ID: 977103260

View in Genome Browser
Species Human (GRCh38)
Location 4:92845932-92845954
Sequence GTGGAAAAATAGATCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977103260_977103266 18 Left 977103260 4:92845932-92845954 CCCTGTTTGATCTATTTTTCCAC 0: 1
1: 0
2: 3
3: 33
4: 349
Right 977103266 4:92845973-92845995 CCCCAACCTCAAAGCTATTTAGG 0: 1
1: 0
2: 1
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977103260 Original CRISPR GTGGAAAAATAGATCAAACA GGG (reversed) Intronic
902958787 1:19946621-19946643 GTGCAAAGATGAATCAAACATGG + Intergenic
903982222 1:27197422-27197444 GAGAAAAAATAAATCAAACTTGG + Intergenic
906386997 1:45378507-45378529 GTGGAAAAAGAGAAGAACCAAGG + Intronic
909103556 1:71380633-71380655 GAGAAAAAATAGAGCAAAGAAGG + Intergenic
909385886 1:75056319-75056341 ATGGAAAAATAAAACAAGCAAGG + Intergenic
909518119 1:76534849-76534871 ATGGAATAATAGATTATACAGGG + Intronic
909626362 1:77720210-77720232 GTGGAAAAAAAGATAAAGGATGG + Intronic
912157581 1:106941065-106941087 ATGTAAAAATAAATCAAACTTGG + Intergenic
913165778 1:116183038-116183060 GTGGAACATTAAACCAAACATGG - Intergenic
914958311 1:152184491-152184513 ATGGAAAAAAAGAGGAAACATGG + Intergenic
915809928 1:158897549-158897571 GAGCAAAAATAAACCAAACAGGG - Intergenic
915952119 1:160196449-160196471 GAAGAAAAAAAGAACAAACATGG - Intronic
916203331 1:162292435-162292457 GTGTAAACATGCATCAAACAAGG - Intronic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
917007951 1:170436437-170436459 ATGCAAAAATATATAAAACATGG - Intergenic
917425220 1:174906109-174906131 GTGGAAGAATGGCTCAAACCTGG - Intronic
917620140 1:176787147-176787169 CTTGAAATATAGATCAAAAATGG + Intronic
917904355 1:179574880-179574902 GAGGAAAATTAGATCAAAGGAGG - Intronic
918113516 1:181478577-181478599 GAGGAAAAATAGAACAAAAGGGG + Intronic
919352608 1:196477758-196477780 GAGGAATAATAGAACAATCAGGG - Intronic
919577445 1:199329008-199329030 GTAATAAAAGAGATCAAACAAGG - Intergenic
920612003 1:207450010-207450032 GAAGAAAAATAGACCAAAGAAGG + Intergenic
921120675 1:212134047-212134069 GTCGAAAAATAGGCCACACACGG + Intergenic
921545639 1:216471804-216471826 GTGCAAAAGTAGATAAAAAAAGG + Intergenic
921665966 1:217871285-217871307 GTGAAAAAACAGAGCAAAAAAGG - Exonic
922711355 1:227835580-227835602 GTGGAAAAATGAAACAAACTGGG + Intronic
923238901 1:232061658-232061680 GTGGAAGAAGAGAACAGACAGGG - Intergenic
1062840839 10:670875-670897 GTGGAAAAGTATATCATTCAGGG + Intronic
1063505122 10:6590855-6590877 ATGGAAAAATAAATAAAAGAGGG + Intergenic
1063584723 10:7341770-7341792 GTGGTAATATTGATTAAACAAGG + Intronic
1064089869 10:12374304-12374326 GTGGCAAAATCGACCAACCAGGG + Intronic
1064809550 10:19179845-19179867 GTGGAAAAATATATAGAACTAGG - Intronic
1065330272 10:24589305-24589327 GTGAAAAATTAAATAAAACATGG + Intronic
1065686658 10:28292031-28292053 ATGGTAAAAAAGATTAAACATGG - Intronic
1066175484 10:32899671-32899693 GTGGAAAACAAGATGAAACAGGG + Intergenic
1066203051 10:33160301-33160323 GTGGAGAAACAGGTCAAGCACGG - Intergenic
1068319248 10:55389260-55389282 GTGGAAAAATAGAGAGGACATGG + Intronic
1069198058 10:65579362-65579384 GTGCAAAAATAGGTCAAACATGG + Intergenic
1069324171 10:67210635-67210657 ATGGAAAAATGGATCCAAAATGG - Intronic
1069730935 10:70612671-70612693 GTGGTAAAATATATGTAACATGG + Intergenic
1070269434 10:74938471-74938493 GTGGAAAAAGAGAAGAAAGAAGG + Intronic
1070476404 10:76833567-76833589 GTTGAAAGATAGAACAGACACGG + Intergenic
