ID: 977078929

View in Genome Browser
Species Human (GRCh38)
Location 4:92497712-92497734
Sequence CTGGAAAAAAAGATTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977078929 Original CRISPR CTGGAAAAAAAGATTGTGCA GGG (reversed) Intronic
900027696 1:292289-292311 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900041651 1:471731-471753 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900063086 1:706708-706730 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900099706 1:956504-956526 CTGGAAAAAAACACTGTGAGAGG + Intronic
903167058 1:21527891-21527913 AAGGAAAAAAAGATTGAGCTGGG - Intronic
904633743 1:31863608-31863630 CTGAAAAATAAGATTGAGAAGGG + Intergenic
904931627 1:34092376-34092398 CTGGAAAAATAGATTGTCGGGGG + Intronic
904951004 1:34238746-34238768 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
905586065 1:39119603-39119625 GTGGAAAGAAACATTGTGAAAGG - Intronic
908327384 1:63036449-63036471 ACGGAAAAAAAAATTGTACAGGG - Intergenic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
908737772 1:67293695-67293717 CAGGCACAAAAGATTGTGGAAGG - Intergenic
911945918 1:104108617-104108639 AGGGAAAAAGAGCTTGTGCAGGG - Intergenic
912919172 1:113849019-113849041 CTGGAAAAAGAGATAGTGGTTGG + Intronic
912964609 1:114226939-114226961 CAGGAAAAAAAAATGGTGCCTGG + Intergenic
912993156 1:114509588-114509610 CTGGAACTAAAGACTGTGTAGGG - Intronic
913392288 1:118327713-118327735 CAGGAAAGAGAGAGTGTGCAGGG - Intergenic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
914786298 1:150834853-150834875 ATTGAAAATAACATTGTGCAAGG + Intronic
914828523 1:151153652-151153674 CTCGAAAAAAAAATTGTTCTTGG + Intergenic
917035317 1:170742173-170742195 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
917035614 1:170744395-170744417 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
918236276 1:182583397-182583419 CAGGAAAAAAAGAATGTTCAAGG - Intronic
919054782 1:192556362-192556384 TTAGAAAAAAAGATTGAGCATGG + Intergenic
919059901 1:192619239-192619261 ATGGAAATAAAGATTGAGAATGG - Intergenic
919398475 1:197080501-197080523 AGGGAAAAAGAGCTTGTGCAGGG - Intergenic
919529237 1:198695600-198695622 ATGGTAAAAAAAATTCTGCAGGG - Intronic
920274865 1:204797069-204797091 CAGGCAAAAGAGAGTGTGCAAGG - Intergenic
920938544 1:210458700-210458722 CAGGAAAAATAGATTGGGCTTGG + Intronic
922074344 1:222228011-222228033 CAGGAAAAAGAGCTTGTGCAGGG + Intergenic
922260029 1:223931733-223931755 CTGGACAAACAGAGTGTGCTGGG - Intergenic
923612684 1:235509443-235509465 CTGGAAAGAAAGATTGGGGTGGG - Intergenic
924277954 1:242407175-242407197 AGGTAAAAAAAGCTTGTGCAGGG - Intronic
924341194 1:243034293-243034315 CTGGACAAACAGAGTGTGCTGGG - Intergenic
924886631 1:248224952-248224974 TTAGAAAAAAACATTGTGCCAGG - Intergenic
1064261460 10:13789907-13789929 CTGGAAAAAAATTATGAGCAAGG + Intronic
1066354865 10:34673110-34673132 CTGGAAAAAAAAAATCTTCATGG + Intronic
1067061124 10:43078393-43078415 CTGGAAACTCAGTTTGTGCAGGG - Intronic
1068086534 10:52380173-52380195 CTGAAAAAAAAAATTTTGCCGGG - Intergenic
1068344074 10:55747975-55747997 ATGGAAAAACAGATAGGGCACGG - Intergenic
1070662673 10:78318829-78318851 CTGGCAAGAGAGCTTGTGCAGGG + Intergenic
1072145537 10:92632800-92632822 CTGAACAAATAGTTTGTGCATGG - Intronic
1073783906 10:106867156-106867178 ATGGAAAAAAAGAATGTTAAAGG + Intronic
1073817731 10:107225649-107225671 CAGGAAAAAAAAACTGTCCATGG - Intergenic
1073868622 10:107834458-107834480 CTGGAAAATAATGTTGTACAAGG + Intergenic
1074575815 10:114668153-114668175 CTGAATAAAAAAATTGTACATGG + Intronic
1074784763 10:116829223-116829245 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1075540670 10:123311130-123311152 CTGGACAACAAGATTGTGTTGGG + Intergenic
1076025074 10:127105118-127105140 CAGGCAACAAAGTTTGTGCAAGG - Intronic
1076967926 11:107959-107981 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1078573903 11:12482739-12482761 CAGGCAGAAAAGCTTGTGCAGGG + Intronic
1078858207 11:15223808-15223830 CTGGAAAAACAGATTAGCCAAGG - Intronic
1079753965 11:24232966-24232988 ATGGAAAACAAAAATGTGCAGGG - Intergenic
1079985339 11:27194138-27194160 GAGGAAAAAAAAATTCTGCAGGG + Intergenic
1080024261 11:27597229-27597251 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1080104338 11:28496249-28496271 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
1080324392 11:31053167-31053189 CTGAAATACAAGATTGTCCAAGG + Intronic
