ID: 977121388

View in Genome Browser
Species Human (GRCh38)
Location 4:93106067-93106089
Sequence ACATAACAACAGGTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977121388_977121393 7 Left 977121388 4:93106067-93106089 CCTTCCACCACCTGTTGTTATGT 0: 1
1: 0
2: 0
3: 15
4: 269
Right 977121393 4:93106097-93106119 TGGTCAGTAGAAGAAATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977121388 Original CRISPR ACATAACAACAGGTGGTGGA AGG (reversed) Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902538600 1:17136508-17136530 AGATCCCCACAGGTGGTGGAAGG - Intergenic
905049384 1:35036688-35036710 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
907481020 1:54745580-54745602 ACAAAACACCAGGTTGTAGAAGG + Intergenic
909909473 1:81244490-81244512 AGAAAACAACAGATGCTGGAAGG + Intergenic
910689014 1:89947303-89947325 ACCTGACAACAGATGGGGGAAGG - Intergenic
911773245 1:101774712-101774734 GCATAAAAACAGGTGGTGGGAGG + Intergenic
911812980 1:102307810-102307832 AGGAAACAACAGGTGCTGGAGGG - Intergenic
912913541 1:113788339-113788361 ACATAAAAAAGGGTGGTGGGGGG + Intronic
913297843 1:117338878-117338900 AGATAACAAAAGCTGTTGGAGGG + Intergenic
913590494 1:120320153-120320175 ACATATAAACTGGTGGGGGAGGG - Intergenic
913617690 1:120578210-120578232 ACATATAAACTGGTGGGGGAGGG + Intergenic
914572582 1:148932762-148932784 ACATATAAACTGGTGGGGGAGGG - Intronic
914600258 1:149197500-149197522 ACATATAAACTGGTGGGGGAGGG + Intergenic
916327395 1:163578301-163578323 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
916903128 1:169252209-169252231 AGGAAACAACAGGTGCTGGAGGG - Intronic
918718602 1:187823991-187824013 AGGAAACAACAGGTGCTGGAGGG - Intergenic
919027597 1:192197721-192197743 AGAGATCAAAAGGTGGTGGAAGG + Intergenic
919178690 1:194053717-194053739 ATATAACAAAAAGGGGTGGAGGG + Intergenic
920854750 1:209653233-209653255 ACCTGACCACAAGTGGTGGAAGG + Intergenic
922766919 1:228160748-228160770 ACAGAACCAAAGGTGGAGGAAGG - Intergenic
923962947 1:239104581-239104603 ACAGAATAACGGGTGGTAGAGGG - Intergenic
924110292 1:240692153-240692175 ACAGAACAAGAGATGGAGGACGG + Intergenic
1064793940 10:18990099-18990121 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1066277509 10:33883353-33883375 ACAAAACAACAGTTGATGGATGG - Intergenic
1069596586 10:69675917-69675939 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1073202084 10:101743875-101743897 ATATGAAAACAGGTGGTGAATGG + Intergenic
1073377571 10:103049973-103049995 ATATACCAACAGGTTGTGCACGG - Intronic
1075282075 10:121147761-121147783 ACATAACAATTGGTGGTGTAGGG - Intergenic
1075803435 10:125167582-125167604 ACAAAAAAACAGGAGATGGATGG + Intergenic
1076038126 10:127218679-127218701 AAATAACAACAGAAAGTGGAGGG - Intronic
1080465378 11:32491407-32491429 AGAAAACAACAGGTGCTGGAGGG - Intergenic
1082137139 11:48562227-48562249 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1082593446 11:55044150-55044172 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1084327311 11:68408635-68408657 ACATTACAACAGGTATTTGATGG + Intronic
1084766248 11:71310760-71310782 ACATATGAATTGGTGGTGGAGGG - Intergenic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1087403123 11:97693572-97693594 AGAAAACAACAGATGCTGGAGGG - Intergenic
1088158489 11:106839351-106839373 AGGGAACAACAGGTGCTGGAGGG + Intronic
1088800024 11:113297015-113297037 AAATACCAACAGGTGGGGGCAGG - Intergenic
1089164448 11:116464323-116464345 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1090524017 11:127509842-127509864 TTATAACAACATGTGGTGGTTGG + Intergenic
1091499683 12:1004082-1004104 CCATAACAGGAGATGGTGGAAGG - Intronic
1093088353 12:14891985-14892007 ACAAAAAAGCAGATGGTGGAGGG + Intronic
1094125152 12:27015404-27015426 ACATAACATCACCTGGGGGATGG + Intergenic
1095980309 12:47969298-47969320 TAACAACAACAGGTGGTGGCTGG + Intergenic
1097468541 12:59958570-59958592 ACGAAACAACAGATGCTGGAGGG + Intergenic
1097957005 12:65496510-65496532 ACCAAACAACAGGAGGAGGAAGG + Intergenic
1098629861 12:72711391-72711413 ACAGAATAATAGGTTGTGGAGGG + Intergenic
1098732861 12:74061041-74061063 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1104076611 12:125395535-125395557 ACAAGAGAACAGATGGTGGAAGG - Intronic
1104177331 12:126345680-126345702 CCCTAGTAACAGGTGGTGGAAGG - Intergenic
1105706639 13:22971427-22971449 ACAGAAGAACAGTTGGAGGAAGG - Intergenic
1106278652 13:28241518-28241540 AAATAACAAGTGGTGGTGGCAGG + Intronic
1108143035 13:47446501-47446523 ACATAATGACAGATGGTTGAGGG - Intergenic
1108746012 13:53395077-53395099 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1109329180 13:60906396-60906418 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1109871587 13:68340591-68340613 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1111630605 13:90842658-90842680 ACAGAATAACAGGTTGTGGAGGG - Intergenic
1111733715 13:92110241-92110263 ACTAAACACCAGGTAGTGGAAGG + Intronic
1112405454 13:99115872-99115894 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1112990811 13:105512183-105512205 ACACAACAAAAGGTTGTGCATGG - Intergenic
1113193586 13:107778801-107778823 AAGTAACAACAGGTGATTGAGGG - Intronic
1113216387 13:108045592-108045614 AGATAAAAACAGAGGGTGGAAGG - Intergenic
1113398694 13:109972286-109972308 ACCCAAGAGCAGGTGGTGGAAGG - Intergenic
1114893070 14:26950097-26950119 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1116148623 14:41107917-41107939 AAAAAACAACAGATGGTGGTAGG + Intergenic
1116243348 14:42376513-42376535 AAATAACTTGAGGTGGTGGAAGG - Intergenic
1116696256 14:48182269-48182291 ACATGACAGCAGGAGGTGGGGGG - Intergenic
1117085839 14:52199998-52200020 AGGAAACAACAGGTGCTGGACGG + Intergenic
1117087176 14:52213625-52213647 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1117088603 14:52226856-52226878 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1117996361 14:61481949-61481971 ACACATCATCAGGTGGTGGGTGG - Intronic
1118046757 14:61978540-61978562 ACATCACAACAGGGAGTGGCAGG + Intergenic
1119686920 14:76640393-76640415 TTACAAAAACAGGTGGTGGAGGG - