ID: 977080666

View in Genome Browser
Species Human (GRCh38)
Location 4:92523707-92523729
Sequence CAGGTTCAGCAGAGGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977080666 Original CRISPR CAGGTTCAGCAGAGGGACGC AGG Intronic
900307867 1:2019732-2019754 CAGGTTCAGCACCAGGACGGCGG - Intronic
900768232 1:4519796-4519818 CAGGATCAGCAGTGGGTCCCAGG - Intergenic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
902835214 1:19043032-19043054 GGGGTTCAGCACAGGGACTCTGG - Intergenic
903153008 1:21426387-21426409 CAGGCTCAGCAGAGAGCTGCTGG - Intergenic
903160122 1:21481594-21481616 CAGGCTCAGCAGAGAGCTGCCGG + Exonic
903863052 1:26376906-26376928 CTGGATCAGCAGAGTGACTCTGG + Intergenic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG + Intergenic
904615455 1:31747029-31747051 CACGTTCAGCAGAGAGATGTGGG - Intronic
906524398 1:46485915-46485937 CAGGTTCGGGTGGGGGACGCGGG - Intergenic
910683169 1:89888753-89888775 AAGGTTTATCAGAGGGACACAGG + Intronic
913642273 1:120823971-120823993 CAGGCTCAGCAGAGAGCTGCTGG + Exonic
914049245 1:144118053-144118075 CATGTTCAGCAAAGTGACACAGG + Intergenic
914129939 1:144847392-144847414 CATGTTCAGCAAAGTGACACAGG - Intergenic
916890014 1:169105813-169105835 CAGGTGCAGGAGCGGGAGGCGGG + Exonic
917199461 1:172499729-172499751 CAGGATCAACAGAGGGACTTAGG - Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
919134605 1:193492081-193492103 CAGGTTCAAGACATGGACGCTGG + Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1069234087 10:66048420-66048442 CAGGTTCAGAAGATTGAAGCCGG + Intronic
1069651555 10:70053297-70053319 GAGGTTCAGCAGCGGGCCCCAGG + Intronic
1069995307 10:72338325-72338347 CAGGTCCAGCAGAGTGACATTGG - Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083922740 11:65789273-65789295 CAGGTGCAGGAGAGGGCCTCTGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1085514628 11:77105152-77105174 CGGGCACAGCAGAGGGACTCAGG - Intronic
1087680053 11:101210196-101210218 CAGGTTTAGCAGTGAGACACTGG - Intergenic
1090673863 11:128970980-128971002 CAGGTGCAGCAGCGGGACCCGGG + Exonic
1091948011 12:4566256-4566278 CAGGTTTAGCATAGCCACGCAGG + Intronic
1092287229 12:7135691-7135713 CAGGTTAGGCAGCAGGACGCTGG - Intronic
1097248113 12:57617779-57617801 CATGTTCAGCTGAGGGAGGATGG + Intronic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1106231602 13:27825222-27825244 GAGGTTCAGGACAGGGAGGCAGG + Intergenic
1112218439 13:97460813-97460835 GATGTTCAGCACAGGGACTCTGG + Intronic
1115369437 14:32595419-32595441 CAGGTTCAGCAGAGCCTAGCAGG - Intronic
1119806047 14:77483012-77483034 CAGGTCCAGCAGATGCATGCTGG - Intronic
1120145969 14:80978663-80978685 CAGGTGCTGCAGATGGAGGCTGG + Intronic
1120519879 14:85514100-85514122 CATGTACAGCTAAGGGACGCAGG + Intergenic
1121532918 14:94671148-94671170 AAGGTCCAGCAGAGGGAGACAGG + Intergenic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1123171153 14:106373925-106373947 CAGCTACAGCAGTGGGGCGCAGG - Intergenic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1129257784 15:74343868-74343890 AAGGTTGAGCATGGGGACGCTGG + Exonic
1132111390 15:99104847-99104869 CGGGCTCAGCGAAGGGACGCCGG - Intronic
1133436484 16:5784472-5784494 CAGGAGCAGCAGAGAGACGGGGG + Intergenic
1133996971 16:10755718-10755740 CAGGTTCACCAGAGTGGCTCAGG + Exonic
1144101626 17:11946801-11946823 CAGGTTGAGCATAGGGAGACAGG + Intronic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1148795379 17:50194429-50194451 CACGTTCACCAGCGGGACCCTGG + Exonic
1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG + Exonic
1151564756 17:74891917-74891939 CAAGTTCAGCAGAGGAACTGGGG + Intronic