1080340107 11:31252527-31252549 CTGGAAAAAAAGAGAGGGTAGGG + Intronic
1081431296 11:42979296-42979318 CAGGGAAGAGAGATTGTGCAGGG - Intergenic
1082002918 11:47403581-47403603 CTGGAAAGAAGGATTGAGAAAGG + Intergenic
1085846007 11:80065898-80065920 CTGTAATAAAAGTATGTGCAAGG + Intergenic
1086551935 11:88062806-88062828 CAGGAGAAATAGATTATGCATGG - Intergenic
1086734884 11:90294062-90294084 CTGGCAAGAAAGTATGTGCAGGG - Intergenic
1087621269 11:100545618-100545640 CTGGAAAAAATGAATGTTTATGG + Intergenic
1088367927 11:109058480-109058502 CTGAAAAAAAAAATTATTCACGG + Intergenic
1088548127 11:110982159-110982181 CTGGACAGAAAGAATGTGAAAGG + Intergenic
1088684349 11:112272432-112272454 CTGGAAAACATGAGTGAGCAAGG - Intergenic
1089648739 11:119897766-119897788 CAGGAAAGAAAGAGTGAGCAGGG - Intergenic
1089806357 11:121094180-121094202 CTTGAAGACAATATTGTGCAAGG - Intergenic
1095836000 12:46638991-46639013 CGGGAAAAAGACTTTGTGCAGGG - Intergenic
1096168852 12:49449689-49449711 CAGGCAAGAAAGTTTGTGCAGGG + Intronic
1096231545 12:49899556-49899578 CTGAAAGAATAGAATGTGCAGGG - Intronic
1097459810 12:59847180-59847202 CTTGAAAAAAAGATGGTGGGGGG - Intergenic
1097587248 12:61529797-61529819 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1097587328 12:61530389-61530411 CAGGAAAGAGAGCTTGTGCAGGG + Intergenic
1097715971 12:62966609-62966631 CAGGAAAAAATGGTTATGCAGGG - Intergenic
1097821104 12:64130154-64130176 CAGGTAAAAAAGAGTGTGCATGG - Intronic
1098389592 12:69955427-69955449 CTGGAAATAAAGTAAGTGCATGG + Intronic
1098676483 12:73295311-73295333 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1099305705 12:80952506-80952528 ATGGAAAAATAGATTTTGTAAGG + Intronic
1099757374 12:86870390-86870412 CAGGCAAGCAAGATTGTGCAGGG + Intergenic
1100057642 12:90532424-90532446 CTGGAAAAAAAAAATAAGCAGGG - Intergenic
1100274210 12:93057127-93057149 CTGGACAAAAAGAATATGAAAGG - Intergenic
1100730337 12:97460169-97460191 CAGAAAAAAAAAATTGTGAAAGG - Intergenic
1101975703 12:109356299-109356321 CTGGAACAAAAGATATTTCATGG - Intronic
1102965693 12:117123847-117123869 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1103040501 12:117691331-117691353 CTGCAAAGAAAGATGGTGCCAGG + Intronic
1104708016 12:130962476-130962498 CTGGGAAAAAAAATTGTAAAAGG - Intronic
1106166254 13:27249290-27249312 GTGCAAAAAAATATAGTGCATGG + Intergenic
1107591434 13:41910848-41910870 CTGAAATAAAAGAGTGTACAAGG + Intronic
1107679291 13:42831637-42831659 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1108460136 13:50657534-50657556 CTGGAGAAAGGGATTGTGCTGGG - Intronic
1109004557 13:56855340-56855362 CAGAAAAAAAAGAATGTGAAAGG + Intergenic
1109879195 13:68449742-68449764 CAGCAAAGAGAGATTGTGCACGG - Intergenic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1110645384 13:77877510-77877532 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1110886977 13:80651990-80652012 CTGGAAAAAGAGATTTTGCAGGG + Intergenic
1111435113 13:88196508-88196530 CAGGAAATAGAGAGTGTGCAGGG - Intergenic
1112554455 13:100453507-100453529 ATGGAGAAAAAGAAAGTGCAGGG + Intronic
1112588934 13:100746096-100746118 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1112662824 13:101532685-101532707 ATGCAAAAAAAGACTTTGCAAGG - Intronic
1113437610 13:110306206-110306228 CTAGAAAAACAATTTGTGCATGG + Intronic
1113593162 13:111514643-111514665 ATGGAAGAAAAGAGTCTGCAAGG + Intergenic
1114143712 14:19948126-19948148 CTGAAAAAAATGAGTCTGCACGG - Intergenic
1114844373 14:26303333-26303355 CTTGAAAAAAAAATTGTCTAAGG + Intergenic
1114917922 14:27290046-27290068 CAGGCAAGAGAGATTGTGCAGGG + Intergenic
1115031694 14:28803560-28803582 CAGGCAAGAAAGCTTGTGCAGGG + Intronic
1115482745 14:33877893-33877915 CTGGCAAGAAAGCATGTGCAGGG - Intergenic
1116029652 14:39555375-39555397 CTGGAGAAAAAAATTGTGGCAGG - Intergenic
1116413641 14:44654190-44654212 ATGGAAATAAACATTGTGGAAGG + Intergenic
1116662183 14:47724568-47724590 CTCCAAAAAAAGAAAGTGCAAGG - Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1117740603 14:58815524-58815546 CTGGCCAGAAAGAATGTGCATGG + Intergenic
1117748732 14:58898554-58898576 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1117987866 14:61406193-61406215 CAGGAAAAAAAAAATGTACAGGG + Intronic
1118143447 14:63110460-63110482 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
1118464889 14:66022099-66022121 CAGGAAAAAAATATTGTTCAGGG + Intergenic
