ID: 977100989

View in Genome Browser
Species Human (GRCh38)
Location 4:92814821-92814843
Sequence CACCATGTTCTATAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977100986_977100989 8 Left 977100986 4:92814790-92814812 CCATCAGACACAGTGTCTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 179
Right 977100989 4:92814821-92814843 CACCATGTTCTATAGGAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977100989 Original CRISPR CACCATGTTCTATAGGAGCC AGG Intronic
905349284 1:37333454-37333476 CACCTTGCTGTATGGGAGCCCGG - Intergenic
912801463 1:112722416-112722438 CACCGTGTTCCATAGCAGGCAGG + Intronic
919747243 1:201016608-201016630 CACCCTGTTTTATAGAAGACTGG - Intronic
919913617 1:202127018-202127040 CATCAGGGTCTATGGGAGCCAGG + Intronic
923258107 1:232239463-232239485 CACAAGCTTCTATATGAGCCAGG - Intergenic
1063295308 10:4799427-4799449 GTCCATGTTCTATAGCAGACGGG + Intronic
1064994272 10:21282690-21282712 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1065326546 10:24554919-24554941 CACTATGTCCAATAGAAGCCTGG - Intergenic
1067312256 10:45125134-45125156 CACCATGTTCCATTCAAGCCTGG + Intergenic
1067529297 10:47058917-47058939 TACCATGTTCTGGAGGACCCTGG + Intergenic
1069771601 10:70903897-70903919 CACCCTGTGCTCTAGGATCCAGG - Intergenic
1069830204 10:71278391-71278413 CAGCATGTTCTGTAGGGCCCAGG - Intronic
1073917797 10:108426828-108426850 CTCCATCTTCTATAGGCTCCAGG - Intergenic
1074531114 10:114299485-114299507 CCCCAGGTTCTATCCGAGCCTGG - Intronic
1075549472 10:123381601-123381623 CACAGTGTTCTTTAGGGGCCAGG + Intergenic
1079246080 11:18753259-18753281 CACCATGTTCTCAAGGTGTCAGG + Intronic
1083441425 11:62679036-62679058 CACCCGGCTCTATAGCAGCCGGG + Exonic
1085958425 11:81429516-81429538 CACCATGTTATTTAAGAGGCTGG - Intergenic
1089978500 11:122753250-122753272 CACCATGTTGACCAGGAGCCAGG - Intronic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1095470418 12:42530833-42530855 CACCATGTTTTACAGGTGCCGGG - Intronic
1097001565 12:55881324-55881346 CACCATGCACTGCAGGAGCCAGG + Intergenic
1097276281 12:57815582-57815604 CCCCATATTTTGTAGGAGCCAGG + Intronic
1106136047 13:26974504-26974526 CACCATGTTCTGCCTGAGCCCGG + Intergenic
1106331825 13:28746413-28746435 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1107376051 13:39805799-39805821 CTCCATGTTGAATAGGAGCTGGG - Intergenic
1107660309 13:42632292-42632314 CACCTAGTTATAAAGGAGCCTGG - Intergenic
1113089783 13:106605141-106605163 CTCCATGTTGAATAGGAGCTAGG + Intergenic
1114584266 14:23795449-23795471 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1116329936 14:43583028-43583050 CACCATCTTGAATAGGAGCTGGG + Intergenic
1116666363 14:47780933-47780955 CACTATGGGCTAGAGGAGCCTGG - Intergenic
1119851198 14:77867783-77867805 CACCATGTTCTATGTCATCCTGG + Intronic
1120133853 14:80840579-80840601 CACAATGTTCTAAAGGATCCTGG + Intronic
1120959687 14:90113481-90113503 CACCATCTTCAATTGGATCCTGG + Intronic
