ID: 977106261

View in Genome Browser
Species Human (GRCh38)
Location 4:92889245-92889267
Sequence AAGAAGCAGAAGTTCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 750
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 680}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977106258_977106261 24 Left 977106258 4:92889198-92889220 CCTAAACTTCTATTACGTGAATC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG 0: 1
1: 0
2: 5
3: 64
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977106261 Original CRISPR AAGAAGCAGAAGTTCTGGCC AGG Intronic
901192165 1:7419126-7419148 AAGAAGAAGAAGTTCGGGAAGGG - Intronic
901397919 1:8995064-8995086 AATAATCAGGAGATCTGGCCAGG - Intergenic
901503657 1:9670211-9670233 CAGAAACAGAAGTTGTGGTCTGG - Intronic
901739121 1:11330708-11330730 AAGAGGCTGCAGTCCTGGCCAGG + Intergenic
902728067 1:18350424-18350446 AAGGAACACAACTTCTGGCCAGG - Intronic
902902061 1:19524524-19524546 AAGAAAGAGAATATCTGGCCTGG - Intergenic
903464383 1:23541970-23541992 AAAAAAAAAAAGTTCTGGCCGGG - Intergenic
905473115 1:38207696-38207718 AAGGAGCAGGAGCTATGGCCTGG + Intergenic
905722696 1:40219949-40219971 GAAAAACAGAAGTACTGGCCAGG + Intronic
906134163 1:43483844-43483866 AAGAAAAAGAAGTTTTGGGCTGG - Intergenic
906195235 1:43926291-43926313 AAGAAAAAGAGCTTCTGGCCGGG + Intronic
907018173 1:51037656-51037678 AAGAAGCAGTAGTCATGGCAAGG + Intergenic
907356592 1:53880017-53880039 TAGTATTAGAAGTTCTGGCCAGG + Intronic
907733060 1:57086478-57086500 AAGAAGCAGACTCTCTGGTCTGG + Intronic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
908430405 1:64051154-64051176 CAAAAGCAGAAGTTCTGGCTGGG + Intronic
908683855 1:66692250-66692272 AAGAATCAAAGTTTCTGGCCAGG - Intronic
908747044 1:67385913-67385935 AAGAAACTGAAGTCCAGGCCGGG + Intronic
909403691 1:75262114-75262136 CAGTATTAGAAGTTCTGGCCAGG + Intronic
909416050 1:75406837-75406859 TAGTATTAGAAGTTCTGGCCAGG + Intronic
909554656 1:76940175-76940197 AAGTAGCAGAAGATATGGCCGGG + Intronic
910283432 1:85526987-85527009 AAGAAATAGAAGTTCTACCCTGG - Intronic
910660363 1:89665142-89665164 TAGTATCGGAAGTTCTGGCCAGG - Intronic
910923281 1:92372554-92372576 AAGATGCAGAATGTGTGGCCTGG + Intronic
911462415 1:98207096-98207118 AAGAAGGAGAAGAGCAGGCCAGG - Intergenic
911540980 1:99158168-99158190 AAGTACTGGAAGTTCTGGCCAGG - Intergenic
911584307 1:99672667-99672689 AAGAAGTAGAGTGTCTGGCCGGG - Intronic
911724684 1:101230693-101230715 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
911938955 1:104018182-104018204 AAGAAGCAGAAATTCTGAAGTGG - Intergenic
912350612 1:109008921-109008943 TAGAAACAGAAATTCTGGGCCGG + Intronic
912975796 1:114329062-114329084 TAGAAGCTGAAGTTCTGTGCAGG - Intergenic
913249264 1:116898896-116898918 AAGAAAAAGAAGACCTGGCCGGG + Intergenic
913362774 1:118000834-118000856 TAGTGTCAGAAGTTCTGGCCAGG - Intronic
913393199 1:118337359-118337381 AAGAGGCAGAACTTCTGGGTTGG - Intergenic
913541034 1:119821511-119821533 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
913588931 1:120303761-120303783 AAGAAGAGGAAGTTCTTGCAGGG + Intergenic
913619254 1:120594608-120594630 AAGAAGAGGAAGTTCTTGCAGGG - Intergenic
914570956 1:148915644-148915666 AAGAAGAGGAAGTTCTTGCAGGG + Intronic
914601876 1:149214627-149214649 AAGAAGAGGAAGTTCTTGCAGGG - Intergenic
914816100 1:151063718-151063740 AAGAAGCATTAGTTGTGGTCGGG - Intronic
915397692 1:155598111-155598133 AAAAAAAAGAAATTCTGGCCGGG - Intergenic
915613275 1:157013406-157013428 AATAAGCAGGAGTTTTTGCCAGG - Intronic
915631819 1:157158712-157158734 AACAAGCAGAAGTTCTCTCAGGG - Intergenic
917024669 1:170629270-170629292 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
917037175 1:170761370-170761392 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
917257470 1:173131278-173131300 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
917997262 1:180453525-180453547 TAGTAGTGGAAGTTCTGGCCAGG + Intronic
918163517 1:181922632-181922654 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
919639319 1:200033937-200033959 AAGAATCAGAAGCTCAGGCAGGG + Intronic
919843390 1:201625621-201625643 AAGAAGCAGAAATGCAGGGCAGG + Intronic
919912407 1:202119612-202119634 AAGAAGCAGAAGGTCAGGCAGGG + Intergenic
920309454 1:205040209-205040231 AAGAAGCAGATGGTCTGGGCAGG + Intergenic
921080649 1:211736395-211736417 AAGATTCAGGGGTTCTGGCCTGG + Intergenic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
921631646 1:217440490-217440512 TAGTAGTGGAAGTTCTGGCCAGG + Intronic
921823663 1:219647054-219647076 AAGAAATAGAAGTTGTCGCCAGG + Intergenic
921827832 1:219693714-219693736 GAGAAGCAGAAGTTTGGCCCTGG - Intronic
922252978 1:223866854-223866876 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
923779945 1:237013224-237013246 AAGGAGCAGAAGGGCTGGCACGG - Intergenic
924307428 1:242704969-242704991 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
924460355 1:244253484-244253506 AAAAAGCACATGTTCTGGGCAGG - Intergenic
924601083 1:245489939-245489961 AAGAAACAGGAGTTCTGGGCAGG + Intronic
924745746 1:246832234-246832256 TAGAAGTAGAAATGCTGGCCGGG + Intergenic
1062778899 10:182719-182741 AAGAAGCAAAGGCACTGGCCGGG - Intronic
1062948792 10:1480401-1480423 ATTAAGAAAAAGTTCTGGCCGGG + Intronic
1062952300 10:1513735-1513757 GAGAAGGAGAAGCTCTGGGCCGG + Intronic
1063379998 10:5578379-5578401 AAGGTGCTGAAGTTCTGGGCGGG + Intergenic
1063577263 10:7273090-7273112 AAGAATCAGAGGTTTTGGCTGGG - Intronic
1063651992 10:7947055-7947077 AAGAAAGAAAAGTTGTGGCCAGG - Intronic
1063867439 10:10381113-10381135 AAGAAACTGAAGTTCAGGCCGGG + Intergenic
1064848075 10:19678661-19678683 TAGAATTGGAAGTTCTGGCCAGG - Intronic
1065084204 10:22158212-22158234 AAAAAGCAGAAATTCTGCTCTGG + Intergenic
1065990799 10:31007573-31007595 AAAAAACAAAAGATCTGGCCGGG - Intronic
1067212889 10:44276028-44276050 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1068502425 10:57857012-57857034 TAGTATTAGAAGTTCTGGCCGGG - Intergenic
1069139549 10:64806448-64806470 CAGAATTGGAAGTTCTGGCCAGG - Intergenic
1069360475 10:67635793-67635815 TAGTATCAAAAGTTCTGGCCAGG + Intronic
1069516063 10:69078189-69078211 AAAAAACAGTATTTCTGGCCGGG - Intergenic
1069630420 10:69894134-69894156 AACCAGAAGAACTTCTGGCCTGG - Intronic
1070104440 10:73417834-73417856 AAGCATCTGAAATTCTGGCCGGG + Intergenic
1070129664 10:73647733-73647755 CGGAAGCAGATGTTCCGGCCGGG - Exonic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1070817973 10:79337050-79337072 CAGTAGCTGAAGTTCTGTCCTGG - Intergenic
1070897336 10:79996063-79996085 CAGAAGCAGAACTGCTGGGCTGG + Intergenic
1071021426 10:81061403-81061425 CAGAACCACAAGTTTTGGCCAGG + Intergenic
1071201716 10:83227005-83227027 AAGAAGGAGAATTTGTGGCACGG - Intergenic
1071413086 10:85415869-85415891 TAGAGTTAGAAGTTCTGGCCAGG + Intergenic