1070875238 10:79798763-79798785 GTGAATAAATAAACCAAACACGG + Intergenic
1071172041 10:82877958-82877980 TTGGACAAATAGTTCAAAAAAGG - Intronic
1071642167 10:87320936-87320958 GTGAATAAATAAACCAAACACGG + Intergenic
1071822278 10:89290725-89290747 GTGGAAAATTACATCAAAGGGGG - Intronic
1072452838 10:95552743-95552765 GTGGAAGAATAAATCAACAAAGG + Intronic
1073354926 10:102846380-102846402 GTTGAAAAATAGATTAAAGTAGG - Intergenic
1074551920 10:114451722-114451744 TGGGAAAAACAGATCAACCAAGG + Intronic
1074656564 10:115595569-115595591 GTGTAATAAAAGAGCAAACAAGG - Intronic
1075156425 10:119980326-119980348 GTGGAGAAATAACTGAAACATGG + Intergenic
1077961977 11:7085100-7085122 GTGGTAAAATACATGTAACATGG + Intergenic
1077961982 11:7085173-7085195 GTGGTAAAATACATATAACATGG + Intergenic
1077964563 11:7114793-7114815 GTGGAGAGTTAGATCTAACAGGG - Intergenic
1079637000 11:22755157-22755179 GTGGGAGAATAGATATAACAGGG + Intronic
1079960384 11:26916506-26916528 GTTGAAAATTAGGACAAACAAGG - Intergenic
1080382061 11:31782301-31782323 GGGGAAAAACAGATGAAAAAGGG - Intronic
1080413509 11:32048549-32048571 GTGGCTAAACAAATCAAACATGG - Intronic
1080954830 11:37081128-37081150 ATGGTAAAATACATCAAATACGG + Intergenic
1081574849 11:44312551-44312573 GTGGAATAAAAGATTAAACCTGG + Intergenic
1082061861 11:47867745-47867767 GGGGACAAAAAGGTCAAACAAGG + Intergenic
1082768140 11:57184680-57184702 TTGGAAAAATTGAACAAAGAGGG + Intronic
1085906618 11:80772096-80772118 ATGGAAGAATAGAGAAAACAAGG - Intergenic
1086388986 11:86341040-86341062 TAGGAAAAATAGATTAAAAAGGG - Intronic
1086744956 11:90413317-90413339 CTGGAAAAATCAATCAAAAATGG + Intergenic
1086788305 11:91001128-91001150 GTGGAAAAATTGATGCAATAAGG - Intergenic
1087018342 11:93576857-93576879 GTGAATAAATAAATTAAACATGG - Intergenic
1087552509 11:99669598-99669620 CTAGAAAAATATATCAAACAGGG - Intronic
1087678977 11:101196983-101197005 GTGCAAAAATATATCAAGTAGGG - Intergenic
1088058487 11:105613123-105613145 GTGGAATAATAGATAAAGCTGGG - Intronic
1089265659 11:117259048-117259070 GTGGAAAAATTGCTCAAACCCGG - Intronic
1089812265 11:121141807-121141829 GTAGAAAAATGAATCAAACATGG + Intronic
1089998857 11:122935569-122935591 GTGGAAAAATAGCGGAGACAGGG - Intronic
1091007747 11:131968844-131968866 GTGGGAAAATAGTTGAAATAAGG - Intronic
1091578674 12:1765426-1765448 GTGGAAATCTAGATCAAACATGG - Intronic
1091700595 12:2657570-2657592 GTAGAAAAATAAATAAAACATGG + Intronic
1092567978 12:9688415-9688437 GTTTCAAAATAAATCAAACAAGG + Intronic
1093677524 12:21961258-21961280 GTGGGAAAATCGCTCAAACTTGG + Intergenic
1093852398 12:24056494-24056516 ATGGAGAAATAGAGCAACCATGG - Intergenic
1095199339 12:39364220-39364242 TAGGAAAAATAGATCATGCAGGG + Intronic
1097340761 12:58435490-58435512 GTGGAAAAATAGCTCCAATAGGG + Intergenic
1097614915 12:61872280-61872302 GTGGAAATAGAGATCACATAAGG + Intronic
1097629598 12:62043904-62043926 TTGGAAAAATAAAACAAACGAGG + Intronic
1098179306 12:67829067-67829089 GTGGACACATAGCTCAAACATGG - Intergenic
1098352361 12:69576896-69576918 GTGGAACAATATATTAAAAATGG - Exonic
1098449433 12:70602672-70602694 GTGGGGATATAGATGAAACAAGG + Intronic
1100144400 12:91659537-91659559 GTGGAAAAATAAAGCAAGGAAGG - Intergenic
1102783689 12:115586668-115586690 GTGAATAAATAGACCAAATATGG + Intergenic
1105235694 13:18550669-18550691 GTGAACAAATAGAACAGACATGG + Intergenic
1105801525 13:23907298-23907320 TGGGAAAAATAAATCAAATATGG - Intergenic
1106942170 13:34791514-34791536 GAGGAAAAATAGTTCAGAAATGG + Intergenic