1121979023 14:98437527-98437549 CACCCTGTCCTTGAGGAGCCGGG - Intergenic
1127650171 15:60999294-60999316 CCCCATGTTCAAATGGAGCCTGG - Intronic
1129783951 15:78295548-78295570 CACCCAGCTCTTTAGGAGCCAGG + Intronic
1132533783 16:467297-467319 CACCATCCTCTTCAGGAGCCTGG - Intronic
1132856825 16:2048820-2048842 CACCAGGTTCTGTGGGAGACGGG + Intronic
1135314670 16:21434422-21434444 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135367593 16:21866702-21866724 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135444221 16:22504460-22504482 CTCCATCTTAAATAGGAGCCGGG - Intronic
1135742028 16:24984170-24984192 AAACATGTACTATGGGAGCCAGG + Intronic
1135959685 16:26985287-26985309 CTCCATCTGCTATAGGAGCTGGG + Intergenic
1136294894 16:29295927-29295949 CACTCTGCTCTAAAGGAGCCGGG - Intergenic
1136311334 16:29413104-29413126 CTCCATCTTAAATAGGAGCCGGG + Intergenic
1136324782 16:29514897-29514919 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136351989 16:29716516-29716538 CTCCACGTTCTAGAGGAACCAGG - Intergenic
1136439467 16:30254882-30254904 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1138470920 16:57235612-57235634 CACTCTGTTCTATAGGGTCCAGG - Intronic
1142100788 16:88269938-88269960 CACTCTGCTCTAAAGGAGCCGGG - Intergenic
1142218099 16:88839695-88839717 CACCATGTGCGGGAGGAGCCTGG + Intronic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1146181545 17:30701449-30701471 CACCATGCTCAAAAGAAGCCAGG - Intergenic
1149498405 17:57133675-57133697 CACCATGTTCTATATGTACGTGG - Intergenic
1150785729 17:68161546-68161568 CTCCATGTTCTAAAGAAGGCAGG + Intergenic
1152327981 17:79652988-79653010 CACCATTTTCTACAGCAGCATGG + Intergenic
1155584224 18:27346368-27346390 AATCATGTTCCATAGGATCCTGG - Intergenic
1157344064 18:46807586-46807608 CACCATGTTCCATGTTAGCCAGG + Intergenic
1163632877 19:18426099-18426121 CCCCATGTTCTCTAGGGGCCGGG + Intronic
1164628699 19:29746799-29746821 CTCCAGGTGGTATAGGAGCCCGG - Intergenic
1165505874 19:36228998-36229020 CACCAGATTCTAGAGGGGCCAGG + Intronic
926689322 2:15722224-15722246 CTTCATTTCCTATAGGAGCCGGG - Intronic
927215765 2:20667162-20667184 CACTATGTTCAAAAGGCGCCGGG + Exonic
928439728 2:31282245-31282267 CTCCATGTTAAATAGGAGCTGGG + Intergenic
929400113 2:41569918-41569940 AACCATGTTCTGCAAGAGCCTGG + Intergenic
929870647 2:45756212-45756234 CACCCTGTTTTCTAGGATCCTGG + Intronic
933634123 2:84688567-84688589 AAACATGTTCTATAGCATCCTGG - Exonic
940169740 2:150815645-150815667 AATCATGTTCTCCAGGAGCCAGG + Intergenic
945372576 2:209037656-209037678 CACCAAATTTTATAGGAGCAAGG - Intergenic
946733979 2:222735936-222735958 CACCAGGTTCCCGAGGAGCCAGG - Intergenic
948964219 2:241363722-241363744 TACCATGTTCTACAGAAGGCTGG + Intronic
1168821102 20:774342-774364 CACTAAGTTCTCCAGGAGCCTGG - Intergenic
1174297395 20:49558639-49558661 CTCCATGTTGAATAGGAGCTGGG + Intronic
1174502415 20:50995425-50995447 CACCTTGTTGTAAAGGAGACTGG + Intergenic
