAGG - Intergenic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
936597470 2:113862572-113862594 GAAGAAAAACAGAAAGAAAAAGG + Intergenic
936809198 2:116375808-116375830 GGGGAAAGACAGATGTTAAATGG - Intergenic
937062791 2:118992744-118992766 GAGGAAAGAAAGAAGGGAAAGGG - Intronic
937630273 2:124093735-124093757 GAGAAAATACTCATGGAATAAGG + Intronic
937699713 2:124850599-124850621 GAGACAAAACAGATGGTAAATGG + Intronic
938154495 2:128921302-128921324 GAAGAAAAACAAATAGAAAATGG - Intergenic
938723069 2:134083624-134083646 GAGGAGCTTCAGTTGGAAAAAGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939818475 2:146926221-146926243 GAGGAAATAAAAAGGAAAAAAGG + Intergenic
939958252 2:148544808-148544830 AAGGAAATAGAGATCCAAAAAGG + Intergenic
940037470 2:149325894-149325916 GAGGAAAGAGAGATGGAGAATGG + Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940536501 2:154952010-154952032 AAGGAAATACAGGAGGACAAGGG - Intergenic
940785453 2:157976402-157976424 GAAGAGATACAAATGGCAAACGG - Intronic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
941070347 2:160947866-160947888 GAGGAAAGTCACATGGAAACTGG - Intergenic
941114900 2:161461499-161461521 GAGGAAAAACCCATGCAAAAAGG - Intronic
941198587 2:162480840-162480862 AAGGAAAAAGAGGTGGAAAAAGG + Intronic
941237280 2:162990591-162990613 GAAGAAATAAAGGTGGAGAATGG + Intergenic
941263257 2:163323843-163323865 AAAGAAATACAGATGGCAAGTGG + Intergenic
942676954 2:178436901-178436923 GAGGAAAAGCAGAAAGAAAAAGG - Intronic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
942927605 2:181452589-181452611 GAAGATATACAAATGGCAAACGG - Intergenic
943683382 2:190791487-190791509 GGGGAAAAACAGATTCAAAATGG - Intergenic
943976519 2:194485391-194485413 GAGGATTTAAAAATGGAAAAGGG + Intergenic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
944271869 2:197793329-197793351 GAGGAAATACACACTTAAAAAGG + Intergenic
944360235 2:198845939-198845961 AAGGAAAGATAGATGCAAAAAGG - Intergenic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945384006 2:209175214-209175236 GATAAAATAAAGAAGGAAAATGG + Intergenic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945535365 2:211010995-211011017 GAGGAAAAGCAGATGTAAATTGG - Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946890141 2:224267046-224267068 GGGGAAAAAGAGATGGAGAAAGG - Intergenic
947080837 2:226394677-226394699 GAGATAATACAGTTGCAAAATGG + Intergenic
947340970 2:229138863-229138885 GAGGAAAAAAAAATGGAAAGCGG + Intronic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
948558413 2:238834163-238834185 GAAGAAATAAAGAAGGGAAATGG + Intergenic
1168845672 20:942904-942926 AAGGACAGACAGCTGGAAAATGG - Intergenic
1168866335 20:1090074-1090096 GAAGAAATAGAGATAGAAGATGG + Intergenic
1168881478 20:1209748-1209770 GAGGGGACAGAGATGGAAAAAGG + Intergenic
1169036922 20:2461490-2461512 GAGGATGTACAGATGCAAATGGG + Intergenic
1169740307 20:8886375-8886397 GATGACATACAAATGGCAAACGG - Intronic
1169990049 20:11492453-11492475 GAGGCAACAGAGATGAAAAATGG + Intergenic
1170229275 20:14027563-14027585 GAGGAAAAACCAATGCAAAAAGG - Intronic
1170778762 20:19404556-19404578 GAACAAATACAGAAGGAGAAAGG - Intronic
1171112006 20:22492709-22492731 GAGCAAAGACAGATGTAATATGG + Intergenic
1172792157 20:37513289-37513311 GAGCAAAGCCACATGGAAAATGG + Intronic
1172974761 20:38897877-38897899 GAAGACATACAGATGGACAACGG - Intronic
1173235475 20:41241287-41241309 GAAGACATACAAATGGCAAACGG - Intronic
1173608275 20:44347612-44347634 GATGAAAGAAAGAAGGAAAAAGG + Intronic
1174394107 20:50235443-50235465 GAAAAAAAACAGATGAAAAATGG - Intergenic
1174666663 20:52264409-52264431 GAGGAAAAAGAGATGAATAATGG - Intergenic
1174881161 20:54280828-54280850 TGGGAAATAAAGCTGGAAAAGGG - Intergenic
1174890471 20:54386344-54386366 GAGGAAATAAAGGAGCAAAAGGG - Intergenic
1175020204 20:55838935-55838957 GAGGAAGGGCAGATGGGAAAAGG - Intergenic
1177091431 21:16773988-16774010 GAGGAAATAGGTAAGGAAAAGGG + Intergenic
1177147185 21:17419549-17419571 GAGGAAATAAGAATGGACAAAGG - Intergenic
1177192222 21:17864621-17864643 GAGTCAATACAGTGGGAAAATGG + Intergenic