1107045565 13:35988546-35988568 TTAGAAAAATAGATCATAAATGG - Intronic
1107297774 13:38930621-38930643 TGGGAAAAATAAATCAAATATGG + Intergenic
1107951620 13:45466982-45467004 ATGGAAAAAAAGAACAAAGAAGG + Intronic
1108410865 13:50145496-50145518 TTGTAAAAATAAATCATACATGG - Intronic
1108797961 13:54055822-54055844 GTGGACAAATAGCTCACACTAGG + Intergenic
1109526495 13:63582266-63582288 ATTGAGAAATAGATCTAACAAGG - Intergenic
1109927927 13:69171201-69171223 GTGGGAGAATAGCTCAAACCTGG - Intergenic
1110939065 13:81326816-81326838 GTGGAAAAAGACAATAAACATGG - Intergenic
1111793889 13:92892631-92892653 GTGGAATAATAAACCCAACATGG - Intergenic
1111851721 13:93584190-93584212 GAAGAAACATAGATCAAAGAGGG + Intronic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1115707868 14:36016552-36016574 GTGGCATAATAGAAAAAACAGGG + Intergenic
1115714302 14:36085695-36085717 TTGGAAATGTAGAGCAAACATGG - Intergenic
1115755571 14:36523953-36523975 GTTCAAAGATAGATAAAACAGGG - Intergenic
1119864324 14:77960639-77960661 ATGGAAATATAGCTCAAATATGG - Intergenic
1119926999 14:78504115-78504137 GTGTACAAATAGATCAACCAAGG - Intronic
1120480989 14:85049013-85049035 GTGGAATAATTGATTAAACAAGG + Intergenic
1122358566 14:101141271-101141293 GTGGAAAATAAGAACAAAAAGGG - Intergenic
1124110364 15:26779745-26779767 GTGGAAAAACAGCCCAAGCAAGG + Intronic
1124183906 15:27504206-27504228 GAGGAGAAATAGAACAAAAAAGG - Intronic
1124508006 15:30295562-30295584 GTTGTAAAATTGATCAAAGATGG - Intergenic
1124723939 15:32138327-32138349 CTAGAAAAATAGACCAAAAAGGG + Intronic
1124735549 15:32243095-32243117 GTTGTAAAATTGATCAAAGATGG + Intergenic
1124897611 15:33791557-33791579 GTGGAAGAATAGATGCACCAGGG + Intronic
1125149230 15:36512378-36512400 GTAAAAAATTAGATGAAACAAGG - Intergenic
1126214134 15:46134370-46134392 CTGAAAAAATAGAAAAAACAAGG - Intergenic
1127926323 15:63547059-63547081 GAGGAAAAAGAAATCAAACCAGG + Intronic
1129023869 15:72550130-72550152 TTAGAAAAATAAATCATACATGG - Intronic
1130710737 15:86278569-86278591 CTTGAAAAATAAAACAAACATGG - Intronic
1130877189 15:88024675-88024697 GTGGAAAAATGGATTCAGCATGG + Intronic
1131401759 15:92131001-92131023 GTGGAAGAATTGATGAAACCAGG - Intronic
1133637317 16:7680294-7680316 GTGGCACAGTTGATCAAACAGGG - Intronic
1134334475 16:13284981-13285003 GTGAAAAAAAAGATCAAACATGG - Intergenic
1134561613 16:15215050-15215072 GTGGAAAAAAAGAATAAACAAGG + Intergenic
1134922151 16:18126676-18126698 GTGGAAAAAAAGAATAAACAAGG + Intergenic
1135588087 16:23686387-23686409 TAGTAAAAATAGATGAAACATGG - Intronic
1137934553 16:52622071-52622093 ATGAAAAAATAGAAGAAACAAGG + Intergenic
1138166847 16:54810282-54810304 TTCCCAAAATAGATCAAACAGGG - Intergenic
1138617773 16:58184520-58184542 GTGGGAGTATAGATGAAACAAGG + Intronic
1140057309 16:71536730-71536752 GTGGAAGAATAGAGCCAAGATGG - Exonic
1141417355 16:83886251-83886273 GTGGCAGCATAGATCAGACAGGG + Intergenic
1141773308 16:86104777-86104799 ATGGAAAAATATATAATACAAGG + Intergenic
1143881832 17:10035734-10035756 GTGGAAAGATTGGTGAAACAAGG + Intronic
1144058506 17:11561272-11561294 GTGCAAAAATGAATAAAACAAGG - Exonic
1144307845 17:13985269-13985291 GTGGAAAAAAAGAACACACAAGG + Intergenic
1144361425 17:14498102-14498124 GTTGACAAATAGATACAACAGGG + Intergenic
1145075264 17:19848990-19849012 GTGGAAAAATATATCCAAGAAGG - Intronic