1119489223 14:75016081-75016103 CGGGAAAAATAGATTGAGAATGG + Exonic
1120201142 14:81539645-81539667 ATGGAAAAAAAGATAATGCAGGG + Intergenic
1120347467 14:83308792-83308814 CTGGAAAATAAAATTTTACAGGG - Intergenic
1120694073 14:87624526-87624548 CTGGAAATAAAGTGTGTACATGG - Intergenic
1120965610 14:90165068-90165090 CTGGCAAGAGAGCTTGTGCAGGG + Intronic
1121128973 14:91428158-91428180 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1121300958 14:92870604-92870626 CGGGAAAAAGAGCTTGTGCAAGG + Intergenic
1121301155 14:92872385-92872407 CGGGAAAAAGAGCTTGTGCAAGG + Intergenic
1121301291 14:92873535-92873557 CGGGAAAAAGAGCTTGTGCAAGG + Intergenic
1121401018 14:93677422-93677444 CAGGCAAAAGAGCTTGTGCAGGG + Intronic
1123693678 15:22861144-22861166 CTGGAAAAACAAATTATACAGGG - Intronic
1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG + Intergenic
1125183200 15:36901047-36901069 CTGGAATTGAAGATTCTGCATGG + Intronic
1126251077 15:46568586-46568608 CTGGCAAAGAATATTGTCCAGGG + Intergenic
1126297316 15:47154963-47154985 CTAGAAAAATAGATTGTGTCTGG + Intergenic
1127002127 15:54521419-54521441 CTTGAAAAATAGACTTTGCATGG - Intronic
1128017835 15:64363243-64363265 GTGCAAAAAAAGACTGGGCATGG - Intronic
1128394996 15:67215555-67215577 CAGGAAAAACATTTTGTGCAGGG - Intronic
1128861751 15:71080115-71080137 ATGGAAAACAAGTGTGTGCAGGG + Intergenic
1128929414 15:71690739-71690761 AGGCAAAAAAAGGTTGTGCAGGG + Intronic
1129965332 15:79729899-79729921 CTGGAAAAACAGAATGTCCTGGG + Intergenic
1130818855 15:87470355-87470377 ATGGAAAAAAAGAAAGTGAAGGG - Intergenic
1131870215 15:96756474-96756496 ATGGAAAAAAATATTCTGTAAGG + Intergenic
1131879082 15:96843485-96843507 CTGGAAAAAAAGATTATGACTGG + Intergenic
1133393219 16:5425966-5425988 CTGGAAGGAGAGAGTGTGCAGGG + Intergenic
1133670132 16:8010492-8010514 CTTGAAAGAAAGATTGTTCTGGG + Intergenic
1133735797 16:8614721-8614743 CAGGAAAGAGAAATTGTGCAGGG - Intergenic
1133954594 16:10430296-10430318 CTGGATAAAAAAATAGTGAATGG + Intronic
1133986358 16:10671786-10671808 CAGGCAAAAGAGAATGTGCAGGG + Intronic
1134112690 16:11524986-11525008 CTCGAAAAACACATTGTGCCTGG + Intergenic
1134311996 16:13083490-13083512 GAGGAAAGCAAGATTGTGCAGGG + Intronic
1135004209 16:18803523-18803545 CTTGAAAAAAAGTCTTTGCAAGG + Intergenic
1135049949 16:19184843-19184865 CTGGAAAACAGGATGATGCATGG + Intronic
1135736893 16:24939195-24939217 ATGGAAAAAAAGACTATGAATGG - Intronic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1135941965 16:26829629-26829651 CTGCAAAAAAAGGTTCTTCAAGG - Intergenic
1135987525 16:27194934-27194956 CAGGCAAAACAGCTTGTGCAGGG + Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1138976865 16:62217981-62218003 CTGGAAAAAAAAATTTTAAATGG - Intergenic
1140815877 16:78620411-78620433 CTGGAAAAAACCATGGTGCTTGG + Intronic
1140827614 16:78721996-78722018 CTAGAAAAAAAGAAAGTGCCTGG - Intronic
1142452754 16:90191180-90191202 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1144189429 17:12830688-12830710 CTGGAAAAAAAGACCTTACAGGG - Intronic
1144445779 17:15326755-15326777 CTGAAAAAAGAGATTGGGAAGGG + Intronic
1146972988 17:37087440-37087462 CTGGAAAGGAAGATTGAGAATGG + Intronic
1147729679 17:42590669-42590691 CTGAAAAAAAAGAATGCGCCAGG + Intronic
1148403543 17:47389031-47389053 CTCAAAAAAAAGATTATGAATGG - Intronic
1149381643 17:56100261-56100283 ATGGAAAATGAGATTGTGGAAGG + Intergenic
1149481456 17:57006622-57006644 ATAGAAAAAAAAATTCTGCAAGG - Exonic
1150629461 17:66868918-66868940 ATGGAAAATAAAATTCTGCAGGG + Intronic
1151148953 17:72067187-72067209 CAGGAAAGAGAGCTTGTGCAGGG + Intergenic
1152523008 17:80871363-80871385 CAGGACAAAAACATTGGGCATGG - Intronic
1153012317 18:550060-550082 CTTGAAAAAAGGATGGTGAAGGG - Intergenic
1154461680 18:14596175-14596197 CTGAAAAAAATGAGTCTGCAAGG - Intergenic
1154980859 18:21501099-21501121 ATGAAAAAAAAGAATGTGCCCGG + Intronic
1156219329 18:35035783-35035805 CTGCAAAAAGAGACTGTGAAGGG - Intronic
1156899331 18:42282701-42282723 CTGGAAAAAAACTAGGTGCAAGG - Intergenic
1158140951 18:54255100-54255122 ATGGTGAAATAGATTGTGCAGGG - Intergenic
1158875107 18:61726218-61726240 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1159137047 18:64348715-64348737 GTCAAAAAAAAGCTTGTGCAGGG + Intergenic
1159443593 18:68512257-68512279 CTGGACAAAATGATTTAGCAAGG - Intergenic
1160644731 19:177582-177604 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1162427954 19:10608358-10608380 CCGTGAAAAAAGATTGTGCTGGG - Intronic
1164476738 19:28581306-28581328 TTTGAAAAAAAGCTGGTGCATGG - Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1166886880 19:45966993-45967015 ATGAAAAAAAAGTTTGTCCATGG + Intronic
1167681277 19:50923130-50923152 CTTAAAAAAAAAATGGTGCAGGG + Intergenic
1168522505 19:57063544-57063566 CTGGTTAAGAAGATTCTGCAAGG - Intergenic
1168633373 19:57974803-57974825 CAGGAAAAAAGGAATGGGCACGG + Intergenic
925535613 2:4912939-4912961 CAGGCAAAAGAGATTGTGTAGGG + Intergenic
926357468 2:12054748-12054770 CTGGAAAAAAAAAATATGGATGG - Intergenic
926667215 2:15539142-15539164 CTTGAATAAAAGAGTGTGAAGGG - Intronic
927126903 2:20020495-20020517 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
927367277 2:22313053-22313075 CTGGAAACAAATATAGTCCAAGG - Intergenic
928018529 2:27681811-27681833 CTTAAAAAAAAAAGTGTGCATGG - Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
929555455 2:42922884-42922906 CTGGATAGAAAGTTTGAGCATGG - Intergenic
930321095 2:49855802-49855824 CTGAAAATAATTATTGTGCAAGG + Intergenic
931594367 2:63925484-63925506 CTGGAAACAAAGTATGTGAATGG - Intronic
932638369 2:73413790-73413812 CTGGAAAAAAAGATAGCAAATGG - Intronic
932952997 2:76315938-76315960 CAGAAGAAAAAGATTTTGCAGGG - Intergenic
933291841 2:80446604-80446626 CTGGAAAAAAAAATCATGTAAGG + Intronic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934698919 2:96423078-96423100 CAGGCAAGAAAGCTTGTGCAAGG + Intergenic
934704128 2:96464440-96464462 CTGGAAAAATAGACTGGGAAAGG - Intergenic
935239947 2:101169572-101169594 AGGCAAAGAAAGATTGTGCAGGG - Intronic
937271542 2:120656068-120656090 CTGGAAGATGAGATTGTGGATGG + Intergenic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
938149172 2:128867140-128867162 CTGCAAAACAATATAGTGCAGGG - Intergenic
940301385 2:152179466-152179488 CTAGAAAAAAAAAATTTGCAAGG - Intergenic
941452184 2:165672854-165672876 CTGGAAGAAAAGACTGGGGAAGG + Intronic
942664020 2:178297201-178297223 CTGGAGAGAAAGACTGTACAAGG - Intronic
942667016 2:178330494-178330516 CTGGAAAAAAAGAGTCTCTACGG - Intronic
943224457 2:185151745-185151767 CAGGAAAGAAAGCTTGTGCAAGG - Intergenic
944815772 2:203373616-203373638 TTAGAAAAAAAGATTAAGCAAGG + Intronic
944868200 2:203882841-203882863 CTGGAAAAAAAAATAGTGAATGG + Intergenic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
946999984 2:225442978-225443000 CAGGAAAGAGAGAGTGTGCAGGG + Intronic
947003471 2:225485206-225485228 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
948027686 2:234790994-234791016 ATGAAGAAAAAGATTCTGCAAGG - Intergenic
948342463 2:237265337-237265359 CTAGAAAAGAGGAGTGTGCAGGG + Intergenic
948688195 2:239684761-239684783 CTGCAAAACAAAACTGTGCATGG + Intergenic
1169158373 20:3353963-3353985 TTGGAAAAATAGAATGTGCATGG - Intronic
1169639252 20:7731538-7731560 CTGGCAAGAGAGCTTGTGCAGGG + Intergenic
1169882367 20:10361206-10361228 CTGAAAAAAAAAAATGTGTAAGG - Intergenic
1170286411 20:14714571-14714593 CTAGAAAACAAGAGTGAGCAGGG - Intronic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172407002 20:34697247-34697269 CTGGAAAAAATGATTCTGTTAGG + Intronic
1172625895 20:36346541-36346563 CAGGAAAAACAGGTTGTGCCTGG + Intronic
1173514514 20:43655698-43655720 TTGGTAAAAAAGATTATACAGGG - Intergenic
1173954113 20:47017543-47017565 CAGGAAAAAAAAATTGTGAAAGG + Intronic
1174092839 20:48063057-48063079 CAGGCAAGAAAGCTTGTGCAGGG - Intergenic
1175413009 20:58783954-58783976 ATGGAAAATATGATTCTGCACGG - Intergenic
1175672938 20:60921495-60921517 TTGGCAAAGAAGCTTGTGCATGG - Intergenic
1176280777 20:64308329-64308351 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1177144630 21:17394015-17394037 CTGGAAGGAAAGATTTTGAACGG - Intergenic
1177751679 21:25292754-25292776 CTGGAAAATGAGAGTGTGTAGGG - Intergenic
1177871710 21:26580772-26580794 CTGGCAAGAGAGCTTGTGCATGG - Intergenic
1177976216 21:27854333-27854355 CAGGAAAAAGAGCTTGTGCAGGG - Intergenic
1179459513 21:41524465-41524487 CTGGAAAAAAGAAATGTACAAGG - Intronic
1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG + Exonic
1181507125 22:23366857-23366879 CAAAAAAAAAAGCTTGTGCAGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182887540 22:33788247-33788269 CAGGCAAGAAAGCTTGTGCAGGG - Intronic
1182887806 22:33790190-33790212 CAGGAAAGAGAGGTTGTGCAGGG - Intronic
1183261082 22:36796434-36796456 CTGGATAATATGACTGTGCAGGG - Intergenic