1177759708 21:25389599-25389621 GAGAAAAAACTGATGGCAAAAGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1177865787 21:26512052-26512074 GAGGAAAAAGAGATGTGAAAAGG - Intronic
1179462331 21:41545669-41545691 GAGGAAAGAAAGAAAGAAAAGGG + Intergenic
1179638640 21:42732035-42732057 GAAGAAAGACAGATGGAACACGG - Intronic
1180482398 22:15766509-15766531 GGGGAACTAAAGATGGAGAAGGG + Intergenic
1180654252 22:17405959-17405981 GAAGAAATAGAAAGGGAAAAGGG - Intronic
1182176349 22:28293777-28293799 GAAGAAACACAGTAGGAAAAGGG + Intronic
1182353678 22:29712631-29712653 GAGGACAGACAGATGGCAGAGGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182784218 22:32893160-32893182 GAGGAAGTGCAGATGAAGAAGGG - Intronic
1182916568 22:34038330-34038352 GAGGAAGGAAAGAAGGAAAATGG - Intergenic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949256626 3:2055065-2055087 GAAAAAATACAGCTTGAAAAAGG - Intergenic
949411435 3:3769383-3769405 GAGAGAATAGAGATGGAAAAGGG - Intronic
949681193 3:6516397-6516419 GAGTAACAACAGATGGAAACAGG + Intergenic
949741254 3:7237210-7237232 GAGGTAACAGAAATGGAAAAAGG - Intronic
949840784 3:8317461-8317483 GAGGAAAGAAAGATGAAGAAGGG - Intergenic
949955172 3:9261237-9261259 GAGGAAAAACCGAAGCAAAAAGG + Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
950850547 3:16058198-16058220 TAGTAAATATAGATGGCAAAGGG - Intergenic
951303168 3:21023471-21023493 AAGGCAAGACACATGGAAAAGGG + Intergenic
951363853 3:21756594-21756616 TAGGAAGTATAGATTGAAAAAGG + Intronic
951399337 3:22212191-22212213 GAGAAAAGACAGGTGGAAGAAGG + Intronic
951501804 3:23396624-23396646 GAGGCCATACAGATTGAAAGTGG - Intronic
951547864 3:23846724-23846746 TGGGTAATAGAGATGGAAAATGG + Intronic
951651878 3:24959638-24959660 GAGGAATTCTAGACGGAAAAGGG - Intergenic
951778629 3:26338390-26338412 GAAGACATACAGATGGCCAATGG - Intergenic
951793513 3:26513038-26513060 GAAGACATACAAATGGCAAATGG - Intergenic
952437993 3:33291942-33291964 TATGAAACACAGATTGAAAAAGG + Intronic
952497247 3:33926620-33926642 TGGGAAATATAGATGGAATAAGG - Intergenic
952536460 3:34315243-34315265 GAAGACATACAAATGGAAACAGG - Intergenic
952793797 3:37221147-37221169 GGTGAAATAGAGAAGGAAAAAGG + Intergenic
952846957 3:37695900-37695922 GAGGAAAGACAGAAGGAATGGGG - Intronic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
953711207 3:45272779-45272801 AAGGAAAAACAGGTGGAAACAGG + Intergenic
953892109 3:46759005-46759027 AAGCAAATACAGAATGAAAAAGG + Intronic
954041253 3:47889120-47889142 GAGGAAATACAGATTTTTAAAGG + Intronic
954054779 3:48012817-48012839 GATGAAATACAGATGCTAAGTGG - Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954813773 3:53264592-53264614 GAGAAAATATAGGGGGAAAATGG - Intergenic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
955853001 3:63241189-63241211 GAGGAAAGAGGGATGGCAAATGG + Intronic
956023695 3:64959424-64959446 GATGAAATACAGACTCAAAAAGG - Intergenic
956958093 3:74364574-74364596 GAGAGAACACAGATAGAAAATGG - Exonic
957038173 3:75314061-75314083 GAGGTAATACTGAGGGAACATGG + Intergenic
957558527 3:81792052-81792074 GTGGAAATACAGCAGAAAAAGGG - Intergenic
957816558 3:85306939-85306961 GAAGAAATACTGACTGAAAAAGG - Intronic
958162120 3:89830953-89830975 GATGAAAAACAGAAAGAAAAGGG + Intergenic
958501645 3:94918280-94918302 GAAGATATACCAATGGAAAAAGG - Intergenic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958578231 3:95980895-95980917 GAGGAAATAAAGTTTAAAAAAGG - Intergenic
958633924 3:96718146-96718168 GAGGACATGCTGTTGGAAAAAGG - Intergenic
959805879 3:110553229-110553251 GATGAAAAATAGCTGGAAAAAGG - Intergenic
959940988 3:112080942-112080964 GAAGAAAAAGTGATGGAAAATGG + Exonic
960051295 3:113241592-113241614 GAGGAAAAACAGAAAGAAAGTGG + Intronic
960323573 3:116267213-116267235 GAGGAAATAAAAATGAACAATGG + Intronic
960404590 3:117244398-117244420 GAGGAGCAAAAGATGGAAAAGGG - Intergenic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
961050931 3:123746417-123746439 GAGGAATACGAGATGGAAAAAGG + Intronic
961086188 3:124069368-124069390 GAGGAAATACTGAGGGAACCTGG + Intergenic
961091697 3:124118259-124118281 GAGGGACTACAGATGGCAGATGG + Intronic
961312468 3:126012229-126012251 GAGGAAATACACTTGGGATAAGG - Intronic
962015599 3:131436994-131437016 GAAGACATACAAATGGCAAACGG + Intergenic
962209269 3:133463351-133463373 AAGGAAATACACTTGGAAGAGGG + Intronic
962351657 3:134660832-134660854 GAGGCCATACAGAAGGAAAATGG - Intronic
962500625 3:135987944-135987966 GATGGAATACAGAAGTAAAAAGG - Intronic
962635251 3:137324883-137324905 GAGGAAATATAGGGGGAAAATGG - Intergenic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963558138 3:146822858-146822880 GAAGAAATACATATGGGCAATGG + Intergenic
963638425 3:147828593-147828615 GAGGATGTATAGACGGAAAAAGG + Intergenic
964887097 3:161496913-161496935 GAGGAAAGAGAGATGCCAAAGGG + Exonic
965001847 3:162964107-162964129 CAGGAAACAGAGATGGCAAAAGG - Intergenic
965103061 3:164327751-164327773 GAGGAAAGAGAGATGAAAAGTGG + Intergenic
965293070 3:166908996-166909018 GAGGAAAAACCAATGCAAAAAGG - Intergenic
965341252 3:167493886-167493908 GAGGAAATACAGACGAAGATGGG - Intronic
965492595 3:169357805-169357827 GAGAAAATAAAGACAGAAAAAGG + Intronic
965605372 3:170493167-170493189 GAGGAATTGCAGATGGAAGCAGG + Intronic
965677319 3:171211717-171211739 GATGAAAGTCAGATGGGAAAAGG + Intronic
965869047 3:173244668-173244690 ATTGAAATACAGAAGGAAAAAGG - Intergenic
966336973 3:178879258-178879280 GAAGAAATACAGACTGAGAAGGG + Intergenic
966371595 3:179256110-179256132 GAGCAAATACAGAAGTAAACAGG + Intronic
966583900 3:181599962-181599984 GAGGAAGTAGAGATGGTTAATGG - Intergenic
967363082 3:188654247-188654269 GAGGAGGTTCAGAAGGAAAATGG + Intronic
967409898 3:189156724-189156746 GAGGAAATACTGATAGATAGAGG - Intronic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
969172321 4:5374054-5374076 GAGGAAATGCAGAGGGGAGAAGG + Intronic
969195125 4:5555561-5555583 AAGGGAATACATATGGTAAAGGG + Intronic
969977200 4:11115939-11115961 GAGGAAATAAGCATGGAGAATGG - Intergenic
970166203 4:13241037-13241059 GAGGAACTACTGATGGCTAAGGG - Intergenic
970425151 4:15938942-15938964 TAGTAACTTCAGATGGAAAAAGG - Intergenic
970896527 4:21109789-21109811 GAGGAAATACACAAAGAATATGG - Intronic
971603282 4:28623725-28623747 CAGGAATGAGAGATGGAAAAGGG - Intergenic
971720162 4:30234342-30234364 GAGGAAATTAAGATAGAGAATGG + Intergenic
972130153 4:35822735-35822757 GACAAAAAACAGATGAAAAAGGG + Intergenic
973284227 4:48397366-48397388 AAGGAAATACAGAAGGAAAGAGG + Intronic
974046136 4:56900211-56900233 GAGGAAGGAGAGAGGGAAAAGGG - Intergenic
974063907 4:57059879-57059901 GGGGAAATTCCTATGGAAAATGG + Intronic
974080376 4:57206307-57206329 GAGGAAATAAGGATGGGAAAAGG - Intergenic
974480986 4:62442609-62442631 GAGGAATTGCATATGGAGAAAGG + Intergenic
974636986 4:64577954-64577976 GAGGACATACAAATGGGAGAGGG + Intergenic
974976308 4:68896923-68896945 GAGGACATACAGGTTGAAAGAGG - Intergenic
975708015 4:77129922-77129944 GAAGACATACAAATGGCAAACGG - Intergenic
976298764 4:83498433-83498455 AAGGAAAAAAAGAAGGAAAATGG + Intronic
976476676 4:85492054-85492076 GAGGAAATACGGGAGGAAGAGGG - Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977303821 4:95298631-95298653 GAAAAAATACAGCAGGAAAAGGG - Intronic
977322826 4:95540535-95540557 GAGGAGATCCAGAAGGAAAAAGG + Intronic
977651537 4:99475453-99475475 GAGGAAATAAAGGTGGAAGTAGG - Intergenic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977878830 4:102181228-102181250 GAGGTAATGTAGATGGAGAAAGG - Intergenic
977954462 4:103011177-103011199 GAGGAAATAGAAAAGGAGAAAGG + Intronic
978300242 4:107260560-107260582 GAAGAAAAGCAGATGGAAATAGG + Intronic
979360507 4:119758624-119758646 GATGGAATACAGATTTAAAAAGG - Intergenic
979677497 4:123426181-123426203 GAAGACATACAGATGGCAACAGG - Intergenic
979755723 4:124338328-124338350 GGGTAAATACTGGTGGAAAATGG - Intergenic
979851674 4:125578967-125578989 GGGGAAATTAAGAGGGAAAAGGG + Intergenic
979936513 4:126704297-126704319 GAGGAAAAAGAGATGGTCAAGGG - Intergenic
980157997 4:129129901-129129923 AAGGAAATACAGATGGACTTAGG + Intergenic
980535459 4:134115082-134115104 GAGTAAATACAAAAGGAAAGTGG - Intergenic
980667959 4:135963314-135963336 GAGGAAAAACAAATTGAAATTGG + Intergenic
981053471 4:140335091-140335113 GATGTAATAAAGATGTAAAAAGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981553622 4:145967505-145967527 GAGGAAAAACAGGCGCAAAAAGG - Intergenic
981599144 4:146465978-146466000 TAGAAAATACAGAAGGAAAGAGG - Intronic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982014056 4:151135260-151135282 GAGGAACTACAGGTGCTAAATGG + Intronic
982202200 4:152972012-152972034 GAAGAAGAACAGATGCAAAATGG + Intronic
982522866 4:156441143-156441165 TATGAAATACAGATGAAAAATGG + Intergenic
982597193 4:157401539-157401561 GAGGGAAAACAGAAGGCAAATGG + Intergenic
982996136 4:162348766-162348788 AAGGTCATACAGATGGTAAATGG + Intergenic
983890021 4:173021120-173021142 GAGGAAAGACAGAGGGGAGAGGG - Intronic
983958687 4:173727046-173727068 GAGGAAAAACAAGTGCAAAAAGG - Intergenic
984450315 4:179892388-179892410 ATGGAAATACAGCTAGAAAATGG + Intergenic
984950509 4:185004443-185004465 GAGGAAAGAAAGGGGGAAAATGG - Intergenic
985925568 5:3013683-3013705 GAGCAAATAAAGATGGAATAAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986657144 5:10025337-10025359 TAAGACATACAAATGGAAAACGG - Intergenic
987432255 5:17849217-17849239 AAGGAAAGACAGAAAGAAAAAGG - Intergenic
987569409 5:19636725-19636747 GAGAAAATTCTGATGGAATATGG - Intronic
987616715 5:20283464-20283486 GAAGACACACAAATGGAAAACGG + Intronic
987765936 5:22229750-22229772 GAGAAACTGCAGATGGAACATGG - Intronic
987845918 5:23285643-23285665 GAAAAAAGAGAGATGGAAAAAGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988308775 5:29529703-29529725 GAGGAATTACATAAGGAGAAAGG + Intergenic
989361060 5:40601701-40601723 GAGGAACTACAGAAAGACAAAGG + Intergenic
989429666 5:41338070-41338092 GAGGAAATATACAAGGAAGAGGG - Intronic
989698660 5:44235718-44235740 GAGGATATAAAAATGAAAAAGGG + Intergenic
989786157 5:45333264-45333286 GAAGACATACAAATGGCAAACGG - Intronic
989961808 5:50424941-50424963 GAGAAAGTAAAGATGGAAGAGGG - Intronic
990027621 5:51214420-51214442 AAGGAAAAAGAGATGCAAAATGG + Intergenic
990077209 5:51863522-51863544 GAGGAAACACAAATGAAAAATGG - Intergenic
990112283 5:52342030-52342052 AAGGACATACAGATGGAAACTGG + Intergenic
990598782 5:57336667-57336689 GCAGAAAGACAGATGCAAAAAGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990763967 5:59161758-59161780 AAGTAAATACAGGGGGAAAACGG - Intronic
990897477 5:60715016-60715038 GAGGAAACACCAATGCAAAAAGG - Intergenic
990993356 5:61706954-61706976 CAGGAAATACAGGAGGAAAGAGG - Intronic
991566755 5:68012861-68012883 AAGGAAATGCAGATACAAAAAGG - Intergenic
991672118 5:69058059-69058081 GAAGAAATACAAATGGCAAATGG - Intergenic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
992987602 5:82249624-82249646 GAGGAAACAGAGACGTAAAATGG + Intronic
993205892 5:84877922-84877944 GAAGATATACAAATGGCAAACGG + Intergenic
993404063 5:87488849-87488871 GAGGAAAGACAAATGCAAAAAGG + Intergenic
994217675 5:97157709-97157731 GAGGAAATAGAGAGGGAGATGGG - Intronic
994252315 5:97550749-97550771 GAGGAAATAAAGATTCAATAAGG - Intergenic
994300845 5:98145634-98145656 GAGAAAATAAGAATGGAAAATGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994588617 5:101744663-101744685 GAGACGATACAAATGGAAAAAGG + Intergenic
994656590 5:102601693-102601715 TAGGAAACACAGATGTCAAAAGG + Intergenic
994828436 5:104746361-104746383 GGGAAAATACAGATGGTAAGTGG - Intergenic
994965747 5:106668877-106668899 AAGGAAGGACAGAAGGAAAAAGG + Intergenic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995518265 5:112975682-112975704 GGGAAAAAAAAGATGGAAAACGG + Intergenic
996047188 5:118886469-118886491 GAGGAAATGCAGTTGAAAACTGG + Intronic
997331052 5:133062102-133062124 GATGAAATACAGCTGGAAAATGG + Intronic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997597795 5:135118728-135118750 GAGGCAATAGAGAAGGAAAAAGG + Intronic
997621044 5:135295621-135295643 GAGAAAATACAGAAGGAACCTGG - Intronic
997957347 5:138289409-138289431 AAAGAAATACAAATGGAAATGGG + Intronic
998003986 5:138645132-138645154 GAGGAAAAAAAAAAGGAAAAAGG + Intronic
998058436 5:139099137-139099159 GAAGACATACAAATGGCAAACGG + Intronic
998207294 5:140167097-140167119 GATGAAATACACATGGCATATGG + Intergenic
998755908 5:145379372-145379394 GAGGCAATGCAGCTGGAATAAGG + Intergenic
1000331697 5:160210963-160210985 GAAGAAAGTCAGATGGCAAAAGG - Intronic
1000457500 5:161469883-161469905 GAGAAAATAGAGATGAAGAAAGG - Intronic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1000917564 5:167100601-167100623 GTGGCAAGAAAGATGGAAAAGGG - Intergenic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1001055013 5:168442025-168442047 GAGGAAACACAGATGTGGAAGGG - Intronic
1001149722 5:169216650-169216672 GAGGAATTACAGATGAAATCAGG - Intronic
1001472880 5:172027524-172027546 GAGGGAAAAAAGATGGGAAAAGG - Intergenic
1001714697 5:173805730-173805752 GAGTACGTACAGATAGAAAAGGG - Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1003154994 6:3585747-3585769 GAGGAAGTACAGAGGGACATGGG - Intergenic
1003452336 6:6246522-6246544 GAGAAAATCCATTTGGAAAACGG - Intronic
1003456382 6:6286453-6286475 AAGAAAATACACTTGGAAAAGGG - Intronic
1004085690 6:12446751-12446773 GAGGAAATGCAGTCAGAAAAGGG - Intergenic
1004324230 6:14659386-14659408 GAGAAATTACAGATGGAAAGAGG - Intergenic
1004794567 6:19066921-19066943 GAGGAAAGAGAGAAGGAAAAGGG - Intergenic
1005036833 6:21562949-21562971 GAAGAAATACAAATGGCACACGG - Intergenic
1005532313 6:26720435-26720457 GAGGAAATAGAAATGAAAAATGG + Intergenic
1005536215 6:26758389-26758411 GAGGAAATAGAAATGAAAAATGG - Intergenic
1005538482 6:26781230-26781252 GAGGAAATAGAAATGAAAAATGG - Intergenic
1005640258 6:27789242-27789264 GAAGAAATAGAGAAGGAAAAGGG + Intergenic
1006194136 6:32227569-32227591 GATGAAATACTGTAGGAAAAAGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006932126 6:37694881-37694903 GAGAAAACACAGAGAGAAAAGGG + Intronic
1007433939 6:41794871-41794893 GAGGAAATTCAGACAAAAAATGG - Exonic
1007974855 6:46091012-46091034 GAGGATTTACAGACAGAAAAAGG - Intergenic
1008324739 6:50163901-50163923 GAGGAAATAAAAACAGAAAATGG + Intergenic
1008562680 6:52737604-52737626 GAGGAATTACAGCTGGAAAGAGG - Intergenic
1008847718 6:55988014-55988036 GAAGACATACAAATGGTAAACGG - Intergenic
1009007116 6:57800787-57800809 GAGGAAATAGAAATGAAAAATGG - Intergenic
1009009336 6:57823467-57823489 GAGGAAATAGAAATGAAAAATGG - Intergenic
1009054430 6:58317471-58317493 GAGGAAAAACTGGTGCAAAAAGG + Intergenic
1009236706 6:61133104-61133126 GAGGAAAAACTGGTGCAAAAAGG - Intergenic
1009294006 6:61920846-61920868 GTAGAAATATAGATGGAAAGAGG + Intronic
1009534014 6:64857684-64857706 TAGTAAATCCATATGGAAAATGG - Intronic
1010582697 6:77618991-77619013 TTGGGAATCCAGATGGAAAAAGG + Intergenic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1011120207 6:83943504-83943526 GAGGAAAAACCTATGCAAAAAGG + Intronic
1011344951 6:86358848-86358870 TTGGAAATAGAGAAGGAAAAGGG + Intergenic
1011350835 6:86421900-86421922 GAGGATGTACAAAGGGAAAATGG + Intergenic
1011441060 6:87387863-87387885 TAGGAAAGACAAAAGGAAAAAGG + Intronic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1011745370 6:90403016-90403038 GAGGAAAGAAAGGTGGAAAGAGG - Intergenic
1011936537 6:92785601-92785623 AAGGAAAGACAGAGAGAAAAAGG + Intergenic
1011982652 6:93402161-93402183 AAGGAAATACGGAAGGAAATAGG - Intronic
1012051948 6:94357880-94357902 GAGGAAATGGAGAAGGAAAAAGG - Intergenic
1012225373 6:96697616-96697638 GAAGACACACAAATGGAAAATGG + Intergenic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1013423713 6:109990933-109990955 GAAGAAATAAAGAAAGAAAAAGG + Intergenic
1013506184 6:110802528-110802550 GGGGAAAAACAGAGGAAAAAGGG + Intronic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013695132 6:112692919-112692941 GAGGGAAGAGAAATGGAAAAAGG + Intergenic
1013922581 6:115426224-115426246 GAAGACATACAGATGGCCAACGG + Intergenic
1013971860 6:116029798-116029820 AAGGACCTTCAGATGGAAAAGGG - Intronic
1013976726 6:116087632-116087654 GAGAAGATACAGAAGGAACAGGG + Intergenic
1014497297 6:122141455-122141477 AAGGACACACAGATAGAAAAAGG - Intergenic
1014683299 6:124461854-124461876 GAAAAAAGAAAGATGGAAAAAGG - Intronic
1014855845 6:126399500-126399522 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014855847 6:126399556-126399578 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014926354 6:127275790-127275812 GAGGAAATACAGAGCTACAAAGG + Intronic
1015228483 6:130886046-130886068 GAGGAGCTACAGATGGACAGAGG - Intronic