1072088044 10:92099864-92099886 AAAAAGAAGCATTTCTGGCCAGG + Intronic
1072586886 10:96790571-96790593 TAGAAACTGAAGCTCTGGCCAGG - Intergenic
1072782798 10:98261725-98261747 AAGAGGCAGCAATTGTGGCCAGG + Intronic
1073017574 10:100413870-100413892 AGAAAGCAAAAGTCCTGGCCAGG + Intergenic
1073401842 10:103264023-103264045 AAAGAGATGAAGTTCTGGCCAGG + Intergenic
1073536055 10:104277579-104277601 AAGAAGTAGTAGAGCTGGCCGGG - Intronic
1073729477 10:106271699-106271721 ACGAGGCAGAAGTTCTGGACTGG - Intergenic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1073966484 10:108996340-108996362 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1074669361 10:115771523-115771545 AAGAAGTAAGAATTCTGGCCGGG - Intronic
1074984778 10:118648313-118648335 TAGTATCGGAAGTTCTGGCCAGG - Intergenic
1075269785 10:121038676-121038698 AACAGGCAGAAGTTCTGGAGGGG - Intergenic
1075752711 10:124786512-124786534 AAAAAAAAGAAGTTCAGGCCAGG + Intronic
1077169229 11:1158979-1159001 CAGAAGCAGGAATTCTGTCCCGG + Intronic
1077475329 11:2787191-2787213 AAGGAGAACAAGTTCTGTCCTGG - Intronic
1077776789 11:5280855-5280877 AAGCATGAGCAGTTCTGGCCAGG - Intronic
1078809062 11:14739615-14739637 AAGTATTGGAAGTTCTGGCCAGG - Intronic
1078921515 11:15835242-15835264 AAGAAGGAGAAGTCTGGGCCGGG - Intergenic
1079034949 11:17013591-17013613 TAGAACGAGAAGTTCTGTCCTGG - Intronic
1079322992 11:19467792-19467814 GAGCTGCAGAAGATCTGGCCTGG + Intronic
1079371601 11:19858149-19858171 AAAATGAACAAGTTCTGGCCGGG - Intronic
1079578187 11:22029066-22029088 TAGTAGTGGAAGTTCTGGCCAGG + Intergenic
1079920645 11:26429940-26429962 AAAAAGTAAAAGTACTGGCCAGG + Intronic
1081166445 11:39814053-39814075 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1081243702 11:40737348-40737370 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1081454582 11:43208720-43208742 TAGAATTGGAAGTTCTGGCCTGG - Intergenic
1081470494 11:43365561-43365583 AAGAAGGAGATGAGCTGGCCAGG - Intronic
1081980434 11:47262804-47262826 AAAAAGCACCAGTCCTGGCCAGG - Intronic
1082007712 11:47429120-47429142 AAGAAGGAGATGTTCAGGGCCGG - Intergenic
1082697800 11:56391520-56391542 AAGAAGCACTAATTTTGGCCTGG + Intergenic
1082713179 11:56579795-56579817 AGGAAGCAGAAGTATTGGTCAGG + Intergenic
1082994303 11:59237698-59237720 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1083175152 11:60945075-60945097 ATGAAGCAGAAGTGGTGGTCTGG + Intronic
1083182190 11:60994143-60994165 AAAAGGCTGAATTTCTGGCCGGG + Intronic
1084454747 11:69262069-69262091 AAGAGACTGAAGCTCTGGCCGGG - Intergenic
1085148371 11:74224957-74224979 AAGAATTTGAAGTTCTGGCCAGG - Intronic
1085325926 11:75606570-75606592 AAGATGCAGATGTTCTGGGGCGG + Intronic
1085462137 11:76700607-76700629 AAGATGCAGACCTCCTGGCCAGG + Intergenic
1085473866 11:76776195-76776217 AAGAAACAGAATTTGTGGGCTGG - Intergenic
1085852114 11:80132835-80132857 AAAAAGAAAAAATTCTGGCCAGG - Intergenic
1085944561 11:81252498-81252520 AAGAAGCAGAGTGTCGGGCCCGG + Intergenic
1086114884 11:83238533-83238555 AAAAAGGAAAAGTTCAGGCCGGG + Intronic
1086432053 11:86745445-86745467 AAGCAGGAGAAGCTCTGGCAAGG + Intergenic
1086672954 11:89569706-89569728 AAGATACAAATGTTCTGGCCGGG + Intergenic
1087287012 11:96275562-96275584 AAGAAAGAAAAATTCTGGCCGGG - Intronic
1087353948 11:97070671-97070693 CAGTATTAGAAGTTCTGGCCAGG - Intergenic
1087432269 11:98069495-98069517 AAGACTAAGAGGTTCTGGCCGGG - Intergenic
1087668193 11:101074455-101074477 TAGTAGTGGAAGTTCTGGCCAGG + Intronic
1088167211 11:106953042-106953064 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1088517339 11:110652365-110652387 TAGTATCGGAAGTTCTGGCCAGG + Intronic
1088672845 11:112160285-112160307 GGGAAGGGGAAGTTCTGGCCTGG - Intronic
1088686256 11:112286800-112286822 AATAAGCAGAAGTTATAGCTGGG + Intergenic
1089306039 11:117526810-117526832 AAGAAGGGGAAGTTCTGAGCTGG - Intronic
1089720717 11:120417789-120417811 TAGAATCAGAGATTCTGGCCAGG - Intronic
1090822874 11:130360527-130360549 ACCAAACAGAAATTCTGGCCAGG - Intergenic
1091514441 12:1164633-1164655 AATAAGGACAGGTTCTGGCCAGG - Intronic
1091727422 12:2855564-2855586 AGGACGCAGAAGTCCTGGCAGGG + Intronic
1092016980 12:5167705-5167727 AAGAAGCCGAGGCCCTGGCCTGG + Intergenic
1092106907 12:5927799-5927821 GAGAGGCAGAAGTTCTGGCTGGG + Intronic
1092362422 12:7848525-7848547 AAAAAGCAGAATTTGTGGCTAGG - Intronic
1092378844 12:7978420-7978442 AAGAAGCAAAAATTTTGGCTAGG - Intergenic
1092581277 12:9845523-9845545 AAGTATTGGAAGTTCTGGCCAGG - Intergenic
1092758867 12:11790974-11790996 TAGAAGCTTAAGCTCTGGCCGGG - Intronic
1093033891 12:14314904-14314926 AAAAATCGGATGTTCTGGCCAGG - Intergenic
1093618581 12:21259023-21259045 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1093737601 12:22639379-22639401 AAGAATAGGAAGATCTGGCCGGG + Intronic
1093808837 12:23468365-23468387 TAGAACTGGAAGTTCTGGCCAGG + Intergenic
1094115038 12:26901936-26901958 AAGTATTAGAAGTTCTGGCAGGG + Intergenic
1094442279 12:30491657-30491679 AAGGAGCAGAGTTTCTGGCCTGG - Intergenic
1094547621 12:31419676-31419698 TAAAAGCAGCATTTCTGGCCAGG + Intronic
1095319999 12:40815662-40815684 TAGAATTGGAAGTTCTGGCCAGG - Intronic
1095589424 12:43887213-43887235 AAGAAGCAGAAGTACTGCCTGGG + Intronic
1096034327 12:48451470-48451492 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1096132359 12:49169916-49169938 AATAAGAAGAAGTACTGGCCAGG + Intergenic
1096419506 12:51444964-51444986 GAGAAGTAGAGGTTCTAGCCTGG + Intronic
1096478303 12:51922025-51922047 AAGAAACAAAGGTCCTGGCCAGG - Intronic
1096783171 12:54002366-54002388 GAGTAGCAGAAGTCCTGGGCTGG + Intronic
1097096052 12:56549288-56549310 AAGAAGCTGTATTTCTGGCCCGG - Intronic
1097520837 12:60668851-60668873 TAGTATCAGAAGTTCTGGCTAGG - Intergenic
1097634836 12:62109991-62110013 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1097654015 12:62339403-62339425 AAGTACTGGAAGTTCTGGCCAGG - Intronic
1097898460 12:64850285-64850307 CAGTATTAGAAGTTCTGGCCAGG - Intronic
1098190737 12:67945725-67945747 AAGAAGCTGGATTTTTGGCCGGG - Intergenic
1098434725 12:70456482-70456504 TAGTATCAGAAGTTCTGTCCAGG - Intergenic
1099502212 12:83428034-83428056 AAGTAGTAGAAGTTCTGGCCAGG - Intergenic
1099524165 12:83698505-83698527 TAGTATCAGAAGTTCTGGTCAGG + Intergenic
1099598687 12:84702678-84702700 AAGAATTACAAATTCTGGCCTGG + Intergenic
1100328129 12:93560334-93560356 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1100779344 12:98007702-98007724 AAGAAGTAGAAGCACTGGCTGGG + Intergenic
1100950632 12:99845242-99845264 AAGTATTGGAAGTTCTGGCCAGG - Intronic
1101183939 12:102253143-102253165 TAGTATCGGAAGTTCTGGCCAGG - Intergenic
1102009470 12:109609370-109609392 AAGTAGCAGGTGGTCTGGCCTGG + Intergenic
1102104255 12:110307052-110307074 AAGAAAAAGAAATTGTGGCCGGG - Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103291135 12:119847277-119847299 ATTAAGAAGAAGTTCGGGCCAGG - Intronic