1151666241 17:75546694-75546716 CAGGTCCAGCAGACAGACGGAGG + Intronic
1151666258 17:75546766-75546788 CAGGTCCAGCAGACAGACGGAGG + Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1160418895 18:78730983-78731005 AAGGTTCTGCAGATGGACGGTGG - Intergenic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1162582187 19:11538287-11538309 CCGGCACAGCAGAGGGACTCGGG - Intergenic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164460755 19:28445621-28445643 CAGTTTCACCAGAGTGGCGCTGG - Intergenic
1164545482 19:29158319-29158341 CAGATCCAGCAGAGGGGCTCTGG + Intergenic
1166936243 19:46334951-46334973 CAGGTTCAGGAGTGGGGTGCTGG - Exonic
1167313495 19:48751040-48751062 CAGGTGCCGGAGAGGGAAGCAGG + Exonic
1167528646 19:50001204-50001226 CAGGTTCCCCAGAGGAAAGCAGG - Intronic
1202688693 1_KI270712v1_random:70947-70969 CATGTTCAGCAAAGTGACACAGG + Intergenic
925302820 2:2829058-2829080 CAGGTTCATCCCAGGGACTCTGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926686815 2:15704480-15704502 CAGGCACAACAGAGGGACACTGG - Intronic
928190275 2:29158934-29158956 CAAGTTCAACAGTGGGACACAGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931870704 2:66456508-66456530 CAGATTCTGAAGAGGGATGCTGG + Intronic
933957735 2:87385138-87385160 CATGTTCAGCAAAGTGACACAGG - Intergenic
934241856 2:90277055-90277077 CATGTTCAGCAAAGTGACACAGG - Intergenic
934271316 2:91539633-91539655 CATGTTCAGCAAAGTGACACAGG + Intergenic
935603363 2:104945380-104945402 CAGTTTCAGCAGTGGAAAGCAGG + Intergenic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
942247750 2:174023602-174023624 CAGTTTCAGCAGAGCGGCCCTGG + Intergenic
946375915 2:219308958-219308980 CAGGTTCGGGAGAAGGACACGGG - Intronic
946748200 2:222866569-222866591 CAGGTTAAGAACAGGGACTCTGG - Intronic
948458226 2:238117092-238117114 CAGGTTCAGCAGTGGGGTCCTGG - Intronic
948574203 2:238939386-238939408 CAAGATCAGCAGAGGGTCGGGGG - Intergenic
1169166839 20:3431441-3431463 CAGGTTCAGCTGTGGGGCTCTGG - Intergenic
1174092069 20:48057421-48057443 CAGGTGCAGCTAAGGGAAGCCGG - Intergenic
1174583337 20:51588792-51588814 GAGGTTCAGGAGAGGTATGCTGG - Intergenic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1175953705 20:62597185-62597207 AAGCTTCAGAAGAAGGACGCCGG - Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1181351305 22:22260389-22260411 CATGTTCAGCAAAGTGACACAGG + Intergenic
1181541568 22:23575789-23575811 CAGGTACAGCAGAAGGACCTTGG - Intronic
1181551443 22:23641126-23641148 CAGGTACAGCAGAAGGACCTTGG - Intergenic
1181796817 22:25317516-25317538 CAGGTACAGCAGAAGGACCTTGG + Intergenic
1183352613 22:37342567-37342589 CAGGGGCAGCAGTGGGACCCAGG - Intergenic
1184716906 22:46287671-46287693 CAGGCTCAGCAGAGTCACCCTGG + Intronic
1185426642 22:50775464-50775486 TAGGTCCATCAGAGGGACGGTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
954396840 3:50297542-50297564 CAGGTTCAGCTGAGTCAGGCTGG + Intronic
956204682 3:66742951-66742973 CAGATTCAGCAGAGCTATGCTGG + Intergenic
959565014 3:107825325-107825347 CAGGTTAAGCAGAGGCAAGTGGG - Intergenic
960474797 3:118110631-118110653 GAGGGTCTGCAGAGGGACCCTGG + Intergenic
961039008 3:123663895-123663917 CAGGCTCAGCAGAGGGGCCAAGG - Intronic
961528579 3:127525478-127525500 CAGGTACAGCATAAAGACGCTGG - Intergenic
963547287 3:146676159-146676181 CAGATTCAACAGAGGGACTATGG + Intergenic
967758139 3:193193485-193193507 CAGCTTCAGCAGAGGAACAGAGG - Intergenic
968087239 3:195879283-195879305 CAGGTTCAACAGTGGGTCTCAGG + Intronic
968603787 4:1522043-1522065 CAGGGGCAGCAGACGGACACAGG + Intergenic