1145407618 17:22619270-22619292 GTGAATAAATAAATCCAACACGG + Intergenic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1146547285 17:33750004-33750026 GTGGATATTTAGATCAAAGAGGG - Intronic
1146618759 17:34379282-34379304 TTGGAAAAAAAAATCAAAAAAGG - Intergenic
1146701002 17:34960297-34960319 GTGGAAAAGTAGATGAGGCAGGG - Intronic
1147025176 17:37575891-37575913 GTGAAAAAAAAGATCCCACATGG + Intronic
1147836053 17:43332640-43332662 GTGGAAAAATAGGTTGAATATGG + Intergenic
1148904427 17:50902996-50903018 GTGGAACAATGGGTCAGACAGGG + Intergenic
1149338524 17:55662750-55662772 GTGGAAACAAAGATCAGATATGG - Intergenic
1150899056 17:69249985-69250007 CTGGAAAAAAAGATAAAATATGG + Intronic
1150965432 17:69962616-69962638 GAGGAAAAATAGACAAAAAAAGG + Intergenic
1154513844 18:15139330-15139352 GTGAACAAATAGAACAGACATGG - Intergenic
1155837405 18:30603382-30603404 GCCAAAAAATAGATTAAACAGGG + Intergenic
1156221195 18:35053972-35053994 GAGGAAAAATAAATGTAACAAGG + Intronic
1158090799 18:53710831-53710853 TTGGAAAAAATGATCAAAGATGG + Intergenic
1158139021 18:54237106-54237128 AAGGAATAATAAATCAAACAAGG - Intergenic
1158826420 18:61225258-61225280 GTCCAAAAAAATATCAAACATGG + Intergenic
1158919007 18:62168399-62168421 GTGGGAAAAAAGAACAAATAGGG - Intronic
1159114354 18:64095894-64095916 CTGGAAAAATTTATGAAACATGG + Intergenic
1160459122 18:79024319-79024341 GTGGGACAATAGATTGAACAGGG + Intergenic
1164454777 19:28397975-28397997 GTGGAAAATCAGATCAGCCAAGG - Intergenic
1164650233 19:29886128-29886150 GTGGAAAGATGGGTCAAAGACGG - Intergenic
1164718290 19:30410061-30410083 TTGGAAAAATAGTTCGTACATGG + Intronic
1167405746 19:49307176-49307198 ATGGAAAAATGCATAAAACAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926108761 2:10168912-10168934 GTTGAATAACAGATGAAACACGG - Intronic
926340988 2:11904207-11904229 GTGGAAAAATAGACAAAATGAGG - Intergenic
928038622 2:27851138-27851160 GTGGAAGAATAGAACACACCAGG - Intronic
928121840 2:28589373-28589395 TTGGAGAAAGAGATCAATCAAGG + Intronic
929400758 2:41578780-41578802 GTTGAAAATGTGATCAAACAGGG - Intergenic
929937629 2:46305553-46305575 GTGGAAAAATATTTCAGAAAGGG + Intronic
930070775 2:47364433-47364455 GTGGAAAAAGATATGAAAAAGGG + Intronic
931145389 2:59511562-59511584 GGGGAAAAATATATAAATCAGGG + Intergenic
933559254 2:83871714-83871736 ATGAAAAAATAGCTAAAACAGGG - Intergenic
936750606 2:115636802-115636824 GTGGATAAATAACTTAAACAGGG + Intronic
937642966 2:124234753-124234775 TTGGAAAAATGGAGCAATCAAGG - Intronic
937815728 2:126248782-126248804 TTGCAAAAAGAGAACAAACAAGG + Intergenic
937824682 2:126355431-126355453 GTGGCTAAATATATCAATCAGGG - Intergenic
938149454 2:128869403-128869425 GGGGAAAAACAGAACAGACAAGG - Intergenic
938514087 2:131983943-131983965 GTGAACAAATAGAACAGACATGG - Intergenic
940644754 2:156379385-156379407 ATTGAAAAATTGATCAGACAAGG - Intergenic
942287003 2:174429360-174429382 GTGGAAATAAAGAACAAAAATGG - Exonic
942295512 2:174513203-174513225 GTGGAAATAAAGAACAAAAATGG - Intergenic
942396828 2:175558432-175558454 GTGGAAACATAGATTAAAAGTGG - Intergenic
942877478 2:180818692-180818714 GTGCAAAAACAGATCAAAGAAGG - Intergenic
943288372 2:186034750-186034772 CTGAAAAAATAGATCAATCCTGG - Intergenic
944750054 2:202699692-202699714 GTGGTAAAATATATATAACAAGG + Intronic
944854822 2:203757635-203757657 GTGGAAATATCCTTCAAACATGG - Intergenic
944933197 2:204541685-204541707 GTGGAAAAAAAGTTGAAAGAGGG + Intergenic
945659175 2:212664077-212664099 GTGGAAAAAAGGATCAACCAAGG + Intergenic
946473195 2:219981971-219981993 GTGGAAAAGTAGAGAAAACCAGG + Intergenic