1183908358 22:41060064-41060086 CTGGATAAAAAGATTCTGCAGGG - Intergenic
1185054475 22:48571608-48571630 CTTTAAAAAAAAATTCTGCAAGG + Intronic
949498382 3:4655170-4655192 CTTGAAATAAAGAAGGTGCAAGG - Intronic
949947488 3:9202112-9202134 CTATAACAAAAGATTATGCATGG + Intronic
951039689 3:17975790-17975812 CTGGACAATAGGATTTTGCATGG + Intronic
951134943 3:19094457-19094479 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
951709321 3:25573186-25573208 CTGGAAGAACAGAGTGGGCAGGG - Intronic
952262027 3:31749404-31749426 CTGCAAAAAAACAATTTGCATGG - Intronic
952318780 3:32256666-32256688 TTGGAATAAAAGATTGTTAAAGG + Intronic
953233675 3:41087057-41087079 CTGCAAAAAATATTTGTGCAGGG + Intergenic
954205633 3:49057044-49057066 CTGGAAAGAGAGAGTTTGCAAGG + Exonic
954895524 3:53971895-53971917 CAGGCAAGAAAGAATGTGCAGGG - Intergenic
955421017 3:58737763-58737785 GAGGGAAAAAAGAGTGTGCATGG + Intronic
955435344 3:58893969-58893991 AGGCAAAAAAAGCTTGTGCAGGG + Intronic
955589464 3:60519165-60519187 CTGGAAAATAAGATTATAGATGG + Intronic
956343598 3:68252944-68252966 CTGGCAAGAGAGTTTGTGCAGGG - Intronic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
957419191 3:79947053-79947075 CTGGAAAAAAAGAACCTGGATGG - Intergenic
957640912 3:82852137-82852159 CTGTAAAAAAAAATAGGGCAGGG + Intergenic
957922676 3:86766393-86766415 TTGGAAAAAGAAATTGTGTATGG - Intergenic
957928944 3:86852332-86852354 CTGGCAAAAATAATTTTGCATGG + Intergenic
959742910 3:109741532-109741554 ATGAAAAAAGAGAATGTGCAAGG - Intergenic
963380093 3:144518418-144518440 CTGGAGAAAAAGATATTGCAAGG + Intergenic
963688603 3:148470319-148470341 TTGGAAAAAAAAATGGTGGAGGG + Intergenic
963982867 3:151559822-151559844 CTGGAGAAAAAGACTTTACATGG + Intergenic
964313600 3:155420005-155420027 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
964640567 3:158905969-158905991 CAGGCAAGAAAGCTTGTGCAGGG - Intergenic
964681067 3:159339403-159339425 CTTGAAAGAAATATTGTCCAAGG + Intronic
967312128 3:188116238-188116260 CTGGAAAAAAAGATAATCCTGGG + Intergenic
967524853 3:190479749-190479771 CTGGAAGATAAGAATGTGAATGG + Intergenic
967736638 3:192959937-192959959 CAGGAAAGAGAGTTTGTGCAGGG + Intergenic
968152576 3:196349019-196349041 CTGGAAAAAAAGATTATCAGAGG + Exonic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
970217492 4:13775537-13775559 CAGGCAAAAGAGTTTGTGCAGGG + Intergenic
970232404 4:13924392-13924414 CAGCAAAAGAATATTGTGCAAGG + Intergenic
970495766 4:16624003-16624025 CTGGCAAAAAAGAGTTTGGAGGG - Intronic
970789088 4:19835325-19835347 CAGGCAAAAAAACTTGTGCAGGG - Intergenic
971176810 4:24289994-24290016 CAGGCAAAAAAGCTTGTGCAGGG + Intergenic
971363566 4:25958271-25958293 CTGGAAGAAAAGCTGGTGCGTGG - Intergenic
971627415 4:28939926-28939948 TTGGAAAAAAATATTGTTTATGG - Intergenic
972735492 4:41836980-41837002 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
973235831 4:47903198-47903220 TTGGAAAGAAAGATTGTCCCTGG - Exonic
973565345 4:52180801-52180823 CAGGCAAGAAAGAGTGTGCAGGG - Intergenic
973849808 4:54949680-54949702 CAGGCAAGAAAGAGTGTGCAGGG - Intergenic
974753056 4:66166404-66166426 CTGGACAAAAAGATGATTCAAGG - Intergenic
976068772 4:81218307-81218329 CTGGAAAAAAAAAAAGTGGAGGG + Intergenic
976103617 4:81592928-81592950 CTGTAATAAAAGAAAGTGCAAGG + Intronic
976633823 4:87267191-87267213 CTAGAAAAACAGATTATGAAAGG + Intergenic
976770664 4:88649058-88649080 CTGAAAAAACAGATCATGCAGGG - Intronic
976914286 4:90351675-90351697 CTGGAAAAATAGATTATTTATGG + Intronic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
977155816 4:93571916-93571938 ATGGAAAAAAGGATAGTGGATGG + Intronic
979039540 4:115770370-115770392 CTTGACAATAAGATTGTGCTGGG + Intergenic
979090360 4:116476434-116476456 CTGGAAAAAACAATTCTGGAAGG + Intergenic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979626813 4:122854342-122854364 CTGGCAATCAAGATTGTGTAAGG + Intronic
980059787 4:128116878-128116900 CTTGATAAAAAGAATGTGAATGG - Intronic
980985532 4:139691145-139691167 CTGGAAAAACAGGCTGTCCATGG - Intronic
981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG + Intergenic
981422545 4:144567660-144567682 CAGGCAAAAGAGAGTGTGCAGGG - Intergenic
981772768 4:148329020-148329042 CTAGAAAATAAGATGGTGCGAGG + Intronic
981809706 4:148759872-148759894 ATGCAAAAAGAGCTTGTGCAGGG + Intergenic
982472306 4:155807771-155807793 CAGGAAATAAAGACTGGGCATGG + Intergenic
