ID: 977091097

View in Genome Browser
Species Human (GRCh38)
Location 4:92676568-92676590
Sequence CTGTTGATTCATATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977091097 Original CRISPR CTGTTGATTCATATGGAGCA TGG Intronic
905524310 1:38624825-38624847 CTGTGGTTTCCTATGGAGCAAGG - Intergenic
905634377 1:39539600-39539622 CTTTGGATTTATATGGAACATGG - Intergenic
906025958 1:42674055-42674077 CTGTAGCCTCATATGCAGCATGG - Intronic
906205187 1:43982825-43982847 CTCTGGTTGCATATGGAGCATGG + Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909257197 1:73439082-73439104 CTGTTGCTTCAGATGGTGCAAGG + Intergenic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
920052275 1:203171370-203171392 CTGGTGATTGGTATGGAGCCAGG - Exonic
920785693 1:209039043-209039065 CTTTAGATTCATATGGTGGAAGG + Intergenic
923221952 1:231903409-231903431 CTGTAGATTTACATGGAGTAAGG + Intronic
924289268 1:242521743-242521765 CTTCTGATTCATATGTTGCAGGG - Intronic
924429197 1:243982487-243982509 CTTTTGCTTCCTCTGGAGCAGGG + Intergenic
1063276082 10:4569134-4569156 CTGTTGATTCATCGGGGGCAAGG + Intergenic
1064646169 10:17461965-17461987 CTATTTATTCTTATGGTGCAAGG + Intergenic
1065380690 10:25087096-25087118 CTGTTGCTTCATTTTGTGCATGG - Intergenic
1067082852 10:43221427-43221449 CTGTTCCTTCATCTGGAGAAGGG - Intronic
1067942875 10:50670705-50670727 CTGCTGATTCCTCTGGGGCATGG - Intergenic
1068781051 10:60919576-60919598 CTGTTGATTTAAATGGTGGAAGG - Intronic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1070864117 10:79695669-79695691 CTGCTGATTCCTCTGGGGCATGG - Intergenic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1071631013 10:87217895-87217917 CTGCTGATTCCTCTGGGGCATGG - Intergenic
1073942542 10:108714692-108714714 CTGTTGCTTCAGAGGGTGCAAGG - Intergenic
1074320354 10:112396291-112396313 CTCTTGATTCCTCTGCAGCAGGG + Intronic
1074474455 10:113756856-113756878 CTGTTGAAGCATTTTGAGCATGG + Intronic
1078300714 11:10129413-10129435 CTGTTGATTCCTTTGAAGAAAGG - Intronic
1078959536 11:16248566-16248588 CTGTTGCTTCAGAGGGTGCAAGG - Intronic
1079574325 11:21984588-21984610 CTTTTCATTCATATGGTGTATGG - Intergenic
1086388385 11:86334389-86334411 CTCTTGATTTACATGGAGGAGGG + Intronic
1086820225 11:91426856-91426878 ATGTTGATTCACATTCAGCATGG + Intergenic
1087764670 11:102137610-102137632 CTGTGATTTCACATGGAGCAGGG - Intronic
1090619287 11:128547407-128547429 CTGCTGTTTCTCATGGAGCAGGG - Intronic
1093894279 12:24560126-24560148 CTGTTGATTCTTCAGGAACAAGG + Intergenic
1095804017 12:46298311-46298333 CTGTTGATTCTTGAGTAGCAAGG - Intergenic
1097625859 12:61999564-61999586 CTGTTGATTAGCATGGAGCTGGG - Intronic
1105919303 13:24946465-24946487 CTGTTGCTTCATCTGGTCCAGGG - Intergenic
1108725061 13:53171646-53171668 GTGTTGATTTATGTAGAGCAAGG + Intergenic
1111654802 13:91139218-91139240 CTATCCATTCAGATGGAGCAGGG + Intergenic
1115500075 14:34041813-34041835 ATGTAGAGGCATATGGAGCATGG + Intronic
1115787823 14:36846299-36846321 CTGTAGATTCTTATGGATCAGGG - Intronic
1116243833 14:42382350-42382372 CTGTTGATTTCCTTGGAGCATGG - Intergenic
1119548348 14:75489848-75489870 CTGTTCCTTCATCTGCAGCATGG + Intergenic
1121861278 14:97321139-97321161 CTGCTTATTCCTATGAAGCAGGG - Intergenic
1121897369 14:97661034-97661056 CATTTGACTCATATGGGGCAGGG + Intergenic
1122660208 14:103290143-103290165 CTGTTGACTCACCAGGAGCAGGG + Intergenic
1125891345 15:43269255-43269277 CTGGTGACTCATTTGGAGAAAGG - Intergenic
1128053858 15:64685370-64685392 CTGAGGATGCATATGGAGCAGGG - Exonic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1132857370 16:2052683-2052705 CTGTTGGTTAATGTGGAGAAGGG + Intronic
1133471948 16:6083896-6083918 CTGTAGATTTATTTGGAGGATGG + Intronic