946917708 2:224542697-224542719 GTTGAAAAATAGGCCAGACACGG - Intronic
947288930 2:228549994-228550016 GTGGATAAATCTCTCAAACATGG + Intergenic
1169100745 20:2946412-2946434 GAGGAAAAAGAGAGCAAACATGG + Intronic
1169938099 20:10906428-10906450 GTGGAAAAATACAGCAGAGAGGG - Intergenic
1170528917 20:17269517-17269539 TTTGAAAAATAGATCAGAGAGGG - Intronic
1171046999 20:21818224-21818246 GTGGAAAAATAAATGGAACAAGG + Intergenic
1173430119 20:42980307-42980329 GTACAAACATAGATCCAACACGG + Intronic
1174238551 20:49114540-49114562 GGGAAAAAAAAGACCAAACACGG + Exonic
1175481102 20:59311652-59311674 GTGGAAAAAAAAAAAAAACATGG - Intronic
1176667599 21:9701816-9701838 GTGGAGAGATATATCAAACCAGG - Intergenic
1176779695 21:13178954-13178976 GTGAACAAATAGAACAGACATGG + Intergenic
1177977336 21:27867994-27868016 GTGAACAAATAGAACAGACATGG + Intergenic
1178579911 21:33829601-33829623 CTGAAAAACAAGATCAAACACGG - Intronic
1178871936 21:36384654-36384676 TTGGAAAAAAAGAACAGACATGG - Intronic
1178965962 21:37118171-37118193 GAGCAAAAGTAGATCATACAGGG + Intronic
1180486640 22:15806740-15806762 GTGGAAAAGAAGATTAAAGAGGG + Intergenic
1182912364 22:33995739-33995761 GTGGAAAAACATATCAAACTGGG + Intergenic
1183289169 22:36988452-36988474 GTGCAAAAATAAATAAGACATGG - Intergenic
949670121 3:6389724-6389746 TTGAAAAAATATATCATACATGG - Intergenic
949752146 3:7366016-7366038 ATGGAAAAATGGACCATACATGG - Intronic
950141188 3:10617044-10617066 GTGGCAATATAGATCACAGAAGG - Intronic
950201659 3:11048691-11048713 GTGGAAGACCAGATCAGACAGGG - Intergenic
951156874 3:19365779-19365801 GTAGAAAAATAAAGCAAAGAAGG + Intronic
951441902 3:22733006-22733028 TTGGAAAAATAAATCTAAGAGGG - Intergenic
952645586 3:35654167-35654189 GTGATAAAATAGATGAAAAATGG + Intronic
953297139 3:41730505-41730527 GTTGAAAAATCTATCAAAAATGG + Intronic
953409479 3:42682245-42682267 GTGGAGATAGAGATGAAACAGGG + Intergenic
953829796 3:46286139-46286161 GTGGAAAAATAGCTCATTTACGG - Intergenic
954638257 3:52083322-52083344 GTGGCGAAACAGAGCAAACAAGG + Intronic
956449808 3:69363118-69363140 GTGGAAAAATAGAAGAAGCCTGG - Intronic
957681893 3:83447752-83447774 GTGGAAAAAAACAATAAACAAGG + Intergenic
957853871 3:85847671-85847693 GTGGAAGAATTGGCCAAACAAGG + Intronic
958115142 3:89205907-89205929 GTAGAAAAATGAATGAAACATGG + Intronic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958954741 3:100455425-100455447 GTGGCAAATGAGATCACACATGG - Intronic
959472214 3:106765987-106766009 GAGGAAAAACAGAGCAAATAAGG + Intergenic
960260083 3:115557447-115557469 GTGGGAAAATGAATGAAACAGGG + Intergenic
960294768 3:115929538-115929560 GTGAAAATACACATCAAACAGGG + Intronic
960334525 3:116400333-116400355 GAGGAAAGAAAGATCAAACTTGG - Intronic
962208069 3:133451934-133451956 GTGGAAAAGTAGAGAAAATAAGG + Intronic
962670470 3:137700947-137700969 GAGCAAAAATAGAATAAACAGGG - Intergenic
962832068 3:139151892-139151914 AAGGAAAAATAGAAAAAACAGGG + Intronic
963036175 3:141030933-141030955 GTGGAAAAGTAGAAGAACCACGG + Intergenic
963247300 3:143074984-143075006 GTGGAGCATTAGATCAAGCATGG - Intergenic
963265529 3:143236521-143236543 GTGGTAGAATTGATAAAACATGG + Intergenic
965423728 3:168495936-168495958 GTGGAAAAGTAGTTTAAATATGG - Intergenic
965479392 3:169198907-169198929 GTGGAAAAAAAAATTAAATAGGG + Intronic
965488248 3:169305488-169305510 GCAGAAAAAAAGAACAAACATGG + Intronic
965489285 3:169316979-169317001 TTGGTAAATTAGATCAAAAAGGG + Intronic