982487816 4:155989137-155989159 CTGGAAAAATAGGCTGGGCATGG - Intergenic
982523673 4:156451611-156451633 ATGGAAAAATGGATTGTTCAGGG - Intergenic
983150205 4:164269248-164269270 CTGGACAAACAGAGTGTGCTGGG - Intronic
984329027 4:178291486-178291508 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
986037386 5:3953081-3953103 CTGGCAAAAAAGATTCATCAAGG + Intergenic
986074034 5:4315962-4315984 CTGGAATATAAGCTTCTGCAGGG + Intergenic
986955883 5:13148776-13148798 CTGGCAAAAAAGATTCATCAGGG + Intergenic
987455964 5:18146885-18146907 CTGGAAGAAAATATTCTTCAAGG - Intergenic
987773453 5:22335626-22335648 AGGCAAAAAGAGATTGTGCAGGG - Intronic
988004947 5:25397553-25397575 AGGCAAAAAAAGCTTGTGCAGGG + Intergenic
988144365 5:27286193-27286215 GTGGAAAAAAAGAGTATGCAAGG + Intergenic
988307234 5:29507899-29507921 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
988685246 5:33519342-33519364 CAGGCAAGAGAGATTGTGCAGGG - Intergenic
989710781 5:44394526-44394548 CTAGAAAAAAGGATTGTGCCAGG - Intergenic
989747875 5:44852974-44852996 CAGGAAAGAGAGCTTGTGCAGGG + Intergenic
990440334 5:55838595-55838617 CTTAAAAAAAAAATTGAGCAAGG + Intergenic
990688539 5:58335747-58335769 CTGGTCAAATAAATTGTGCATGG + Intergenic
991340538 5:65603433-65603455 CAGGAAAAAAAAAGTGTGTAAGG + Intronic
991713341 5:69429530-69429552 CTGGAAAGTAAGATCGTGCTTGG - Intronic
993153092 5:84185407-84185429 CTTGAAAAAAAGTCTGTACAAGG - Intronic
993778591 5:92035519-92035541 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
993872615 5:93269856-93269878 TCTTAAAAAAAGATTGTGCATGG - Intergenic
994204566 5:97020110-97020132 ATAGAAAAAAAGAATCTGCAAGG - Intronic
994341853 5:98639369-98639391 CAGGAAAAAAAGATTTTTAAAGG - Intergenic
994682696 5:102908761-102908783 CTGGAAAAAAAAAATGTTCCAGG + Intronic
994708894 5:103241780-103241802 TTGAGAAACAAGATTGTGCATGG - Intergenic
994857453 5:105142645-105142667 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
995133493 5:108655833-108655855 CTGGAAAAAAAAATTCTCAATGG + Intergenic
995137294 5:108693483-108693505 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
995920513 5:117305420-117305442 CTAGACATAAAGGTTGTGCAAGG - Intergenic
996453369 5:123653163-123653185 CTGGCAAAAAAGATTTCGCGTGG + Intergenic
997036705 5:130201934-130201956 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
997831138 5:137151093-137151115 CTGGTAAAATAGATGCTGCAGGG - Intronic
998793406 5:145791178-145791200 CAGGCAAGAAAGCTTGTGCAGGG + Intronic
998874919 5:146589436-146589458 ATGGAAAAAAAAATGGTGGAGGG + Intronic
1000313455 5:160066576-160066598 CTGAAATAAAAGTTTGGGCACGG - Intronic
1000933863 5:167284632-167284654 TTTGCAAAAGAGATTGTGCAGGG + Intergenic
1001011307 5:168101200-168101222 CAGGAAAATTAGATTATGCAAGG - Intronic
1002732193 5:181347198-181347220 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1002752342 6:126906-126928 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1003652240 6:7971854-7971876 TTGGAAAAGAAAATTGTGTAAGG - Intronic
1003768167 6:9264592-9264614 TTGGAGAAAAAGATTGTATACGG + Intergenic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1004344480 6:14835943-14835965 AAGGAAAAAAAAATTGTCCAAGG - Intergenic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1010551439 6:77227470-77227492 TTTGGAAAAAAGGTTGTGCAAGG + Intergenic
1010658439 6:78540721-78540743 CTATAGAAAAAGATTGTTCAGGG - Intergenic
1010770501 6:79823196-79823218 ATGGTTAAAAAGATTGTTCAAGG + Intergenic
1010900806 6:81424835-81424857 ATGGAACAAAAGATTGAGTAAGG + Intergenic
1010984572 6:82409071-82409093 CTGGAAAAAAGGATGATTCACGG + Intergenic
1011382653 6:86759664-86759686 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
1012491094 6:99783175-99783197 GAGGAAAAAGAGATAGTGCAGGG + Intergenic
1012643209 6:101648915-101648937 CAGGCAAGAAAGCTTGTGCAAGG + Intronic
1012832952 6:104228750-104228772 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1013453601 6:110309628-110309650 AGGCAAAAAAAGGTTGTGCAGGG + Intronic
1013661089 6:112297808-112297830 CAGGAAAGAGAGAGTGTGCAAGG + Intergenic
1014528020 6:122523806-122523828 CAGGAAAGAGAGCTTGTGCAGGG - Intronic
1014643182 6:123939795-123939817 CTGGAAAAAAAAAGTGTGGCTGG - Intronic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1015473068 6:133628398-133628420 CTAGAAACAGAGATTATGCATGG + Intergenic
1016676730 6:146778957-146778979 CAGCAAAAAAAGTTTGTTCAAGG + Intronic