1103320427 12:120089675-120089697 AAGAAACAGAAGTTGAGGCCGGG - Intronic
1103673912 12:122640880-122640902 AAGAAAAAGCAGTTCAGGCCGGG - Intergenic
1104529664 12:129557417-129557439 AAGATGAACAAGTTATGGCCGGG + Intronic
1104949940 12:132435234-132435256 AAGATGGAAATGTTCTGGCCGGG + Intergenic
1106043965 13:26120495-26120517 AAAAATGAGAATTTCTGGCCAGG + Intergenic
1106056746 13:26245079-26245101 AAGATGAACAAGTTCTGGCCGGG + Intergenic
1106983475 13:35318113-35318135 TAGTATCAGAAGTTCTGGCCAGG - Intronic
1106990714 13:35416247-35416269 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1107256493 13:38433729-38433751 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1107348628 13:39490134-39490156 GAGAAGCAGAAGTTCTGTATAGG - Intronic
1107395235 13:40008743-40008765 AAGTATTGGAAGTTCTGGCCAGG - Intergenic
1107443861 13:40452574-40452596 GACCAGCAGAAGTTCTAGCCTGG + Intergenic
1109050723 13:57477912-57477934 TAGTATCGGAAGTTCTGGCCAGG + Intergenic
1109051149 13:57482795-57482817 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1109390357 13:61684205-61684227 AAGAATTAGAAACTCTGGCCAGG + Intergenic
1110010581 13:70327975-70327997 TAGTAGTGGAAGTTCTGGCCAGG - Intergenic
1110602305 13:77388717-77388739 AAGTATCAGAAGTTCTGGGGTGG + Intergenic
1111183437 13:84698091-84698113 TAGTATCAGAAGTACTGGCCAGG + Intergenic
1111506438 13:89195757-89195779 TAGTATCGGAAGTTCTGGCCAGG + Intergenic
1111618503 13:90693009-90693031 AAAAAACAGATGTCCTGGCCAGG - Intergenic
1111862015 13:93719596-93719618 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1111908036 13:94278448-94278470 TAGTATCAGAAGCTCTGGCCAGG - Intronic
1112172297 13:96986594-96986616 AAGAACTAGAAGCTCTGCCCTGG + Exonic
1112305091 13:98266550-98266572 AAGAAGCAAGAGTTCTGGGTTGG + Intronic
1112942724 13:104884847-104884869 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
1113741449 13:112714878-112714900 AAGAAGCGGAAGTTCTGCGGGGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114545485 14:23497374-23497396 AAGACTTAGCAGTTCTGGCCTGG + Intronic
1114642367 14:24232204-24232226 AAGACGCAGTAGTACTGGGCTGG - Intronic
1115179436 14:30605189-30605211 AAGAATCAGAATCTCAGGCCAGG - Intronic
1115341610 14:32298689-32298711 AAGAAGCAGCAGTTTGGGGCTGG + Intergenic
1115681592 14:35745468-35745490 AAAAAGCAGAAAATCTGGCCGGG + Intronic
1116193202 14:41686479-41686501 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1117232687 14:53737354-53737376 AACAAACAGAAATTCTGGGCAGG + Intergenic
1117502730 14:56370027-56370049 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1118256689 14:64211577-64211599 AACAGGCAGAAGGCCTGGCCTGG + Intronic
1118806921 14:69246001-69246023 AGGAAGCAGAAGTAGGGGCCGGG - Intergenic
1119403593 14:74381275-74381297 AAGAAACAGCATTTCTGGCAAGG - Intergenic
1119584571 14:75821155-75821177 GGGAAGCAGAAGCTCTGCCCAGG + Intronic
1119611018 14:76062363-76062385 AAGAAGCAGAAAAACAGGCCGGG - Intronic
1120615098 14:86694508-86694530 AAAAATGAGAAGTTCTGGCCAGG + Intergenic
1120725142 14:87930450-87930472 TAGTATCAGAAGTTCTGGCCAGG + Intronic
1121084175 14:91132771-91132793 AAGATGAAAAAGTTCTGGCTGGG - Intronic
1121094253 14:91204893-91204915 GAGAAGAAGAGCTTCTGGCCTGG - Intronic
1121423825 14:93834127-93834149 AAGAAACAGAAGTCCAGGCAGGG - Intergenic
1121508647 14:94495361-94495383 AAGAAAGGGAAATTCTGGCCGGG - Intronic
1123000026 14:105288492-105288514 AAGAAGCTGGAGTGGTGGCCGGG + Intronic
1124133283 15:27009460-27009482 AACAAGCAAAAGTTCTAGCCAGG + Intronic
1124272803 15:28298498-28298520 AAGAAGAAGAAATACTTGCCAGG + Intronic
1124424960 15:29555957-29555979 AAGAAGGGGAATTCCTGGCCAGG + Intronic
1124824571 15:33081095-33081117 AAGAAGCGGAAGTTTTGCCGTGG - Intronic
1125492958 15:40161974-40161996 ATGAAGCTTAAGTTCTGGCATGG + Intronic
1125646287 15:41275448-41275470 GAAAATCAGAAGTTTTGGCCGGG - Intronic
1125760369 15:42092333-42092355 AAGAAGCAAAAGTCCTGGGAAGG - Intronic
1126172947 15:45709188-45709210 AGGAAGCAGGAGTTCAGGCCTGG + Intergenic
1126661517 15:51037811-51037833 AAGAAACAGAAATTCAGGCAAGG - Intergenic
1126742442 15:51790983-51791005 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1126759804 15:51959297-51959319 AAGAAGTAAAATTACTGGCCGGG - Intronic
1127493451 15:59486217-59486239 AAGAAGCAGAAATTCTGGAGTGG + Intronic
1129131869 15:73505825-73505847 AAGAAGGAGAAGTGCAGGCCGGG - Intronic
1129162537 15:73754504-73754526 CAAAAGCAGTAGTTCTGGGCTGG + Intergenic
1129863596 15:78884216-78884238 AAAAAGCTGAAATTCTTGCCAGG + Intronic
1130306143 15:82713287-82713309 AATAAGCAGAAGATTTGGCTGGG - Intergenic
1130535453 15:84782226-84782248 AATTAGCAGAAGTTATAGCCAGG + Intronic
1131333398 15:91523623-91523645 ATGAAACAAAAGTGCTGGCCAGG - Intergenic
1132254353 15:100362444-100362466 CAGAATTGGAAGTTCTGGCCAGG + Intergenic
1133261842 16:4555997-4556019 AAGAATCTGAAGTACTGGCTGGG - Intergenic
1133579668 16:7131047-7131069 AAGAATCATAGCTTCTGGCCGGG + Intronic
1134467375 16:14491466-14491488 AAGAAACAAAACTTCAGGCCAGG + Intronic
1134873396 16:17673056-17673078 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1135403251 16:22180709-22180731 AAGAATCAAAGGATCTGGCCCGG + Intronic
1136645749 16:31613031-31613053 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1137378849 16:47978980-47979002 AAAAAGAAAAAATTCTGGCCAGG - Intergenic
1137555982 16:49470629-49470651 AAGAAGCAGTGGTCCTGCCCTGG + Intergenic
1139370469 16:66465782-66465804 AAGAAACAGAAACTCTGGCGAGG - Intronic
1140397119 16:74637006-74637028 AAAACTCAGCAGTTCTGGCCGGG - Intronic
1140886053 16:79244194-79244216 CAGTATCGGAAGTTCTGGCCAGG + Intergenic
1141204547 16:81923448-81923470 AAGAAGGAAAAGGTCAGGCCAGG - Intronic
1141359475 16:83382115-83382137 AAGAAACAGAAGTTCTGAGAAGG - Intronic
1141415190 16:83865763-83865785 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1142868479 17:2805666-2805688 AAGGAGCAGAGGTTTTGGCCAGG - Intronic
1143218866 17:5244958-5244980 AAGATGAAAAAGTTCTGGGCTGG - Intergenic
1143656626 17:8298103-8298125 AAGAAGAAAAAGTTTAGGCCGGG - Intergenic
1144514245 17:15904669-15904691 AAAAAGCAAAAGTACAGGCCGGG - Intergenic
1146012514 17:29207196-29207218 AGGAAGCAGAAGTTCCTGCAGGG + Intergenic
1146014965 17:29225502-29225524 AAGAAGCAGAAGTCCTGAGTAGG + Intergenic
1146135057 17:30312791-30312813 AAGAATCACAAGATCTGGCCAGG + Intergenic
1146294298 17:31637293-31637315 CAGAAGCAGAACTTCTGGTTTGG + Intergenic
1147358915 17:39919059-39919081 AAGAAGAAGGGGTTCTGGCCGGG - Intronic
1147432335 17:40379972-40379994 AAGAAAAAGAAGTTTTGGCCAGG - Intergenic
1147651058 17:42062316-42062338 GAGAAGCAGAAATCCTGGCCAGG + Intronic
1147666362 17:42151139-42151161 TAGAAGTAGAAGGTCTGGCCAGG + Intronic