968904991 4:3446909-3446931 CAGGTTCTGCAGGGCCACGCAGG - Intronic
970327078 4:14936932-14936954 CAGGTACAGCTGAGGGAAGAGGG + Intergenic
970471545 4:16384414-16384436 CTGATTCTGCAGAGGGACTCCGG - Intergenic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
980364073 4:131776549-131776571 CAGGTTCTGCACATGGACACAGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
982202622 4:152974917-152974939 CCCGGTCAGCAGAGGGACCCAGG - Exonic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992669768 5:79047598-79047620 CAGGTACAGCTCAGGGACGCGGG - Intronic
992769716 5:80035557-80035579 CAGGTGCAGCAGGAGGACGGCGG - Exonic
992828205 5:80569925-80569947 CAGGGCCAGCCGAGGGCCGCCGG - Intronic
997237059 5:132278779-132278801 CAGGTGGGGCAGAGGGACTCAGG - Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
1001534286 5:172487887-172487909 CACGCTCTGAAGAGGGACGCAGG - Intergenic
1002469575 5:179427499-179427521 CAGGTTCAACACGGGGTCGCGGG - Intergenic
1005264082 6:24092808-24092830 CAGATCCAGCAGAGGAACCCAGG - Intergenic
1007649090 6:43406553-43406575 CAGTTTCAGCAGAGCGATGTGGG + Intergenic
1007751200 6:44073025-44073047 GAGGTGCAGCAGAGGCAGGCGGG + Intergenic
1007825128 6:44594610-44594632 AAGGGTCTGCAGAGGGCCGCAGG + Intergenic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1011129010 6:84034951-84034973 CAGGTGCAGGAGAGTGACGAGGG + Intronic
1013799141 6:113920498-113920520 GAGGTTCAGAAGAGTGAGGCTGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019604245 7:1900587-1900609 GAGGATCAGCCGAGGGACGCAGG - Intronic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019713582 7:2528481-2528503 CAGGGTCAGGAGAGGCACACAGG + Intronic
1020193151 7:6016020-6016042 GAGGTTCAGCAGAGGCAGCCCGG + Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021650972 7:22832692-22832714 AAGATTCAGCACAGGGACCCAGG + Intergenic
1024082086 7:45864262-45864284 CAGGCTCAGCTGGGGGCCGCTGG + Intergenic
1026627773 7:72011482-72011504 CAGGTTCAGGAGAGGGAACAGGG - Intronic
1027141619 7:75661747-75661769 CAGCTACAGCAGAGTAACGCAGG + Intronic
1028241299 7:88424350-88424372 GAGGTTCAGCTAAGGGACACGGG - Intergenic
1032446801 7:131991186-131991208 TAGGTTCACCACAGGGAGGCAGG + Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1033970637 7:147034768-147034790 CGGATTCAGCCAAGGGACGCTGG - Intronic
1036582259 8:10086271-10086293 CAGGTTGAGCAGTTGGATGCTGG + Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1037754665 8:21703113-21703135 GAGGTTCAGCAGAGGGAATCTGG - Intronic
1041928788 8:63265615-63265637 CAGGTTCTATAGAGGGTCGCCGG + Intergenic
1044999890 8:97869685-97869707 CAGGTTCCGAAGAGGGAAGGGGG - Intronic
1045910949 8:107409392-107409414 CAGGTTCACCAATGGGACTCAGG + Intronic
1052756913 9:32551076-32551098 CATGCGCAGCAGATGGACGCCGG + Intronic
1053628423 9:39902434-39902456 CAGGTTCTGCACATGGACACAGG - Intergenic
1053777636 9:41563893-41563915 CAGGTTCTGCACATGGACACAGG + Intergenic
1054215464 9:62348267-62348289 CAGGTTCTGCACATGGACACAGG + Intergenic
1054672017 9:67807080-67807102 CAGGTTCTGCACATGGACACAGG - Intergenic
1056464613 9:86841567-86841589 CAAGCTCAGAAGAGGGACTCAGG + Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1060103223 9:120857764-120857786 CTGGTACAGCAGAGAGACGCAGG + Exonic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1062355425 9:136159852-136159874 CAGGTTCCGCTGAGGGACCCTGG - Intergenic
1198209296 X:134501756-134501778 GAGGTTCAGCAGTGGGAAGCTGG - Intronic
1199808872 X:151329237-151329259 CAAGTTCTGCAGAGGGATGGTGG + Intergenic
1200734441 Y:6779134-6779156 CAGGTTCAGTAGAGGGGCTCAGG - Intergenic