1175144714 20:56886761-56886783 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1178180191 21:30151408-30151430 CACCATGCACAATAGAAGCCAGG + Intergenic
1182715965 22:32356427-32356449 CACCCTGTTGGATAGCAGCCCGG - Intronic
1183258570 22:36779198-36779220 CACACTTTTCTAGAGGAGCCAGG + Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
951940999 3:28078965-28078987 CACCATGTTCAAGAGGAGCAAGG - Intergenic
954930984 3:54281098-54281120 CTCCAGGTTGTTTAGGAGCCAGG - Intronic
957225715 3:77442730-77442752 TACCATGTTCCAAATGAGCCGGG + Intronic
960304250 3:116041850-116041872 CATCATTTTATATAGCAGCCAGG + Intronic
976016977 4:80567473-80567495 AACAATATTCTTTAGGAGCCAGG - Intronic
977100989 4:92814821-92814843 CACCATGTTCTATAGGAGCCAGG + Intronic
980988198 4:139715932-139715954 CTCCATGTTAAATAGGAGCTGGG - Intronic
984909898 4:184664680-184664702 CACCCTGCTGTAGAGGAGCCTGG + Intronic
984923610 4:184787317-184787339 CACCCTGTTCTCAAGGAGCTCGG + Intronic
989281921 5:39654561-39654583 CTCCAAATTCTAGAGGAGCCAGG - Intergenic
992865846 5:80956492-80956514 CTCCATCTTAAATAGGAGCCGGG - Intergenic
995623657 5:114054835-114054857 CACCAGGATCTACAGGGGCCGGG + Intergenic
995813131 5:116132064-116132086 GACGAGGTTCTATAGGAGGCAGG + Intronic
997668488 5:135651142-135651164 AAGCATGCTCTGTAGGAGCCTGG - Intergenic
1001912757 5:175534579-175534601 CACCAGGTTCTGCAGGAGCACGG + Intergenic
1002188266 5:177465919-177465941 CACCATGTTCTTTATGTGGCAGG + Intronic
1013592287 6:111629324-111629346 CACCATGCATTATAGGAGCCAGG + Intergenic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1036345156 8:7956287-7956309 CAGGATGTTCTATATCAGCCAGG - Intergenic
1036481220 8:9141352-9141374 CACAATGTTGTCTAGGAGCTCGG + Exonic
1036862287 8:12363299-12363321 CAGGATGTTCTATATCAGCCAGG - Intergenic
1045658392 8:104410621-104410643 CACCATTTTCTACTGGTGCCAGG + Intronic
1049414490 8:142489066-142489088 CACCGTGCTCTACAGGAACCTGG + Exonic
1051156439 9:14152414-14152436 AACCATGTTCTATATGACACTGG + Intronic
1051274266 9:15383998-15384020 GACCATGTTGTCTAGGGGCCAGG + Intergenic
1055291041 9:74782075-74782097 CACCATTTTCTATAAGGGACTGG + Intronic
1061258432 9:129466160-129466182 CACCAGGGTCTATGGGAGGCTGG + Intergenic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1190768118 X:53492443-53492465 CACCATGCACTGTAGGAACCAGG + Intergenic
1193312474 X:80024538-80024560 CCCCAGGCTCTATGGGAGCCTGG + Intronic
1193359172 X:80560688-80560710 CACCATGTCCAAGAAGAGCCAGG - Intergenic
1194041017 X:88941913-88941935 CACCATGTTGAATAGAAGCTAGG - Intergenic
1198845004 X:140900867-140900889 CACCATCTTGAATAGGAGCTGGG - Intergenic
1201896500 Y:18997907-18997929 CTTCATGTTCTATGGGAGGCTGG + Intergenic
1202245844 Y:22819213-22819235 CACAATGTTCTCTAGGGGCAGGG - Intergenic
1202398832 Y:24452961-24452983 CACAATGTTCTCTAGGGGCAGGG - Intergenic
1202471948 Y:25217125-25217147 CACAATGTTCTCTAGGGGCAGGG + Intergenic