1148056364 17:44799157-44799179 AAGAAGTAATAGTTCTGGCTGGG - Exonic
1149611896 17:57963667-57963689 ATTAAGATGAAGTTCTGGCCAGG - Intergenic
1150908357 17:69362300-69362322 TAAAAGCTGAAGTTCTGGCCGGG - Intergenic
1151021032 17:70617683-70617705 AAGAAGCACAAGTGCTTCCCAGG + Intergenic
1151111561 17:71683955-71683977 AAAAAGCATAAGTTTTGGTCAGG - Intergenic
1151404360 17:73877146-73877168 CAGAAGAGGCAGTTCTGGCCTGG - Intergenic
1151426149 17:74032354-74032376 CAGAAGCAGAGCTGCTGGCCAGG + Intergenic
1151734448 17:75930309-75930331 AAGTAGCAGAATTTCAGTCCTGG - Intronic
1152764029 17:82125983-82126005 AATAAGAAGTGGTTCTGGCCAGG + Intronic
1153193061 18:2564106-2564128 AATAAGAACTAGTTCTGGCCGGG + Intronic
1153234171 18:2970049-2970071 AAAACTCAGAAATTCTGGCCTGG + Intronic
1155207211 18:23570537-23570559 AAGAAGCAGAATTTCTTCACTGG + Intronic
1155249024 18:23938126-23938148 AAGAAGCACCAGTTCTGCCTGGG + Intronic
1156065836 18:33141428-33141450 CAGAAGCAGAAGAGCTGGCTGGG + Intronic
1156201846 18:34842174-34842196 TAGAGGTAGAAGTTCTGGGCTGG - Intronic
1156887306 18:42150354-42150376 AGGAGTTAGAAGTTCTGGCCAGG - Intergenic
1157267833 18:46244249-46244271 AAGAAGCAGAAGTCTTGGTGAGG + Intronic
1157854721 18:51094826-51094848 TAGAATTAGAAGTTCTGGCCAGG - Intergenic
1158210414 18:55042947-55042969 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1158297290 18:56012574-56012596 CAGAATTGGAAGTTCTGGCCAGG - Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1160262785 18:77310769-77310791 AAATAGCAAAAGTTTTGGCCGGG - Intergenic
1162105278 19:8366407-8366429 AAGGAGAAGATGTCCTGGCCTGG + Intronic
1162554574 19:11378752-11378774 CTGAAGCAGAAGATCTGGCCTGG - Exonic
1162583063 19:11542176-11542198 AAGAAGAAGAAGGTCGGGCGAGG - Intronic
1162809773 19:13156674-13156696 AAGAAGCACATATTCTGGGCCGG + Intergenic
1163389541 19:17021991-17022013 AAGAAGGGGAAGTCCTGGTCTGG + Intronic
1163640666 19:18460324-18460346 AAGAAGCAGACGAGCTGTCCAGG + Intronic
1163838241 19:19589471-19589493 AAGAAAAAAAAGTTCTGGTCAGG + Intronic
1165360527 19:35333843-35333865 AAAAATCAGAAGATCAGGCCGGG - Intronic
1165402221 19:35609030-35609052 AAGAAGCAGAAAGTGAGGCCAGG + Intergenic
1166378491 19:42342341-42342363 AAAAAGGAGAATTTCTGGCTGGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166729136 19:45048573-45048595 AAGAAGCAGATTTTGTAGCCAGG + Intronic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
926958467 2:18328530-18328552 GAAAAGCTGGAGTTCTGGCCAGG - Intronic
927433114 2:23043492-23043514 TAGAATCAGAAGTTCTGGGGCGG - Intergenic
927440268 2:23110990-23111012 TAGTATCGGAAGTTCTGGCCAGG - Intergenic
928017163 2:27668443-27668465 AAAAAGAACAAGTTCTGGCTGGG - Intronic
929361188 2:41093132-41093154 TAGTATCAGAAGTTCTGGCTAGG + Intergenic
930061135 2:47289884-47289906 AAGAATCAGTGCTTCTGGCCAGG - Intergenic
930323700 2:49886318-49886340 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
930472538 2:51837140-51837162 AAGTATTGGAAGTTCTGGCCAGG + Intergenic
932246398 2:70200421-70200443 AGAAATCAGAACTTCTGGCCGGG + Intronic
932720049 2:74132092-74132114 AAGCAGCAGATGTTCTTGACTGG - Intronic
933217231 2:79644331-79644353 AAAAAGCAGATCTTTTGGCCAGG - Intronic
933534375 2:83554011-83554033 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
934862559 2:97776348-97776370 AAAAATCAGGAGTTCTGGCCAGG - Intronic
935399823 2:102648472-102648494 TAGAATTGGAAGTTCTGGCCAGG + Intronic
935444953 2:103146373-103146395 TAGAAGAAGAAATTCTGGCCGGG - Intergenic
935923242 2:108037888-108037910 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
935983288 2:108647943-108647965 TAGTATTAGAAGTTCTGGCCAGG + Intronic
936001240 2:108832320-108832342 AAGAAATACAAATTCTGGCCAGG - Intronic
936477993 2:112857622-112857644 TAGTATCGGAAGTTCTGGCCAGG + Intergenic
938821279 2:134962632-134962654 AAAAAGCTGAAGTTTTGGCCAGG - Intergenic
938996152 2:136680502-136680524 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
939365322 2:141223015-141223037 TAGAATTAGAAGTTCTGGCCAGG + Intronic
939947167 2:148423881-148423903 AAAAAGCAGGGGTTGTGGCCAGG + Intronic
939975814 2:148716235-148716257 TAGAATTGGAAGTTCTGGCCAGG - Intronic
940122910 2:150287586-150287608 AAGAAACAGAAGTTCATGGCTGG - Intergenic
940318134 2:152346348-152346370 AATTATCAGAAGTTCTGGCAGGG + Intronic
940393043 2:153154743-153154765 TAGAATTGGAAGTTCTGGCCAGG - Intergenic
941634571 2:167922841-167922863 AAGAAGCAGCAGCTATGACCAGG + Intergenic
941984917 2:171500721-171500743 AAGAAGCAGAAAACCTGTCCAGG + Intergenic
942417788 2:175777023-175777045 AAGAAGCAGTAATTCTGGAAAGG - Intergenic
943351091 2:186797101-186797123 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
943420332 2:187661030-187661052 TACAAAGAGAAGTTCTGGCCAGG + Intergenic
943420340 2:187661077-187661099 TACAAAGAGAAGTTCTGGCCAGG + Intergenic
944035862 2:195293906-195293928 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
944088933 2:195883150-195883172 AAGAATCAGAAAACCTGGCCGGG + Intronic
944270796 2:197784214-197784236 AAAAAGCAAAACTTCTGCCCTGG - Intronic
944335554 2:198529512-198529534 AAGTAGTGGAAGTTCTGGCCAGG + Intronic
944430014 2:199623031-199623053 AAGAAGCAGAAGCTGTTTCCAGG - Intergenic
944811439 2:203330346-203330368 AAGATTCAGAGGTTCAGGCCTGG + Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
945042640 2:205755071-205755093 AAGAAACAGAGGTCCAGGCCAGG - Intronic
945308919 2:208287567-208287589 AAGAAAAAGAAACTCTGGCCAGG - Intronic
945421045 2:209637145-209637167 GAAAAGGAGCAGTTCTGGCCGGG + Intronic
945522987 2:210852558-210852580 GAAAAGCAGAAATCCTGGCCAGG + Intergenic
945812357 2:214563818-214563840 TAGTATTAGAAGTTCTGGCCAGG + Intronic
948648252 2:239422551-239422573 GAGAATCAGAAGTGCTGCCCAGG - Intergenic
948725640 2:239932127-239932149 AAGGAGCAGAGGTGCAGGCCGGG - Intronic
949005501 2:241644573-241644595 AGGAATCAGAAGTGTTGGCCGGG + Intronic
1168898741 20:1342046-1342068 AAGGAGCAGAAGTTCCAGGCAGG - Intronic
1169120148 20:3090856-3090878 AAGAAACAGAAGGTGTGGGCAGG - Intergenic
1169139806 20:3221185-3221207 AAGAAAAAGAAAATCTGGCCAGG - Intronic
1169342129 20:4804631-4804653 AAGAAAGAAAAGTTTTGGCCAGG - Intronic
1169530964 20:6484376-6484398 AAGAGGCTCTAGTTCTGGCCAGG - Intergenic
1169683084 20:8238888-8238910 GAGAAGCAGAAGCTAAGGCCTGG + Intronic
1170766669 20:19295366-19295388 TAGTAGTGGAAGTTCTGGCCAGG - Intronic
1170775606 20:19372267-19372289 AAGAAGCAGAAGTTGAGGGAAGG + Intronic
1171325358 20:24286646-24286668 GAGTAGTGGAAGTTCTGGCCAGG - Intergenic
1171380690 20:24731880-24731902 AAAAAGTATAAGCTCTGGCCAGG + Intergenic
1172772977 20:37392348-37392370 AAGATGGAGAAGTTGAGGCCAGG - Intronic
1172961019 20:38799721-38799743 AAGAACCACAAGTTCAGGCCAGG + Intergenic
1173719280 20:45239243-45239265 AAGACGCAGGAGGTCTGGCCAGG - Intergenic