1015387801 6:132645653-132645675 GATGAAAGACAAATGGAAAATGG + Exonic
1015526047 6:134175889-134175911 AAGGAAAGAAAGAGGGAAAAGGG + Intronic
1015633332 6:135252698-135252720 GAGGCAATTCAGGAGGAAAATGG - Intergenic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016749188 6:147613787-147613809 GAGGAAAAAGGGAAGGAAAATGG + Intronic
1017047191 6:150357671-150357693 AAGGAAATAGAGATGGCAGAGGG + Intergenic
1017406405 6:154124101-154124123 GAGGAAAAACAGATTGACAGTGG + Intronic
1017602777 6:156101765-156101787 GAGGAAATCCTTAAGGAAAAAGG + Intergenic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1017651206 6:156584141-156584163 GAAGACATACAAATGGCAAACGG + Intergenic
1017684993 6:156904233-156904255 GAGGAAAAAAATATGGAAGAAGG - Intronic
1018457772 6:163967959-163967981 GAGGAGATATTGATGGAGAAAGG + Intergenic
1018458567 6:163975434-163975456 GATGATAGACAGGTGGAAAATGG + Intergenic
1018757966 6:166865908-166865930 AAGGAAAGACGGATGGAGAAGGG + Intronic
1018863108 6:167726335-167726357 TAGGAAATACAAAGAGAAAATGG + Intergenic
1018965043 6:168478452-168478474 TAGGAAATAAGGTTGGAAAATGG + Intronic
1019106651 6:169673203-169673225 AACAAAATACAGAGGGAAAATGG + Intronic
1020586008 7:10068878-10068900 GAGGAAATACAGATTTTTAAAGG + Intergenic
1020842028 7:13230097-13230119 GAAGAGAGACAGAGGGAAAAAGG - Intergenic
1020986043 7:15135845-15135867 GAAGAAAGACAGCTGGAAGAAGG - Intergenic
1021345380 7:19521039-19521061 AAGGAAATAAAGATGGGCAAAGG + Intergenic
1021772365 7:24018229-24018251 GAGGGAAAACAGATGTAAATAGG - Intergenic
1022755861 7:33288576-33288598 GATGAAATACAAGAGGAAAAAGG - Intronic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1024960929 7:54975258-54975280 GAGAAAGGACAGGTGGAAAAGGG + Intergenic
1027430096 7:78103025-78103047 GAGGAATTCCAGATAGAAGAAGG - Intronic
1027459227 7:78431600-78431622 AAGAAAATGCAGATGGTAAATGG + Intronic
1028200832 7:87958773-87958795 GAGGAAATACAGATCACCAAAGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028796988 7:94914026-94914048 AAAGAAACACAGATAGAAAATGG - Intronic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1029453892 7:100657459-100657481 GAAGAGAGACAGATGGAGAAAGG - Intergenic
1030265777 7:107620579-107620601 TAGGTAATTCTGATGGAAAAAGG - Exonic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030618320 7:111761719-111761741 GAGGAAATACAGCAGGAACTGGG + Intronic
1031257072 7:119466802-119466824 GAGGAAGTGCAGAAGGGAAAGGG + Intergenic
1031335170 7:120520501-120520523 GAGGAAATACACATGAGAAATGG + Intronic
1031786799 7:126043599-126043621 TATGAAATAAAGAGGGAAAAGGG - Intergenic
1031936918 7:127744733-127744755 GCAGAAATACAGGTGCAAAAAGG + Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032684168 7:134213864-134213886 TTGTAAATATAGATGGAAAATGG - Intronic
1032685203 7:134225539-134225561 GTGGAAATACAAATGTAACAAGG + Intronic
1032849374 7:135781037-135781059 GAGGAAACACAAATGAATAAAGG + Intergenic
1033439565 7:141366702-141366724 GAAGAAAAGCAGAAGGAAAATGG - Intronic
1033530591 7:142258973-142258995 GAATATATACAGATGGTAAATGG + Intergenic
1033882757 7:145906474-145906496 GAGCAAGTGCAGATGCAAAAAGG + Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034212801 7:149379699-149379721 GAGGAAAAACAGATGCAGAAAGG - Intergenic
1035318814 7:158014890-158014912 GAGGAAAGACAGATGGAGATAGG - Intronic
1035611347 8:966810-966832 GTGGAAATAAAGCTGGAAGAAGG - Intergenic
1035820575 8:2587388-2587410 AAAGAAATAAAGAAGGAAAAAGG - Intergenic
1036034031 8:4999775-4999797 GAAGAAACCCAGATGGAGAATGG + Intergenic
1036102016 8:5797515-5797537 GAGGAAAAACATAAAGAAAAGGG + Intergenic
1036648222 8:10625402-10625424 GAGGAAAGACACAGGGAAGAGGG + Intronic
1037462308 8:19123673-19123695 GAAGATTTACAGATGGCAAATGG - Intergenic
1037512441 8:19597681-19597703 GAGAAAATACAGATGTTAAAAGG + Intronic
1037719769 8:21432395-21432417 GAGGAAAAACCCATGCAAAAAGG + Intergenic
1038086795 8:24206906-24206928 GGGGAAACAAACATGGAAAAGGG - Intergenic
1038324773 8:26564556-26564578 GAGGAATCACAAATGGAATAAGG - Intronic
1038863936 8:31418182-31418204 GAAGAAAAAGAGAAGGAAAATGG - Intergenic
1039340821 8:36647946-36647968 GAGGAAACCAAGAAGGAAAAGGG + Intergenic