966010917 3:175075855-175075877 GTCTAAAAATAGATAAAATAAGG + Intronic
966288899 3:178331323-178331345 GTGGAAAAAAAGAAAAAAAAAGG + Intergenic
968709208 4:2100732-2100754 GAGTAAAAATAGATAAATCAGGG + Intronic
968884299 4:3319052-3319074 GTAGAAATATTCATCAAACACGG - Intronic
970992580 4:22230013-22230035 GGGGAAAAATAATTCAAAGATGG - Intergenic
971903015 4:32686860-32686882 TTGTAAAAATAGAACAAAGATGG - Intergenic
972051310 4:34737861-34737883 GTGCAAAAATAGAATAAATAAGG + Intergenic
972856188 4:43109798-43109820 GTTAAAATATAGATTAAACATGG + Intergenic
973033583 4:45375966-45375988 GTTGAAAAATAGAACAAAGTAGG - Intergenic
974219959 4:58955479-58955501 GAAGAAAAATAAATCAATCAAGG - Intergenic
974350809 4:60743643-60743665 GTTGAAAAAAAAATCAAAGAGGG + Intergenic
974418357 4:61640468-61640490 GTGGGAAAATGGAGCAAAGAGGG - Intronic
975201394 4:71594051-71594073 TAGGGAAAATAGATAAAACAAGG - Intergenic
975265835 4:72365814-72365836 GGGGAAAAATAAATTTAACACGG + Intronic
977103260 4:92845932-92845954 GTGGAAAAATAGATCAAACAGGG - Intronic
977764342 4:100778840-100778862 GTGGAAAAGTGAATCACACAGGG + Intronic
978795117 4:112701153-112701175 GAGGGAAAATAGATGATACAGGG + Intergenic
979039630 4:115772500-115772522 TTGGAAAACCAGATCAAAAAGGG + Intergenic
979915609 4:126429519-126429541 GTGGAAAAAAAGAACAAAATGGG + Intergenic
980160975 4:129162565-129162587 GTGAAAAAGTAGATGAAATATGG - Intergenic
981155128 4:141426000-141426022 GTTGAAAAAAAGAAGAAACATGG - Intergenic
981223257 4:142261622-142261644 GTGGGGAAATAGCTCAAGCAAGG - Intronic
982244895 4:153341904-153341926 GTGGCCAAATAATTCAAACAAGG + Intergenic
982914913 4:161195440-161195462 GGGGAAAAATACATCAGAAAAGG - Intergenic
984040699 4:174729818-174729840 ATAGAAAAATAGATGAAAAATGG - Intronic
984188707 4:176578650-176578672 ATGGTAAAATAGATAAAATATGG - Intergenic
984470986 4:180173254-180173276 GTAGAAAAACAGAACAAAAAAGG + Intergenic
984546275 4:181107930-181107952 GTGGAAAAATCGATGAAGAATGG + Intergenic
985249414 4:188008329-188008351 CTGGAAAAATAAACCAAACATGG - Intergenic
985407206 4:189649789-189649811 GTGGAGAGATATATCAAACCAGG + Intergenic
986441227 5:7783529-7783551 CTGGAAAAATAAAAAAAACAAGG + Intronic
986769714 5:10961624-10961646 GTAGAAATATAGATTAAACTAGG + Intergenic
987114678 5:14716838-14716860 GGGGAGAAAGACATCAAACAGGG + Intronic
987451534 5:18090071-18090093 ATGGAAAAATAAAACAAAAAGGG + Intergenic
988346016 5:30038858-30038880 TTGTAACAAGAGATCAAACATGG - Intergenic
989115035 5:37944170-37944192 GTCTAAAAGTAGTTCAAACAAGG - Intergenic
989436811 5:41423501-41423523 GTGGAAAAATTGATGAAAAAAGG - Intronic
990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG + Intergenic
990293586 5:54379355-54379377 GGGGAAAAACAAATCAAATAAGG - Intergenic
991152299 5:63384681-63384703 GTGGCAAAAGTGATCAATCATGG - Intergenic
992301199 5:75382098-75382120 TTTGAAAAACAGATCTAACATGG + Intronic
992370678 5:76140806-76140828 GAGGACAAAGAGATCAAGCAGGG - Intronic
993359604 5:86957761-86957783 GTGAAAAAATAAGTGAAACATGG - Intergenic
993516065 5:88836472-88836494 GTGGAAAAAGAGATAAAGAAAGG - Intronic
995469256 5:112483299-112483321 GAGCAAAAATAGATGAAACCTGG - Intergenic
996458189 5:123709123-123709145 GGGGAAAACTAGACCAAAGAGGG + Intergenic
998533764 5:142910172-142910194 GAGGAAAACTGGATCAAACAGGG - Intronic
999577320 5:152993622-152993644 GTGGAAAAAAAAATCACACTAGG - Intergenic
1001110321 5:168890686-168890708 GTAGAAGAATAGATGAAACAAGG + Intronic