1174243145 20:49154568-49154590 AAGAAACACAATTCCTGGCCAGG + Intronic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1175688424 20:61048018-61048040 GAGATGCAGAATTACTGGCCGGG - Intergenic
1175726094 20:61319648-61319670 AAGATGAATAAGTTCTGGCTGGG + Intronic
1175844066 20:62049475-62049497 AAGAGCCAGAAGGTCTGGCCTGG - Intronic
1175962648 20:62644927-62644949 AGGAAGCAGGAGGGCTGGCCTGG - Intronic
1176919371 21:14668671-14668693 TAGTATCAGAAGTTCTGGCCAGG + Intergenic
1177575946 21:22956479-22956501 TAGAGTTAGAAGTTCTGGCCAGG + Intergenic
1178184041 21:30199077-30199099 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1178384223 21:32136433-32136455 AAGAAGAACAAGTTCTTGCAAGG + Intergenic
1179665585 21:42910028-42910050 TAGAAACAGGAGTTTTGGCCAGG + Intronic
1180698035 22:17766217-17766239 AAGAATCTTAAGTTCAGGCCAGG - Intronic
1181616331 22:24057229-24057251 AAAAAGCAGAAGGACTGGCCGGG - Intronic
1181778218 22:25175129-25175151 AAGGAGGATAAGTTCTGGTCTGG - Intronic
1181794205 22:25292430-25292452 AAGAAGCATCACTTCAGGCCAGG - Intergenic
1181824029 22:25499150-25499172 AAAAATCAGATATTCTGGCCAGG + Intergenic
1181861332 22:25821321-25821343 AAAAAGCAAAAGTGCTGGCAAGG - Intronic
1182275699 22:29187272-29187294 AAGATGAAGAAGTTCTGGACGGG + Intergenic
1182306755 22:29375053-29375075 AAGAATAGGCAGTTCTGGCCGGG + Intronic
1183047563 22:35232344-35232366 AAGAAGCAGAAAATATGGCCAGG - Intergenic
1183463188 22:37965300-37965322 AACAAACAGTTGTTCTGGCCAGG - Intronic
1183861146 22:40671070-40671092 AAGAGTCAGAAGTTTTAGCCAGG - Intergenic
1184032893 22:41905214-41905236 TAGAAGCAGAAGCTCGAGCCAGG + Intronic
1184413807 22:44340564-44340586 AGGAGGCAGAGGTTCTGTCCAGG + Intergenic
1184437073 22:44485618-44485640 AAGAAGCACCAGCTCTGGCCAGG - Intergenic
1184689267 22:46110114-46110136 AGGAGGCTGAAGTCCTGGCCTGG + Intronic
1184708359 22:46231515-46231537 AAGAAACTGAAGTACTGGGCTGG - Intronic
1184802193 22:46768187-46768209 AAGAATCCGAAGGTTTGGCCGGG + Intronic
1184857449 22:47154140-47154162 AGGAAGGAGAAGTCATGGCCTGG - Intronic
1184952457 22:47853674-47853696 GAGAAGAAGAAGGTCTGTCCAGG + Intergenic
1203274479 22_KI270734v1_random:78322-78344 AAGAAGCATCACTTCCGGCCGGG + Intergenic
949440537 3:4075468-4075490 TAGTATTAGAAGTTCTGGCCAGG + Intronic
949456035 3:4239783-4239805 TAGAATTGGAAGTTCTGGCCAGG - Intronic
949828044 3:8183814-8183836 CAAAAGCAGAAGTTCAGGCATGG - Intergenic
950041004 3:9919347-9919369 AAAAAACAATAGTTCTGGCCGGG + Intronic
950951944 3:17009415-17009437 AAGAAGAACAATTTCAGGCCAGG - Intronic
950976841 3:17255493-17255515 AAGAAACACAGGATCTGGCCGGG - Intronic
951346840 3:21557177-21557199 TAGCATCGGAAGTTCTGGCCAGG - Intronic
951630803 3:24717738-24717760 AATAAGCAGCAGATCTGGCAGGG + Intergenic
952371850 3:32730062-32730084 AAGAAGTATAAATTCTGGGCCGG - Intronic
952387541 3:32853410-32853432 AAGAATGAGATATTCTGGCCGGG - Intronic
952614436 3:35252741-35252763 AAGTATTGGAAGTTCTGGCCAGG + Intergenic
952721263 3:36535483-36535505 TAGTATTAGAAGTTCTGGCCAGG - Intronic
953269621 3:41427899-41427921 TAGTACTAGAAGTTCTGGCCAGG + Intronic
954185811 3:48916357-48916379 AAAAAGAAAAAGTTTTGGCCAGG - Intergenic
954507807 3:51093682-51093704 TAGTATTAGAAGTTCTGGCCAGG - Intronic
955132694 3:56186832-56186854 AAGAAACAGTAGGACTGGCCGGG - Intronic
955216600 3:56989475-56989497 AGGAAGCAGCAGTTTTGGCTCGG - Intronic
955262225 3:57404418-57404440 AAGAAACAAAAGTTTCGGCCAGG + Intronic
955269323 3:57481048-57481070 AAGTGTTAGAAGTTCTGGCCAGG + Intronic
955696947 3:61646405-61646427 AAGAATTAGATGATCTGGCCAGG - Intronic
956073830 3:65483810-65483832 AACAAGCAAAATCTCTGGCCAGG + Intronic
956584314 3:70848248-70848270 TAGAATTGGAAGTTCTGGCCAGG - Intergenic
956999173 3:74864608-74864630 AAAGAGAAGAAGTTCTGGCGGGG + Intergenic
957622569 3:82613107-82613129 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
958021733 3:88005921-88005943 CAGAAACAGCAGTTCTGCCCTGG + Intergenic
958106150 3:89076065-89076087 AAGTATTGGAAGTTCTGGCCAGG + Intergenic
958694192 3:97507176-97507198 AAGTATTGGAAGTTCTGGCCAGG - Intronic
959014880 3:101122533-101122555 AAGCAGCAAAACATCTGGCCAGG - Intergenic
959043058 3:101441206-101441228 CAGAAGCATGAGTACTGGCCAGG + Intronic
959790733 3:110358142-110358164 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
959978250 3:112485815-112485837 AAGAATAAAAACTTCTGGCCGGG + Intronic
960681594 3:120253433-120253455 TAGTATTAGAAGTTCTGGCCAGG + Intronic
960771666 3:121199494-121199516 TAGTATTAGAAGTTCTGGCCAGG - Intronic
961256501 3:125558956-125558978 AAGAAGCAAAGCTTTTGGCCAGG + Intronic
961390823 3:126551402-126551424 AAGAAACAGAGCTTCTGACCTGG - Intronic
961408426 3:126699981-126700003 AAGATGAACAAGTTCTGGCCAGG - Intergenic
961584752 3:127913228-127913250 CAAAAGGAGAAATTCTGGCCAGG + Intergenic
962073769 3:132058715-132058737 AGGAAGCAGAAGTTGGGGACAGG - Intronic
962219070 3:133548152-133548174 AAAAATCAAAGGTTCTGGCCAGG + Intergenic
963086297 3:141439692-141439714 AAGAAGCAGTAGTTTTGAACTGG + Intronic
963247425 3:143075703-143075725 CAGAACCAGAAATTCTGGCAGGG + Intergenic
963515378 3:146301718-146301740 TAGATTCAGAAGTGCTGGCCAGG - Intergenic
963906410 3:150777169-150777191 AAGAAAGAGAAGAGCTGGCCTGG + Intergenic
964179858 3:153869889-153869911 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
964335477 3:155649681-155649703 AAGAAGTAGAATTAATGGCCGGG + Intronic
965025844 3:163300675-163300697 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
965264377 3:166522049-166522071 AAGTAGTAGAAGTTCTGCCTTGG + Intergenic
965958676 3:174402916-174402938 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
966114917 3:176450182-176450204 AAGTATTGGAAGTTCTGGCCAGG - Intergenic
966339694 3:178912012-178912034 AAGAAACAAAAGTGCTGGCAAGG + Intergenic
966644153 3:182224492-182224514 TAGTATCGGAAGTTCTGGCCAGG - Intergenic
966986086 3:185181615-185181637 AAAAAGCAGAGGATCAGGCCAGG + Intergenic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
967347953 3:188479636-188479658 AAGAAGCTGCAGTTCTAACCAGG + Intronic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
968889482 4:3360053-3360075 AAGAAACAGAAAATCTCGCCAGG - Intronic
970229300 4:13892124-13892146 ATTAAGCAAAAGTTCTGGCTGGG - Intergenic
970279885 4:14443446-14443468 CAGAAGCAGAAGTTCAGACCTGG + Intergenic
971275454 4:25192269-25192291 AAGAAGAAGAAGATAAGGCCAGG - Intronic
971615033 4:28777924-28777946 AAGGACTAGAAGTTCTAGCCTGG + Intergenic
971772026 4:30909309-30909331 TAGAATCTGAAGTTCTGGCCAGG + Intronic
971912210 4:32809396-32809418 AAGAAGGAGAAGTTCAAGCCAGG + Intergenic
972388622 4:38591773-38591795 AAGAAGCAGAGGTTGTGGGCGGG - Intergenic
972850795 4:43048052-43048074 AAGAATTAAAAGTTCGGGCCAGG + Intergenic
972919028 4:43915223-43915245 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