1136037190 16:27549536-27549558 CTGTTGATTGAGTTGGGGCACGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1139234177 16:65317236-65317258 CTGTTTATTCATGTTGAGCTGGG - Intergenic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1145026879 17:19475083-19475105 CTGTGGATTCATCTGGAATAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1151885754 17:76922493-76922515 CTGTTGTTTCCTGTGAAGCATGG - Intronic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1155971815 18:32090813-32090835 CTGTTTATTCATTTAGACCATGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160177157 18:76604564-76604586 CAGTTAATTCTTATGTAGCAGGG - Intergenic
1162656555 19:12135685-12135707 CTGTTCATTGATTTGGAACATGG - Intronic
1163708286 19:18830393-18830415 CTGCTGATATATATGGAGCCCGG - Intergenic
1163882400 19:19937165-19937187 CTGATCACTCATCTGGAGCAGGG - Intergenic
1165941567 19:39417058-39417080 CTGTTGGTTCATCTGGAGGATGG + Intronic
1168254401 19:55157830-55157852 CTGGTGATCCAGCTGGAGCAGGG - Intronic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
927875280 2:26651081-26651103 CTGCTGATTCATGAGCAGCATGG + Intergenic
930925124 2:56808931-56808953 CTGTTGATTTATTTGGATCCTGG + Intergenic
931079434 2:58752811-58752833 CTGTTGCTTCAGAGGGTGCAAGG + Intergenic
935401972 2:102669693-102669715 CTGATGATTCCTATGGACAACGG + Intronic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
942801949 2:179885660-179885682 CTGTTTGTTTATATGGAACATGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
946299467 2:218813849-218813871 CTGTGGATTCATGTTTAGCATGG + Intronic
946757757 2:222964219-222964241 ATGTTGTTTCTCATGGAGCAAGG + Intergenic
947981584 2:234414973-234414995 ATGCTGGTTCAAATGGAGCAAGG - Intergenic
1170285604 20:14704907-14704929 CTGTTACTTCCTATGGAGGAAGG + Intronic
1170703997 20:18728364-18728386 CTGAGGTTTCATAGGGAGCACGG - Intronic
1170870364 20:20200364-20200386 ATCTTGATTCAAATGGAGGAGGG - Intronic
1172678404 20:36692512-36692534 ATGTTGATTCTTGTGGGGCACGG - Intronic
1173668311 20:44778697-44778719 CTGTTGACTGAAAAGGAGCAGGG - Intronic
1174680320 20:52400186-52400208 CAGTTGAGTCATGTGGAGTAAGG + Intergenic
1178264647 21:31131880-31131902 CTGTGGCTTCATATGGCGAAAGG - Intronic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1180563617 22:16643706-16643728 CTGTTGCTTCATCTGGTCCAGGG + Intergenic
1181576908 22:23801017-23801039 CTGTTGATGGTTGTGGAGCATGG - Exonic
1183919972 22:41157948-41157970 CTGTTAACTCATCTGGAGTAGGG + Intronic
949443008 3:4103803-4103825 CAGTTGTGTGATATGGAGCAAGG - Intronic
949751303 3:7355401-7355423 CTGGTGAATCATATGGACCAAGG - Intronic
949935420 3:9112166-9112188 CTTTGGATTCATCTGGAACATGG - Intronic
950498306 3:13347631-13347653 CTGTTGATACATATTCAGCACGG - Intronic
956252938 3:67253682-67253704 CTGTTGCTTCAGAGGGTGCAAGG + Intergenic
957849955 3:85794859-85794881 ATGTTGATTCATACAAAGCAAGG + Intronic
960436201 3:117629601-117629623 CTCTTGATTCTTATGGAGTCTGG + Intergenic
960694587 3:120383594-120383616 CTTTGGATTCATATGGATTATGG + Intergenic
962348851 3:134642270-134642292 CTCCTGTTTCATATGGGGCATGG + Intronic
963807664 3:149741587-149741609 TTGTTGAACCAAATGGAGCAGGG + Exonic
964404452 3:156334446-156334468 CTCTTGAGTCATATGGACCTGGG + Intronic
970661861 4:18294134-18294156 ATGTTGATTGATATTCAGCAAGG + Intergenic
971253526 4:24993061-24993083 CTGTTGATTCATTTGTAAAATGG + Intergenic
972646865 4:40976746-40976768 CTATTTATTCAGATGGGGCAAGG + Intronic
972968927 4:44548480-44548502 CATTTGATGCATATGTAGCATGG - Intergenic
972996583 4:44886364-44886386 CTGTTTATTCAAATGTATCAAGG - Intergenic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
977781359 4:100985115-100985137 ATGTTGATTCATTGGGAGCTAGG + Intergenic