1016711105 6:147172988-147173010 TTGGACAAAAACATTGTTCAAGG - Intergenic
1016760257 6:147728919-147728941 TTTAAAAAAATGATTGTGCAAGG + Intronic
1017530156 6:155281896-155281918 CTGAAAAAAAAGATTAAGCGTGG + Intronic
1017812618 6:157994920-157994942 CTGGAAAGCAAGGTGGTGCAGGG - Intronic
1017984004 6:159426608-159426630 ATGGAAAAACAGTATGTGCATGG + Intergenic
1018312103 6:162521019-162521041 CTGGAAAAAAATATTAATCATGG - Intronic
1019236445 6:170619512-170619534 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1020396362 7:7722894-7722916 CTGGCAAAAAAGATTGATCAGGG - Intronic
1020412402 7:7907721-7907743 CAGGCAAGAAAGCTTGTGCAGGG - Intronic
1020563995 7:9773090-9773112 CTGGGAAAAGAAAATGTGCATGG - Intergenic
1022594264 7:31697115-31697137 CAGGTAAAAAAGCTGGTGCAGGG + Exonic
1022790609 7:33685211-33685233 ATGGAAGAAATGATTGTGTAAGG + Intergenic
1022978117 7:35576983-35577005 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1024014751 7:45303083-45303105 ATGGAAAATAAGTTTTTGCAAGG + Intergenic
1024394418 7:48849221-48849243 CTGGACAGAAATATTGTGGATGG - Intergenic
1024400845 7:48923420-48923442 CTGGACAGAAATATTGTGGACGG + Intergenic
1027300532 7:76828974-76828996 AGGCAAAAAAAGCTTGTGCAGGG + Intergenic
1027690207 7:81336291-81336313 AGGCAAAAAAAGCTTGTGCAGGG + Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030398770 7:109021509-109021531 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
1030457222 7:109791279-109791301 CAGGAAAGAAAGAGTATGCATGG - Intergenic
1030800334 7:113842260-113842282 ATGGCAAATAAGACTGTGCAGGG + Intergenic
1030814086 7:114012880-114012902 ATGGAAACTAAGATTGTGCAAGG - Intronic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031791863 7:126117157-126117179 GGTGAAAAAAAGCTTGTGCAGGG - Intergenic
1031873130 7:127109202-127109224 ATGGAAAAAAAGGTGGTGAATGG + Intronic
1032740594 7:134734700-134734722 CAGGCAAGAAAGTTTGTGCAGGG - Intergenic
1033501700 7:141957533-141957555 CAGGCAAAAGAGATTGTGTAGGG + Intronic
1034012990 7:147550398-147550420 CAGGCAAGAGAGATTGTGCAGGG - Intronic
1034112291 7:148548618-148548640 CTGGAAAAAAAAAATGCCCATGG + Intergenic
1034561352 7:151881408-151881430 CAGGAAAGAGAGAGTGTGCAGGG + Intergenic
1035142754 7:156780270-156780292 CTGGACAAAAAGAAAGTGCTTGG + Intronic
1035511325 8:187095-187117 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1035733665 8:1871904-1871926 CAGGAAAAAAATAATGGGCAAGG + Intronic
1037505391 8:19524421-19524443 CTAGAAAAAAAAATTAGGCATGG - Intronic
1039852528 8:41382267-41382289 CTAGAAATAAAGATTATACAAGG + Intergenic
1039853011 8:41387588-41387610 CAGGAAAGAAAGAGAGTGCAGGG - Intergenic
1040058162 8:43079535-43079557 TTGGAAAATATGATTGTTCATGG + Intronic
1042527268 8:69776401-69776423 CTTCAAAAAAAGATTGGGCTGGG + Intronic
1042710993 8:71717125-71717147 ATGGAAAAAAAAATTTTGCTGGG - Intergenic
1043161159 8:76849883-76849905 TTGGAAAAAAATATGGTACAAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043872854 8:85454039-85454061 CTCTATAAAAAGAGTGTGCATGG + Intergenic
1044290553 8:90463792-90463814 CAGGAAGAAAAGATTATGGAAGG + Intergenic
1045037131 8:98184549-98184571 CAGGAAAACAGGATTCTGCAGGG - Intergenic
1046367108 8:113249122-113249144 CAGGCAAAAGAGGTTGTGCAGGG - Intronic
1046485318 8:114880013-114880035 ATGGTAGAAAAGATTGTGTAGGG - Intergenic
1046719751 8:117606061-117606083 CTGGCAAGAATGCTTGTGCAGGG + Intergenic
1047193731 8:122701902-122701924 GTGGCAAAAAAAATTGTCCATGG - Intergenic
1047222198 8:122927618-122927640 CAGGCAAGAAAGCTTGTGCAGGG + Intronic
1047241882 8:123098279-123098301 CTGGAAGAATAGAAGGTGCAAGG - Intronic
1048009950 8:130447536-130447558 CTGGCAAGAAAGACAGTGCAGGG - Intergenic
1048030859 8:130630569-130630591 CTGGAAAACTAGATTCTCCAAGG + Intergenic
1048039588 8:130712742-130712764 CTGGAAGAAAAGAGTGCACAGGG - Intergenic
1048360053 8:133689884-133689906 CTGGGAAGAAAGAATGTGCTTGG + Intergenic
1048662406 8:136619502-136619524 CTTGAAATAAATATTGTGAAAGG - Intergenic
1048669208 8:136696989-136697011 CAGGTAAGAAAGCTTGTGCAGGG - Intergenic
1050155853 9:2665813-2665835 AAGCAAAAAGAGATTGTGCATGG - Intergenic
1050841235 9:10151549-10151571 TTAGCAAAAAAGATTGGGCACGG - Intronic
1050935865 9:11393658-11393680 CAGGCAAGAAAGCTTGTGCAGGG - Intergenic
1051027558 9:12631130-12631152 CTGGAAAAAAAGAATCAACAAGG + Intergenic
1051043432 9:12843450-12843472 TTGATAAAAAAAATTGTGCATGG + Intergenic