973199107 4:47479599-47479621 AGGAAGCACAAATTCTGGCTAGG - Intergenic
973232607 4:47859545-47859567 AAAAAGCAGAAATACCGGCCAGG + Intronic
973661928 4:53117006-53117028 AAGATGCAGAAGTTTTGTCTAGG - Intronic
974556360 4:63453717-63453739 AAGAAACATAACTTTTGGCCGGG - Intergenic
975126439 4:70787554-70787576 AAAAATCTGAAATTCTGGCCGGG - Intronic
975983996 4:80186534-80186556 AAGAAGCAGCAGCTCTGGGCGGG + Intronic
976410012 4:84702799-84702821 AAGAAATATGAGTTCTGGCCGGG + Intronic
976639904 4:87327456-87327478 AGGAATAAGAAGTTCTGGCTGGG + Intergenic
976749110 4:88436100-88436122 AAGAAACAGGAGTTCTGGCCTGG + Intronic
976809535 4:89086125-89086147 TAGGATTAGAAGTTCTGGCCAGG - Intronic
977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG + Intronic
977520021 4:98070495-98070517 TAGTATTAGAAGTTCTGGCCAGG + Intronic
977582939 4:98744930-98744952 AGGAATCAGAAGTGCTGGCAGGG - Intergenic
978118859 4:105053914-105053936 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
978256767 4:106701750-106701772 AAGTATTGGAAGTTCTGGCCAGG + Intergenic
978364722 4:107969596-107969618 AAGAAGCTTAATTCCTGGCCAGG + Intergenic
979141469 4:117181401-117181423 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
979141804 4:117184716-117184738 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
979234285 4:118382486-118382508 TAAAAACAGCAGTTCTGGCCAGG + Intergenic
979351048 4:119644953-119644975 AAGAAGCAGAAGTTCTATTGTGG + Intergenic
979953104 4:126919970-126919992 TAGTAGTGGAAGTTCTGGCCAGG + Intergenic
979998329 4:127460133-127460155 TAGTAGTGGAAGTTCTGGCCAGG - Intergenic
980398997 4:132255274-132255296 CAGTATTAGAAGTTCTGGCCAGG - Intergenic
981284097 4:142995010-142995032 TAGTGTCAGAAGTTCTGGCCAGG + Intergenic
982143661 4:152357614-152357636 AAGAATTAAAACTTCTGGCCAGG - Intronic
982310493 4:153980091-153980113 TAGTGGTAGAAGTTCTGGCCAGG - Intergenic
982524867 4:156466148-156466170 TAGTATTAGAAGTTCTGGCCGGG + Intergenic
983134562 4:164064660-164064682 AAGTATTGGAAGTTCTGGCCAGG - Intronic
983847991 4:172542795-172542817 AAGAAACAGCTGTGCTGGCCGGG + Intronic
984471241 4:180177086-180177108 AAGAAACAGCAGTTGAGGCCAGG - Intergenic
984479186 4:180277064-180277086 AAGAAGGAGAAGTTGATGCCTGG + Intergenic
984919292 4:184749810-184749832 AAAAAACAGAAGTACCGGCCAGG + Intergenic
985193612 4:187404414-187404436 TAGAATTGGAAGTTCTGGCCAGG - Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985278691 4:188265975-188265997 TAGAAAGAGAAGTTCAGGCCAGG - Intergenic
985283062 4:188306156-188306178 AAGAAAAAAAAGTTTTGGCCGGG + Intergenic
986647937 5:9936593-9936615 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
986665112 5:10095435-10095457 TAGTATCGGAAGTTCTGGCCAGG + Intergenic
986845629 5:11749448-11749470 ATGGAGCAGAATCTCTGGCCTGG - Intronic
987403086 5:17498173-17498195 TACAGGCAGAAGTTCTGGCTGGG - Intergenic
987409928 5:17604723-17604745 TACAGGCAGAAGTTCTGGCTGGG - Intergenic
987410574 5:17610932-17610954 TACAGGCAGAAGTTCTGGCTGGG - Intergenic
987852934 5:23380531-23380553 TAGTATCACAAGTTCTGGCCAGG + Intergenic
987966630 5:24885776-24885798 ATATAGTAGAAGTTCTGGCCAGG + Intergenic
988163659 5:27553450-27553472 AAGAGGCACAAGTTCTGGAAAGG + Intergenic
988246500 5:28689079-28689101 AAGAAGAAGAAGCTATGGCCGGG - Intergenic
988395179 5:30688086-30688108 CAGAACCAGAAGTTCTGTTCTGG + Intergenic
988624327 5:32855320-32855342 AATAAGCAAAAGCTCTGGACAGG + Intergenic
988957498 5:36333797-36333819 AAGAAACAGAGGTTCTACCCTGG - Intergenic
989222722 5:38986734-38986756 TAGTATTAGAAGTTCTGGCCAGG - Intronic
989343563 5:40404193-40404215 AACAAGCAGATGTTGTGGCTGGG - Intergenic
989620367 5:43378025-43378047 AAAAAGTTTAAGTTCTGGCCGGG - Intronic
990195205 5:53307138-53307160 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
990457152 5:55999205-55999227 AAGAAACAGAAGGCCTGGCACGG + Intergenic
990959944 5:61383840-61383862 TATAAGAAAAAGTTCTGGCCAGG - Intronic
991093214 5:62712685-62712707 AAGAACCATGACTTCTGGCCAGG - Intergenic
991909166 5:71544582-71544604 TTGAAAAAGAAGTTCTGGCCGGG + Intronic
992654120 5:78891416-78891438 AAGAAGCATCAGTCTTGGCCTGG + Intronic
992703347 5:79362797-79362819 AAGAAACAGAAACCCTGGCCGGG - Intergenic
992858990 5:80892778-80892800 AAGAAGCAAAAATTTTGGTCAGG - Intergenic
993256774 5:85601629-85601651 AAGACACATAAGTTCTAGCCTGG - Intergenic
993433054 5:87855900-87855922 AAGAAACAGAAATTCTAACCAGG + Intergenic
994176137 5:96713424-96713446 AAGAATGAGAAATTCTGGCCAGG - Intronic
994340120 5:98617214-98617236 AAGAATCTTATGTTCTGGCCGGG + Intergenic
994850656 5:105051241-105051263 TAGTATCAGAAGTTCTGGCCAGG - Intergenic
995162179 5:108995123-108995145 CAGTATTAGAAGTTCTGGCCAGG - Intronic
995623932 5:114056322-114056344 AAGAATCAGGAGTCCTAGCCAGG - Intergenic
995715144 5:115075127-115075149 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
996323707 5:122248794-122248816 TAGTATCGGAAGTTCTGGCCAGG - Intergenic
996370263 5:122745874-122745896 AAGATGCAGAATATGTGGCCAGG + Intergenic
996676063 5:126175973-126175995 TAGCATTAGAAGTTCTGGCCAGG + Intergenic
997324415 5:133008242-133008264 AAGAATCAGAAAATCAGGCCGGG + Intronic
997403989 5:133628984-133629006 TAGTATCGGAAGTTCTGGCCAGG - Intergenic
997404092 5:133630125-133630147 TAGTATCGGAAGTTCTGGCCAGG + Intergenic
997461055 5:134052819-134052841 AAGAAGCAGAAGCCCTGGCCGGG + Intergenic
997535247 5:134615517-134615539 AATAAGAAGAAATTCTGGGCCGG + Intronic
997869413 5:137494054-137494076 AAGAATCAGAAGTGCTGCCTTGG - Intronic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
997947100 5:138212609-138212631 AAGAATCAAAAGTTTTGGTCTGG - Intronic
998001567 5:138630029-138630051 AAGATGAAGAAGTTCTGGAGAGG + Intronic
998066286 5:139161719-139161741 AAGAATTAGAATTGCTGGCCAGG + Intronic
998444491 5:142188115-142188137 AAGGAGCTGATGGTCTGGCCGGG - Intergenic
998748287 5:145287003-145287025 AACAATAAGAAGTTCTGGCCAGG - Intergenic
999205996 5:149848441-149848463 AAGAACCAGAAGGCCTGGTCTGG - Exonic
999602955 5:153287062-153287084 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1000375754 5:160580173-160580195 TAGTATCGGAAGTTCTGGCCAGG - Intronic
1000406868 5:160897171-160897193 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1000428488 5:161120951-161120973 AGGAAGCTGAAGTTATGGCATGG + Intergenic
1000434952 5:161196708-161196730 AAAAAGCAGAAGTCATGGCCAGG - Intergenic
1000869097 5:166553013-166553035 AAAAAAAAGAAGTTGTGGCCAGG - Intergenic
1001249956 5:170139577-170139599 CAGAAGCAGAAGCCCTAGCCAGG + Intergenic
1001390249 5:171372787-171372809 TAAAAGTAGAAGTTCAGGCCGGG - Intergenic
1001699515 5:173696744-173696766 AGGAAGGAAAAGTTCTGGACTGG + Intergenic
1001786991 5:174422171-174422193 AAAAATATGAAGTTCTGGCCGGG - Intergenic
1001839331 5:174860963-174860985 CAGTATCAGAAGTTCTTGCCGGG - Intergenic