978195609 4:105968339-105968361 CTCTTGTTTTATAAGGAGCAAGG + Intronic
979411219 4:120382532-120382554 CTATATATTCACATGGAGCACGG - Intergenic
979600780 4:122584651-122584673 CTGGTGATTCATCTTTAGCATGG + Intergenic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
983907576 4:173199919-173199941 TTGTTGATTCAAAAGGAACATGG - Intronic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
985338158 4:188918383-188918405 CTGAAGATTAATCTGGAGCAAGG - Intergenic
987494872 5:18630506-18630528 CTGTTGCTTCAGAAGGTGCAAGG - Intergenic
987575045 5:19715438-19715460 CTGTTGTTTCAGACAGAGCATGG + Intronic
988425863 5:31063467-31063489 CTGTTGATTCAAATTCATCAAGG - Intergenic
992817326 5:80456503-80456525 CTGTTGATTCATATGGAAATGGG + Exonic
994380600 5:99066545-99066567 CTGTTGATTCATCTGGAGGATGG - Intergenic
995146802 5:108796241-108796263 CTTTTGAGTCACCTGGAGCAGGG + Intronic
1000966916 5:167668537-167668559 CTGTTGATTCCTAAGTAGCCAGG - Intronic
1003820948 6:9896433-9896455 CTGTTGATTTATATGGTGACTGG - Intronic
1004534697 6:16489280-16489302 CTGGTGATTCTTTTGGAGTAAGG - Intronic
1004664633 6:17738574-17738596 CTGTTTTTTCATATAAAGCAGGG - Intergenic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1010108492 6:72196036-72196058 CTATTGATACATGTGGATCATGG + Intronic
1010570535 6:77468232-77468254 GTGTTTATTCATATGGAGATAGG - Intergenic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1016253946 6:142081119-142081141 CTGTTTATTCAAATGGTGGAAGG + Intronic
1017988896 6:159469378-159469400 CAGTTGAGCCATATGGACCAGGG - Intergenic
1018841824 6:167522923-167522945 CTGTTGCTTTATTTAGAGCAGGG + Intergenic
1020588967 7:10109799-10109821 CTGTAGCATCATATGGAGAAAGG - Intergenic
1023702647 7:42907598-42907620 TGATTGATTCATAGGGAGCAGGG + Intergenic
1027438358 7:78191576-78191598 TTGTTGATTGATGTGGAGCCTGG + Intronic
1030549356 7:110938493-110938515 TTGTTGTTTCATTTGGAGAAAGG - Intronic
1031298847 7:120039280-120039302 CTGTTGCTTCACAGGGTGCAAGG - Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1033029943 7:137816329-137816351 CAGTTGGTTCATATGTAGAATGG + Intronic
1033356970 7:140607814-140607836 CTGCTGGCTCATATGGAACAAGG - Intronic
1033911601 7:146269791-146269813 CTGTTGCTTCATGTGTGGCATGG + Intronic
1033947298 7:146736221-146736243 CTGGAGTTTCATATGGAGCAGGG + Intronic
1034727232 7:153348355-153348377 CAGTTGTTTCATATGGGGGAAGG - Intergenic
1036596927 8:10221711-10221733 CTGTTGATTAAAATAAAGCAGGG + Intronic
1036993407 8:13626831-13626853 CTGACGATTCTTATGGAACAGGG + Intergenic
1037432347 8:18827111-18827133 CTCTTTATTCATATGGTGCCCGG - Intronic
1038163505 8:25062857-25062879 CTATTTATTCATATGGAGACAGG + Intergenic
1043504437 8:80888352-80888374 CTGTTGATTCACATGTGACATGG - Intergenic
1043577266 8:81672468-81672490 CTGTTGAATTATAGGGTGCATGG - Intronic
1043714680 8:83467169-83467191 CTGTTGTTTCAGAGGGTGCAAGG + Intergenic
1044808330 8:96031629-96031651 CTGTTTCCTCATATGAAGCATGG - Intergenic
1047796907 8:128267025-128267047 CTGTTTTTTCATAAGGATCAGGG - Intergenic
1050581085 9:7057886-7057908 CTCTTGCTTCATTTTGAGCACGG + Intronic
1054936182 9:70691004-70691026 ATGATGATTTATATGGAGGAGGG + Intronic
1055259771 9:74419972-74419994 CAGTTTACTCATATGCAGCATGG - Intergenic
1186501699 X:10055807-10055829 ATGTGGATTCATCTGGAGCCTGG + Intronic
1187117822 X:16371284-16371306 TTGTTGAATAATATGGAGCTGGG + Intergenic
1191032857 X:55993713-55993735 CTGTGGATTCTTATGGTTCAGGG + Intergenic
1191673357 X:63769726-63769748 CTGTTGCTTCAGAGGGTGCAAGG + Intronic
1195081855 X:101378712-101378734 CTGTTGCTCCATAGGGAGCTGGG - Intronic
1196174097 X:112621391-112621413 CTGTTTATTCATCTGTAGTAGGG - Intergenic
1202600065 Y:26584662-26584684 CTGTTGCTTCATCTGGTCCAGGG + Intergenic