1051179362 9:14394483-14394505 CAGGCAAAAGAGCTTGTGCAAGG + Intronic
1051466809 9:17387682-17387704 CTTGAAAAAAAGGTTGTGGTAGG + Intronic
1052204528 9:25823147-25823169 CTGGTTAAAAAGCTTCTGCACGG - Intergenic
1052667535 9:31514225-31514247 CAGGAAAAACAGGTTGGGCATGG - Intergenic
1054337903 9:63824468-63824490 CAGGGAATATAGATTGTGCATGG - Intergenic
1054895164 9:70302208-70302230 CTGAAAAAATAGGTTGGGCACGG + Intronic
1054943414 9:70768904-70768926 TTGGAAAAAGAGATCATGCATGG + Intronic
1054961315 9:70973154-70973176 GTGGAATAAATGATTGTACATGG - Intronic
1055239920 9:74171340-74171362 CTTGAGAAAATGATTGTTCAGGG - Intergenic
1055660898 9:78502957-78502979 CTGGAAAAAAGGGCTGTGGAGGG + Intergenic
1055808922 9:80128416-80128438 CTGGAGAACAGGAATGTGCACGG + Intergenic
1056084413 9:83131235-83131257 CAGGAAACAAATATTGTACATGG + Intergenic
1056487206 9:87071475-87071497 CAGGCAAGAAAGAGTGTGCAGGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058142724 9:101375170-101375192 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
1058286037 9:103179451-103179473 CTGGAAAAAAAAATTCTATATGG - Intergenic
1058576677 9:106411182-106411204 GGTGAAAAAAAGCTTGTGCAAGG - Intergenic
1059628440 9:116092571-116092593 CAGGCAAAAAAGCTTGTGCAGGG - Intergenic
1059681330 9:116589560-116589582 TTGAAAACAAAGATTCTGCATGG + Intronic
1059775837 9:117474479-117474501 CAGGAGAGATAGATTGTGCAGGG + Intergenic
1060298365 9:122358616-122358638 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
1061070503 9:128307278-128307300 CTGGAAAAAAATATTTAGCCAGG + Intergenic
1061550520 9:131331905-131331927 CTCAAAAAAAAAATTGTGCAGGG + Intergenic
1062756595 9:138299524-138299546 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202784625 9_KI270718v1_random:36804-36826 CAGGGAATATAGATTGTGCATGG + Intergenic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1185735702 X:2494050-2494072 CTGGAAGAAAAGTTTGTACTCGG + Intronic
1186070319 X:5812451-5812473 CAGGCAAGAAAGCTTGTGCAGGG + Intergenic
1186943243 X:14536081-14536103 TGGGAAAAAAATAGTGTGCATGG - Intronic
1187027289 X:15448770-15448792 AGGGAAAGAAAGATTGGGCAGGG - Intronic
1187788411 X:22919909-22919931 CTGGAAAAAGGGATTGGGAAGGG + Intergenic
1188090548 X:25959255-25959277 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1188169786 X:26910763-26910785 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1188540316 X:31242431-31242453 GTGGAAAAAAACATTGTTCTAGG - Intronic
1189062247 X:37767031-37767053 TTGTAAAAAAAGATTTTTCAAGG + Intronic
1190147986 X:47915295-47915317 CTGGATAAAACTATTGGGCATGG + Exonic
1190435031 X:50415801-50415823 CTGGAAATAAATTTTGTCCAAGG + Intronic
1192148040 X:68694804-68694826 CTGGAAAACTAGAGTGTGCGTGG + Intronic
1193279247 X:79627666-79627688 AGGCAAAAAGAGATTGTGCAGGG - Intergenic
1194088817 X:89561190-89561212 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1194211678 X:91077578-91077600 CTGGAACACAAGCTTGTGTAAGG + Intergenic
1194349786 X:92811774-92811796 CTGGAAAGAAAGGTTATGAAAGG - Intergenic
1194395324 X:93376540-93376562 CTGGGGATAAAGATTGTTCATGG + Intergenic
1194397666 X:93405088-93405110 CTGGCAAGAAAGCGTGTGCAGGG + Intergenic
1196180266 X:112681860-112681882 CTGGAATAAGAGATTCTGCAAGG + Intergenic
1196859205 X:120011720-120011742 CTGAAAAAAAAGCTTGGTCATGG + Intergenic
1197403228 X:126019445-126019467 ATGCAAAAAAAAATTGTGTAAGG - Intergenic
1198326048 X:135574211-135574233 CTTGAAAAAAAAAATGTGCCTGG - Intronic
1199901972 X:152183983-152184005 CAGAAAAAAAAGAATGTGAAAGG - Intronic
1200441490 Y:3217241-3217263 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1200658109 Y:5928384-5928406 CTGCAAAAAAAGGTTATGAAAGG - Intergenic
1201398993 Y:13582311-13582333 TTGGCCAAAAAGTTTGTGCAGGG - Intergenic
1201471148 Y:14336250-14336272 CAGGAAAAAGGGAGTGTGCAGGG - Intergenic
1201529950 Y:14980597-14980619 CTGGAAAAAAAGATTCACCTGGG + Intergenic
1201557505 Y:15279407-15279429 CAGGAAAGAGAGGTTGTGCAGGG + Intergenic
1201640987 Y:16176639-16176661 CAGGAAAAAGAGTTTCTGCAGGG - Intergenic
1201661829 Y:16408687-16408709 CAGGAAAAAGAGTTTCTGCAGGG + Intergenic
1201759462 Y:17521224-17521246 CAGGCAAAAGAGATTGTGTAGGG - Intergenic
1201842092 Y:18384766-18384788 CAGGCAAAAGAGATTGTGTAGGG + Intergenic
1202383717 Y:24302541-24302563 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202487066 Y:25367579-25367601 CTGGACAAACAGAGTGTGCTGGG - Intergenic