1001876726 5:175208052-175208074 AATAACCAGATGCTCTGGCCGGG + Intergenic
1002094828 5:176824618-176824640 AAAAAGCAAAAGATCTGGGCTGG + Intronic
1002181252 5:177432193-177432215 AAGAAGCTGGAGGTCTGGGCAGG - Intronic
1002850132 6:987057-987079 TAGAAGTTGAAGTTCTGGCCAGG - Intergenic
1003487498 6:6592237-6592259 AAAAAGCAGAAGTCCTGGCCTGG + Intronic
1003636797 6:7839403-7839425 AAGAAGAAAAAGTTCTGGAGAGG - Intronic
1004227936 6:13804477-13804499 AAAAAGTAGAAGTCTTGGCCGGG + Intronic
1004240030 6:13912635-13912657 AAGAAGGATAACTACTGGCCAGG - Intergenic
1004944030 6:20592370-20592392 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1005061912 6:21784381-21784403 AAAAATAAGGAGTTCTGGCCCGG - Intergenic
1005274580 6:24202611-24202633 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1005629389 6:27693467-27693489 AAGAAGAAGAAGGCCTGGCGCGG - Intergenic
1007177347 6:39906002-39906024 GAGAAGGAAAAGTTCTGGGCTGG + Exonic
1007463834 6:42037735-42037757 AAAAAACAAAAGTTCTGGCCAGG + Intronic
1007514266 6:42398909-42398931 GAGCAGCAGAAATACTGGCCTGG + Intronic
1007680095 6:43628065-43628087 AAGAATCAGAAATTCTAGGCTGG + Intronic
1008568570 6:52793028-52793050 AAGAAGCAGGGGTCCTAGCCTGG - Intronic
1008602270 6:53107767-53107789 AAGAAGCAGTAGCTTGGGCCGGG + Intergenic
1009500381 6:64405457-64405479 TAGTATTAGAAGTTCTGGCCCGG + Intronic
1009661763 6:66621564-66621586 TAGTATCAGAAGTCCTGGCCAGG + Intergenic
1009801188 6:68538283-68538305 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1009944979 6:70332640-70332662 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1010257745 6:73778418-73778440 TAGTACTAGAAGTTCTGGCCAGG - Intronic
1011020268 6:82805223-82805245 TAGTAGTGGAAGTTCTGGCCAGG - Intergenic
1011084512 6:83524134-83524156 AAGAAGAAAAAAATCTGGCCGGG + Exonic
1011830901 6:91370210-91370232 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1012596747 6:101050177-101050199 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1013287927 6:108696792-108696814 AAGATGTAAAACTTCTGGCCGGG + Intergenic
1013382812 6:109593993-109594015 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1013912751 6:115297889-115297911 AAGTATTGGAAGTTCTGGCCAGG - Intergenic
1014307112 6:119756585-119756607 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1014922798 6:127232354-127232376 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1015673519 6:135719416-135719438 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
1015915161 6:138208961-138208983 AAGGAGTAGAAGTTGTGGGCAGG + Intronic
1015925552 6:138307187-138307209 AAGGAGCAGAATTTCTGGGAAGG - Intronic
1016191278 6:141267948-141267970 AAGAAGCAAAAATGCTGGTCTGG + Intergenic
1018666954 6:166147537-166147559 AAGAAACAGAAGATTGGGCCAGG - Intergenic
1019141492 6:169948136-169948158 AAGAAGCAGAAATTCTGAATAGG + Intergenic
1020391026 7:7658323-7658345 CAGTATTAGAAGTTCTGGCCAGG - Intronic
1021015056 7:15521826-15521848 TAGAAATGGAAGTTCTGGCCAGG + Intronic
1021111911 7:16705388-16705410 AAGAATAAAAAGTTCAGGCCAGG + Intronic
1021391049 7:20093060-20093082 AAGAAAAGAAAGTTCTGGCCAGG + Intergenic
1022206533 7:28169712-28169734 AATAAGCAGAAATTATGCCCAGG - Intronic
1022600023 7:31749265-31749287 AACAAGCAGAACTCCTGGGCAGG + Intergenic
1022885277 7:34637001-34637023 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
1023288945 7:38649236-38649258 AAGTATTGGAAGTTCTGGCCAGG - Intergenic
1023515756 7:40999758-40999780 AGGAAGCAGATGTTCTGGAAAGG - Intergenic
1023874270 7:44278255-44278277 AGGACGCAGAGGGTCTGGCCAGG + Intronic
1024314555 7:48002953-48002975 CAGTATTAGAAGTTCTGGCCAGG - Intronic
1024329897 7:48145179-48145201 AAAAAGCAGAGTTTATGGCCAGG - Intergenic
1024345995 7:48314246-48314268 CAAAAGCTGAACTTCTGGCCTGG - Exonic
1024492615 7:50002623-50002645 AAGAAGTAGCATTTCTGACCTGG - Intronic
1024925924 7:54616035-54616057 AAGAAACAAAAGTTGTCGCCAGG + Intergenic
1024935305 7:54705925-54705947 AAGATGGGTAAGTTCTGGCCGGG + Intergenic
1025147640 7:56518561-56518583 AAAAATCAGAAGATCTGGGCTGG - Intergenic
1025154749 7:56594549-56594571 AAAAACCAGAAATCCTGGCCAGG - Intergenic
1025868856 7:65411650-65411672 AAGGAGCAGCAGTGATGGCCAGG + Intergenic
1025938694 7:66057872-66057894 TAGAATTAGAAGTTCAGGCCAGG + Intergenic
1026700777 7:72642604-72642626 AAAAAGCTGAAGTTCTAGGCTGG + Intronic
1027484668 7:78746407-78746429 AAGAAGTTGATGTTCTGTCCCGG - Intronic
1027792050 7:82646552-82646574 TAGTAGTAGAAGTTCAGGCCAGG + Intergenic
1028487060 7:91371498-91371520 AAGAAGTAGAGATTCTTGCCTGG - Intergenic
1029596494 7:101540240-101540262 AAGAAGTAGACGATCTGGTCAGG + Intronic
1029700067 7:102240551-102240573 AAGAAATAAAAGTTCAGGCCAGG - Intronic
1029792707 7:102862046-102862068 AAGAAACAGACGTTTTGGGCAGG + Intronic
1029792934 7:102864273-102864295 AAGAAGCAGATGATAAGGCCTGG - Intronic
1029801854 7:102956512-102956534 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1029886992 7:103883411-103883433 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1031189470 7:118528841-118528863 TAGTAGTGGAAGTTCTGGCCAGG + Intergenic
1031267626 7:119601244-119601266 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1031273033 7:119678705-119678727 AAGAAGAAGACTTTCGGGCCAGG + Intergenic
1033028986 7:137806726-137806748 TAGATGCAGAGGTTCAGGCCGGG - Intronic
1033413328 7:141140059-141140081 AAGGAGAAGAACCTCTGGCCGGG - Intronic
1033417486 7:141175970-141175992 TAGTATTAGAAGTTCTGGCCAGG - Intronic
1033431405 7:141292931-141292953 AATAAAAAGAAGATCTGGCCGGG - Intronic
1034685374 7:152966466-152966488 GAGAAGCTGAAGTGCTGGTCAGG - Intergenic
1034759204 7:153655451-153655473 AAGGAGCAGAGGGTCTGGCAAGG - Intergenic
1035495122 7:159318258-159318280 AAGAAACAGAAATTCTGGAGTGG + Intergenic
1036176492 8:6543111-6543133 AAGAAGCAGAAAGTCTTGGCTGG - Intronic
1037297928 8:17420917-17420939 AAGAAGAAAAAGTTCCAGCCTGG + Intergenic
1037304131 8:17487153-17487175 AGGAACCAGAACCTCTGGCCCGG - Intergenic
1037379192 8:18266151-18266173 AAAAAGCAGAAACTCTGGCTAGG + Intergenic
1037961293 8:23100290-23100312 TAAAAGGAGAAATTCTGGCCAGG + Intronic
1038643725 8:29347549-29347571 CAGAAGCTGAACTTCTGGCTAGG + Intronic
1038882881 8:31634180-31634202 TAAAAGCTGAAGTTCAGGCCAGG - Intergenic
1039402620 8:37283356-37283378 AAGTATTGGAAGTTCTGGCCAGG + Intergenic
1039412181 8:37364205-37364227 CAGAAGCGGAGGTTCTGCCCAGG + Intergenic
1039847391 8:41335495-41335517 AAGAATCAAAAGCCCTGGCCGGG + Intergenic
1041580098 8:59448692-59448714 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1041800046 8:61788890-61788912 AAGATGAATAAGTTCTGGCTGGG - Intergenic
1041900252 8:62974674-62974696 CAGTATTAGAAGTTCTGGCCAGG - Intronic
1042127600 8:65554208-65554230 AAAAAGTATAAGTTTTGGCCGGG - Intergenic
1042179355 8:66070188-66070210 TAGCAGTGGAAGTTCTGGCCAGG + Intronic