1002598250 5:180338303-180338325 ATGGAAAAATAGAAGAAGCAAGG - Intronic
1002760574 6:198697-198719 ATAGAAAAATAGATGCAACAGGG + Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1003779862 6:9412322-9412344 GTGGATAAATATAACAGACATGG - Intergenic
1004295231 6:14404047-14404069 GAGGAAAACAATATCAAACATGG - Intergenic
1004601349 6:17153462-17153484 GAGGAAAAAAAGATCAAATAAGG - Intergenic
1004786896 6:18978201-18978223 GTGTAAAAATAAATAAAGCATGG + Intergenic
1005937960 6:30538727-30538749 GTGGGAAAATTGCTCAAACCTGG - Intergenic
1005966704 6:30731583-30731605 TGGGAAAAATAGATTAAACGGGG - Intronic
1006208182 6:32368976-32368998 GTGAAAAGATAGGTAAAACAGGG - Intronic
1006211267 6:32396884-32396906 GTGGAAAAATTGCTCGAACCCGG + Intronic
1006244019 6:32713981-32714003 TTGGAAAAAAAGAACAAAAAAGG - Intergenic
1006704133 6:36002795-36002817 GTGGGAGAATCGCTCAAACAAGG - Intronic
1007968676 6:46028607-46028629 GAGAGAAAATAGATCATACATGG - Intronic
1008562155 6:52734037-52734059 GTGGAAAAGTAAATCAGACATGG - Intergenic
1009320935 6:62287018-62287040 GGGGAAAATTAGAGCAAACGTGG - Intergenic
1009671291 6:66754241-66754263 GCAGAAAAATAAATAAAACATGG - Intergenic
1009779653 6:68254032-68254054 GTGCAAAAATAAATCTCACAGGG - Intergenic
1010340217 6:74741667-74741689 GGGGAAAAATAGAAGAAACAAGG + Intergenic
1010778409 6:79913297-79913319 GTGCAAAAATACAACAAAAAAGG + Intergenic
1012840854 6:104327156-104327178 GAGTAAAAATACAGCAAACAAGG - Intergenic
1014438860 6:121450706-121450728 GTGTAAAAATACAGAAAACAAGG + Intergenic
1014441585 6:121479792-121479814 GTGGGCATATACATCAAACAGGG + Intergenic
1015224228 6:130838207-130838229 ATAGGAAAGTAGATCAAACAAGG - Intergenic
1015821578 6:137266886-137266908 GTGCAAAGATGGATCAAACCTGG + Intergenic
1016246039 6:141982077-141982099 GTGGAAATATATATTAAAAAAGG - Intergenic
1017823118 6:158063065-158063087 ATGGAAACATACATAAAACAAGG + Intronic
1018493548 6:164323431-164323453 GTGGAAAAAAAGATCACAAATGG - Intergenic
1018620010 6:165721083-165721105 GTGGAGAAAAAGATCAAATCAGG + Intronic
1018621334 6:165732268-165732290 GTGGTAAAATAGGTGAAAGACGG - Intronic
1020229613 7:6307837-6307859 GGGGAAAAATAGCCCAAAGAAGG + Intergenic
1020882268 7:13777094-13777116 GTGGATGAAGAGATCAATCAGGG + Intergenic
1021193243 7:17645893-17645915 GAGGAAAACTATATCAAAGATGG - Intergenic
1021514190 7:21464927-21464949 GGTGAAAAATAAATCAAAAAAGG - Intronic
1022342866 7:29485578-29485600 GTAGATAAATAGATCAAGGATGG + Intronic
1022381878 7:29868085-29868107 GCGGAAAAGCAGATCACACAAGG + Intronic
1022651719 7:32283439-32283461 GTGGAAAAATTTATAAAATAGGG - Intronic
1022789115 7:33669179-33669201 GTGGAAACATGGATCTACCAAGG - Intergenic
1023367268 7:39476189-39476211 TATGAAAAATAAATCAAACAAGG - Intronic
1024059116 7:45685306-45685328 GTGGAAAAACAGGACAGACAGGG + Intronic
1024169964 7:46774681-46774703 GTGGAAAAAAAAATCCAACTAGG - Intergenic
1024337787 7:48226706-48226728 GTGCAAAAATAGAAGGAACATGG - Intronic
1032655531 7:133925298-133925320 GAGGAAAAATAGGTCACGCAAGG + Intronic
1033995530 7:147341482-147341504 GTGAATAAATAGATTAAAAATGG + Intronic
1034018695 7:147616051-147616073 GGGGAAAAAAAAATGAAACAAGG - Intronic
1034845256 7:154438577-154438599 GAGGAAAAGTACATCAAAAATGG + Intronic
1035150351 7:156865628-156865650 GTGGAAAAAAAGAGCAAAGCTGG + Intronic
1036703832 8:11031850-11031872 ATGCAAAAATAAATCACACATGG - Intronic
1037527715 8:19742991-19743013 AGGGAAATAAAGATCAAACAAGG - Intronic