1039480734 8:37871560-37871582 GAAGAAAAACCGATGGGAAATGG - Exonic
1039913922 8:41845770-41845792 GGAGAAAAACAGATGGAGAAGGG - Intronic
1039954201 8:42194934-42194956 GAGGAGAGGCAGATGGAAACTGG - Intronic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040381052 8:46873413-46873435 TAAAAAATATAGATGGAAAATGG + Intergenic
1040516494 8:48139525-48139547 GAGGAAATACATTCCGAAAATGG + Intergenic
1041191254 8:55357391-55357413 GTGGAAATTCAGGTGGAGAATGG - Intronic
1041236673 8:55809804-55809826 AAAGAAATACAGATGAAAATAGG + Intronic
1041237009 8:55813801-55813823 GAGGTAATGTAGAAGGAAAAAGG - Intronic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041938313 8:63359067-63359089 GAGGACACACAGCTAGAAAATGG - Intergenic
1041943181 8:63410888-63410910 AAGGTAATACAGCTGGTAAATGG - Intergenic
1042760212 8:72264225-72264247 GAGAAAAAACAGAGAGAAAAAGG - Intergenic
1044439899 8:92210695-92210717 TCTGAAATACAGATGTAAAAGGG + Intergenic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045542522 8:103100360-103100382 GAAGAAAAACAGAAAGAAAACGG + Intergenic
1045839200 8:106560225-106560247 GAGGAAATGCAGTTGTAAAAGGG + Intronic
1046037531 8:108862111-108862133 GAGGAAATCCAGACATAAAAGGG + Intergenic
1046067863 8:109218116-109218138 GAGGAAAAACCAATGCAAAAAGG - Intergenic
1046108639 8:109694831-109694853 AAGGAAATACAGAGAGAGAAAGG - Intergenic
1046686397 8:117232290-117232312 GGGGAAATGCAGATGAAACATGG + Intergenic
1046811953 8:118542996-118543018 GAGAAAATAAGGAAGGAAAAAGG + Intronic
1046852448 8:118990314-118990336 AAGGAAATCGAAATGGAAAAGGG + Intergenic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1047217888 8:122893414-122893436 GAGGGAGAAGAGATGGAAAAAGG - Intronic
1047266330 8:123312837-123312859 GAGAAAATACAGAGTGTAAATGG + Intergenic
1047380581 8:124358612-124358634 GAGGATTTATGGATGGAAAAAGG - Intronic
1047789054 8:128183806-128183828 GAGGAATAAAAGAAGGAAAAAGG - Intergenic
1047848777 8:128833513-128833535 GAGCAAAAACAGATGTCAAATGG - Intergenic
1047887550 8:129268565-129268587 GAGGAAATGAAGAATGAAAAAGG - Intergenic
1048153101 8:131913373-131913395 CAAGAAATACATATGCAAAAGGG - Intronic
1048607936 8:135989590-135989612 GAGGAAATCAAGATGGAGAGAGG + Intergenic
1048644236 8:136400237-136400259 GAAGAAAAAGAGATGGAAAAGGG + Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1048805163 8:138233896-138233918 GAAGACATACAAATGGCAAATGG + Intronic
1051760773 9:20461351-20461373 GAAGAAAAACACATGGAAAGGGG + Intronic
1051817270 9:21122433-21122455 GAGGAAAGTCTGTTGGAAAAGGG - Intergenic
1052103389 9:24479799-24479821 GAAGAAATAAAAATGGAAAATGG + Intergenic
1052118935 9:24684568-24684590 GAGAAAATACAGAGGCAAAGTGG - Intergenic
1052170267 9:25386257-25386279 TAGGAAATACAGATCTAAACTGG - Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1052479358 9:29003045-29003067 GTGAAAATACGGATAGAAAATGG + Intergenic
1052515894 9:29479076-29479098 GAGTATAGATAGATGGAAAAAGG - Intergenic
1052517601 9:29503351-29503373 GAGGAAGTACACTTGGAAGAGGG + Intergenic
1052527047 9:29631362-29631384 GTGCAAAAAGAGATGGAAAAGGG - Intergenic
1052610876 9:30772334-30772356 GGTGAAATGCAGGTGGAAAATGG - Intergenic
1052943352 9:34147740-34147762 GAAGAAATTTTGATGGAAAAGGG - Intergenic
1052944177 9:34154305-34154327 GGTGAAATGGAGATGGAAAATGG + Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053331927 9:37219548-37219570 CAGGAAATACAGAGGCTAAATGG - Intronic
1054821183 9:69521854-69521876 GAGGACAAAGAGATGGAAAGGGG + Intronic
1054822908 9:69541482-69541504 GAGGACATACAGATGGTCAATGG - Intronic
1055041296 9:71876258-71876280 AAGGACATACAGCTGGCAAACGG - Intronic
1055235381 9:74116110-74116132 CAGCAAATACATATGCAAAAGGG - Intergenic
1055441594 9:76342048-76342070 AAGGAAATATAAATGCAAAATGG - Intronic
1055712516 9:79079036-79079058 GAAGGAATACAAATGGGAAATGG + Intergenic
1055884202 9:81039943-81039965 GAGGAAATATAGTTAAAAAAAGG - Intergenic
1056533798 9:87510420-87510442 AAGGAAATACACATGCGAAATGG + Intronic
1056855462 9:90124845-90124867 GAGGAAATAAAGAGGTACAAGGG + Intergenic
1057061976 9:92012176-92012198 GAGGAAAAACAGGCTGAAAAAGG + Intergenic