1042183384 8:66113684-66113706 AAGACGCAGAAGTCGTGACCCGG - Intergenic
1042970882 8:74407822-74407844 TAGGGGCAGAAGTTCTGACCAGG - Intronic
1043223495 8:77695714-77695736 TAGTATCAGAAATTCTGGCCAGG - Intergenic
1043668549 8:82849933-82849955 AAGATACAGAACTACTGGCCTGG + Intergenic
1044113668 8:88306906-88306928 CAGTATTAGAAGTTCTGGCCAGG + Intronic
1044508202 8:93045538-93045560 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1044649945 8:94483624-94483646 AAGATGAAAAAGTTCTGGCCGGG + Intergenic
1044961384 8:97534353-97534375 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1045001053 8:97878557-97878579 AAGAAGAAGAAGTCCAGGCATGG + Intronic
1045208618 8:100070797-100070819 TAAAATGAGAAGTTCTGGCCAGG + Intronic
1045677261 8:104620910-104620932 AAGAAGCAAAAGATCTGTACTGG + Intronic
1045978189 8:108153184-108153206 TAGTAGTAGAAGTTCTGGACAGG + Intergenic
1046278736 8:111996573-111996595 GAGAAGCAGAAAATCTGCCCAGG + Intergenic
1046653752 8:116870905-116870927 CAGCAGCTGAAGTGCTGGCCAGG - Intronic
1047372029 8:124264085-124264107 AAGATGAAAAAGTTCTGGCTTGG - Intergenic
1048065925 8:130968464-130968486 AAAAAGCAGAATAACTGGCCGGG - Intronic
1049073049 8:140371997-140372019 AAGAAACAGAAGTTGTTGGCTGG - Intronic
1049779555 8:144422581-144422603 AAGAAGCCGGAGGACTGGCCAGG - Intergenic
1051526432 9:18049916-18049938 CAGAATCAGAAGTCCGGGCCGGG - Intergenic
1051569353 9:18538132-18538154 AAGAAGCAGAAATTCCAGCAGGG + Intronic
1052096203 9:24387484-24387506 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1052173715 9:25431999-25432021 CAGAATTAGAAGTACTGGCCAGG + Intergenic
1052336150 9:27322438-27322460 AAAAAGCAGGGGTTGTGGCCAGG - Intergenic
1053087786 9:35241916-35241938 AAGGAGCTGAAGTTTTGGACAGG + Intronic
1053410087 9:37910340-37910362 GAGAAACTGAAGTTCAGGCCTGG - Intronic
1055688510 9:78804679-78804701 GAGAAGCTGTGGTTCTGGCCTGG + Intergenic
1057056247 9:91963447-91963469 AACAAGGAGAAGTTCTGGAAAGG - Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058529986 9:105896444-105896466 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1058558676 9:106200347-106200369 AAGTATTGGAAGTTCTGGCCAGG - Intergenic
1058783677 9:108364984-108365006 AAGAAAAAGAAGTTTAGGCCGGG + Intergenic
1058909253 9:109506045-109506067 AAGAAGCTGATGTTCTGGGCCGG - Intergenic
1059688812 9:116663745-116663767 AAGTAGCAGAACATCTGTCCTGG - Intronic
1059846975 9:118290749-118290771 AAGAAACAGAAGTTCCAACCTGG - Intergenic
1060386685 9:123236836-123236858 AAGAAGCAACAGTTGAGGCCAGG + Intronic
1060603086 9:124890857-124890879 AAGAAGAAGAAGTAATGACCAGG + Intronic
1061545519 9:131302112-131302134 ATTAAGAACAAGTTCTGGCCGGG - Intronic
1185495830 X:554188-554210 AAGAAGGAGGAGTCCTGACCCGG + Intergenic
1185850391 X:3480501-3480523 AAAAATCAGAGTTTCTGGCCAGG - Intergenic
1186029531 X:5352957-5352979 AACAAGAAGAATTTCTGGCCGGG + Intergenic
1186061560 X:5713634-5713656 TAGAATTGGAAGTTCTGGCCAGG + Intergenic
1186841949 X:13493265-13493287 AAAAAGCAAAAGTTAAGGCCGGG - Intergenic
1186895601 X:14001804-14001826 AAGAAGCACATGTTGGGGCCGGG - Intergenic
1187928315 X:24270888-24270910 AAGAAGGAATACTTCTGGCCAGG - Intergenic
1188422505 X:30007364-30007386 AAGCAGGAGAACTTCTGGCGAGG + Intergenic
1188738840 X:33752143-33752165 AAGTATTAGAAGTTTTGGCCAGG - Intergenic
1189574716 X:42339380-42339402 TAGTATCAGAAGTTCTGCCCAGG - Intergenic
1189688203 X:43587820-43587842 ATGAGGAAGAAGTTCTGGCCAGG - Intergenic
1189786838 X:44566536-44566558 AAAAAAATGAAGTTCTGGCCAGG - Intergenic
1189832863 X:44992516-44992538 AAAAAGCAGTATTGCTGGCCAGG - Intronic
1190268867 X:48847022-48847044 AAAAAGAAAAAGTTTTGGCCGGG + Intergenic
1190363819 X:49673223-49673245 AAGAAGAAGAAGATCTGGCCAGG - Intergenic
1190600286 X:52085229-52085251 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1191091197 X:56624059-56624081 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1191149397 X:57204651-57204673 AAGAAGCAGAACTACTGGTTTGG - Intergenic
1191168190 X:57414223-57414245 TAGTATCAGAATTTCTGGCCAGG - Intronic
1191915524 X:66197819-66197841 AAGAGACACAAATTCTGGCCTGG + Exonic
1192635596 X:72813563-72813585 TAGAATTGGAAGTTCTGGCCGGG - Intronic
1192646118 X:72907240-72907262 TAGAATTGGAAGTTCTGGCCGGG + Intronic
1192702827 X:73494057-73494079 TAGTATCAGAAGTTCTGGCAAGG - Intergenic
1192716803 X:73651357-73651379 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1192768141 X:74163049-74163071 AAGAGAGAGAAGTTCTGGCATGG + Intergenic
1192825854 X:74695677-74695699 ATCAAGCAGAAATTCTGGGCTGG + Intergenic
1193089821 X:77482187-77482209 AAGAAGCAGGACTTCTGGGAGGG - Intergenic
1193479047 X:82004242-82004264 TAGAATTGGAAGTTCTGGCCAGG - Intergenic
1193893846 X:87085927-87085949 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1194230928 X:91322698-91322720 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1194496152 X:94620142-94620164 AAGAAGCAAAAGTGGAGGCCGGG + Intergenic
1194635271 X:96338775-96338797 TAGAATTTGAAGTTCTGGCCAGG - Intergenic
1194700453 X:97107474-97107496 AAGTAGGAGAGGTTCTGCCCTGG + Intronic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1195212698 X:102665675-102665697 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1195213730 X:102676122-102676144 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1195332507 X:103815561-103815583 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195677669 X:107519727-107519749 AAGAAGGAGGAGTAATGGCCTGG + Intergenic
1195812033 X:108844814-108844836 TAGTATTAGAAGTTCTGGCCGGG - Intergenic
1196054892 X:111344367-111344389 TAGTATTAGAAGTTCTGGCCAGG + Intronic
1196086929 X:111693539-111693561 AAGAAGCATGTATTCTGGCCGGG - Intronic
1196561602 X:117155811-117155833 AAGTATAGGAAGTTCTGGCCAGG + Intergenic
1196743900 X:119050478-119050500 AAGAAGCATAAAATCTGGCCGGG - Intergenic
1197123911 X:122922404-122922426 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1197423696 X:126269334-126269356 TAGTATTAGAAGTTCTGGCCAGG - Intergenic
1197906642 X:131432385-131432407 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1198403561 X:136290734-136290756 AAGAAGCAAGGGTTCTGGCTGGG - Intergenic
1198556245 X:137796425-137796447 TAGTATTAGAAGTTCTGGCCAGG + Intergenic
1199749820 X:150804888-150804910 AAGAAATAGAAAATCTGGCCAGG + Intronic
1199750382 X:150810904-150810926 AAGAAATAGAAAATCTGGCCAGG + Intronic
1199762589 X:150916477-150916499 TAGAAGCAGAGGTCCTGCCCTGG - Intergenic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic
1201639333 Y:16161842-16161864 AACAATAAGAATTTCTGGCCAGG - Intergenic
1201663480 Y:16423485-16423507 AACAATAAGAATTTCTGGCCAGG + Intergenic
1201679428 Y:16626519-16626541 CAAAAGCAGAAGTCCTGACCAGG - Intergenic
1201734325 Y:17241461-17241483 TAGTATTAGAAGTTCTGGCCAGG - Intergenic