1037671681 8:21020483-21020505 GAGGAAAAATGGCTAAAACAAGG - Intergenic
1038728524 8:30104311-30104333 GTAAAAAAATAGAACAAAGAGGG - Exonic
1039142051 8:34401622-34401644 GTGGAAAAATTGTAGAAACATGG - Intergenic
1040805124 8:51386616-51386638 GTGGATAAATAGATGATAGATGG + Intronic
1042235162 8:66604679-66604701 GTGATAAAATAGATCAACCAAGG + Intronic
1042410013 8:68454316-68454338 TTGGAAGAATAGATAAAACTTGG + Intronic
1043094162 8:75945568-75945590 ATGGAAAAATAGTCAAAACAAGG + Intergenic
1043369991 8:79579893-79579915 GTGGAAAACTAACTCAAACAAGG + Intergenic
1043533828 8:81178226-81178248 GAGGCAAAATAGGTCAACCAGGG - Intergenic
1043933986 8:86122090-86122112 GAGGAAAAATAAAACAACCAAGG - Intronic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1044823003 8:96170379-96170401 GTGGGAAAATAAATCTATCAAGG - Intergenic
1046364117 8:113203784-113203806 GTTTAAAAGTAGATAAAACAAGG - Intronic
1046787094 8:118279395-118279417 ATGGAAATCTAGATCAAACTTGG + Intronic
1047457338 8:125027762-125027784 ATGGAAAAATAGAATAAAAAAGG + Intronic
1047643314 8:126843945-126843967 AGGGAAAAAGAGATAAAACATGG + Intergenic
1048190510 8:132284018-132284040 GAGGAACCATACATCAAACAAGG + Intronic
1048340254 8:133533294-133533316 GGGGAAAAATAGCACAGACAAGG - Intronic
1048755713 8:137735716-137735738 TAGGAAAAATAGATTAAAGATGG + Intergenic
1051125564 9:13800630-13800652 TTGTATAAATAGATCAAAAAAGG + Intergenic
1051473023 9:17471330-17471352 GTGGAAAACTAAATCTAATAAGG + Intronic
1051544845 9:18262269-18262291 GTGGCAAAATAGAACACCCAAGG + Intergenic
1052099684 9:24430144-24430166 TTGGAAAAATAGTCCAAATAGGG - Intergenic
1054943414 9:70768904-70768926 TTGGAAAAAGAGATCATGCATGG + Intronic
1055403757 9:75952395-75952417 GTGGAAACAAAAAGCAAACAAGG - Intronic
1061049817 9:128188437-128188459 GTGGAAAAAAAGGTTAAAAATGG - Intronic
1061167001 9:128928884-128928906 GTTGTAAAATAACTCAAACAAGG - Intronic
1062679806 9:137772854-137772876 GGGAAAAAAGAGATAAAACAAGG - Intronic
1203658216 Un_KI270753v1:18883-18905 GTGGAGAGATATATCAAACCAGG + Intergenic
1185854494 X:3521387-3521409 GGGGAAGAACAGAACAAACATGG - Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1188976188 X:36678641-36678663 GTGGAAAAATGGTTAAATCATGG + Intergenic
1190292723 X:49003328-49003350 GTGGAAAAATATTTCCAGCAGGG + Intergenic
1191130512 X:57003426-57003448 GTGAAAAAATTGTTCATACAAGG + Intergenic
1192345731 X:70303584-70303606 GTGCAAACATAGAACAAAAAGGG - Intronic
1192965248 X:76170360-76170382 GTGGAAGAACCAATCAAACAGGG - Intergenic
1193043439 X:77027585-77027607 GTGCAAACCTAGATGAAACAAGG - Intergenic
1193234650 X:79092160-79092182 CTGGGAAAATAGATTAAAGAGGG - Intergenic
1194260012 X:91683341-91683363 ATGGAAAAATAGAGCAGATATGG - Intergenic
1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG + Intergenic
1195691183 X:107626924-107626946 GTGGAAAAAAAAATCAGGCAAGG - Intergenic
1197395834 X:125925864-125925886 ATGGAAAAATAGAAAAAAGAAGG - Intergenic
1197539272 X:127735769-127735791 GTGGAAAAATAGAGATAAAAGGG + Intergenic
1199231157 X:145437368-145437390 ATGGAAAAATACATAAAACAAGG - Intergenic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1200578710 Y:4922532-4922554 ATGGAAAAATAGAGCAGATATGG - Intergenic
1200749495 Y:6932007-6932029 ATGGAAAAGTAAATAAAACAGGG - Intronic
1200809019 Y:7463136-7463158 GGGGAAGAACAGAACAAACATGG + Intergenic
1201636442 Y:16128040-16128062 GAGGAAAAAAATATGAAACATGG - Intergenic
1202090429 Y:21183138-21183160 GTGGAAAAATTGATGCAACAGGG - Intergenic