1057598043 9:96433388-96433410 GAGGAAGAAAAGGTGGAAAATGG + Intergenic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1058318124 9:103594384-103594406 TAGGGAATACAGAGGGCAAATGG - Intergenic
1058406426 9:104680587-104680609 GAAGACATACAAATGGCAAAGGG + Intergenic
1058900247 9:109435858-109435880 TAGGAAATAAGGAAGGAAAATGG - Intronic
1058955786 9:109946746-109946768 GAGGAAAAAAAAAAGGAAAAGGG + Intronic
1059180906 9:112211233-112211255 GAACATATACAGAAGGAAAATGG - Intergenic
1059212224 9:112524061-112524083 GTGGAGATATAGATGGGAAATGG - Intronic
1059552410 9:115242712-115242734 GAAGAAATAAAGAGGAAAAAAGG + Intronic
1059721668 9:116965861-116965883 TAGGAAGCACAGATGGTAAAGGG - Intronic
1060112759 9:120918598-120918620 GAGGAAATCCAGTGGGAAAATGG - Intronic
1060203856 9:121670112-121670134 AAAGCAATAGAGATGGAAAACGG - Intronic
1060784660 9:126441154-126441176 GAGTAAATACAGAGGAAAAAGGG - Intronic
1060867773 9:127013537-127013559 GGGGACAGACAGGTGGAAAAGGG - Intronic
1061038299 9:128125554-128125576 GAGGAACTAGAGATGGAAGGGGG + Intronic
1061938849 9:133873363-133873385 CAAGACATACAGATGGCAAAGGG + Intronic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186716057 X:12252883-12252905 GAGGAAATACACTTAGAAATAGG + Intronic
1187736703 X:22312174-22312196 GAGGGAAGACAAATGGAAGAAGG + Intergenic
1187830345 X:23374641-23374663 GATGAAACCCAGAAGGAAAACGG - Intronic
1188304033 X:28540618-28540640 GAAGACATACAAATGGCAAACGG + Intergenic
1188758167 X:33990033-33990055 GAGGGAAAGCAAATGGAAAACGG + Intergenic
1189613516 X:42762725-42762747 GAGGAAAGAAACATGAAAAATGG - Intergenic
1189713826 X:43844266-43844288 CAGGAAATCCAGATGCATAAGGG - Intronic
1189733178 X:44043231-44043253 GAGGAAATGGAGATTTAAAAAGG + Intergenic
1190291750 X:48997620-48997642 GAGGAAGTAGAGATGGGGAAAGG + Intronic
1191793294 X:64993903-64993925 GAGGAAACTCAGATGCAAATAGG + Intronic
1191956041 X:66643241-66643263 GAGTAAACACAGATGGAGACAGG - Intergenic
1192858326 X:75038497-75038519 GAGGAAGTAGAGATAGAAATAGG - Intergenic
1193172689 X:78355055-78355077 GAAGACATACAAATGGCAAACGG - Intergenic
1194150013 X:90312158-90312180 GAGGAAAATCTGATAGAAAAAGG - Intergenic
1194215430 X:91124732-91124754 AAGGAAATACACCTGGAAGAGGG - Intergenic
1194223944 X:91231323-91231345 GAAGACATACAAATGGCAAATGG + Intergenic
1194249612 X:91558833-91558855 GAAGACATACATATGGCAAAAGG + Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1195138052 X:101931251-101931273 GAGGAAATACCGAAGAAATAAGG - Intronic
1195295357 X:103471189-103471211 GAGTGAATACACAAGGAAAATGG + Intergenic
1195554384 X:106205129-106205151 GAGCAATTACAAATGGAGAAGGG - Intronic
1195701805 X:107711362-107711384 GAGAAAAAGCAGATGAAAAAAGG - Intergenic
1195789089 X:108561550-108561572 TACCTAATACAGATGGAAAAAGG - Intronic
1195986225 X:110633528-110633550 GAAGACATACAAATGGCAAATGG + Intergenic
1196502897 X:116406165-116406187 GAGGAAAACCAATTGGAAAAGGG - Intergenic
1196626555 X:117883818-117883840 GAAGACATACAAATGGCAAACGG + Intergenic
1196758323 X:119177466-119177488 GAGAAACCACAGATGGGAAATGG + Intergenic
1196826808 X:119747431-119747453 GATGAAATTCAGTTGGTAAACGG - Intergenic
1196841998 X:119867616-119867638 GAGAAAACACAGATGATAAAAGG - Intergenic
1197334270 X:125192988-125193010 GAGGAAATAGAAATGGGAAATGG - Intergenic
1198281591 X:135148209-135148231 GAAGAGACACAGATGGAAATAGG + Intergenic
1198289368 X:135224313-135224335 GAAGAGACACAGATGGAAATAGG - Intergenic
1198519121 X:137434409-137434431 GAGGAAAAACCAGTGGAAAAAGG + Intergenic
1198925297 X:141784853-141784875 GAAGACATACACATGGCAAATGG - Intergenic
1199341533 X:146683262-146683284 GAAGACATACACATGGCAAACGG - Intergenic
1199353675 X:146834958-146834980 TAGGATATACATATAGAAAAGGG - Intergenic
1199418981 X:147620951-147620973 GAAGACATACAAATGGTAAATGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200496441 Y:3889241-3889263 GAGGAAAATCCGATAGAAAAAGG - Intergenic
1200560409 Y:4694704-4694726 GAAGACATACAAATGGCAAATGG + Intergenic
1200568569 Y:4800083-4800105 GAAGACATACATATGGCAAAAGG + Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1201277309 Y:12311296-12311318 GAAGATCTACAGATGGAAACAGG - Intergenic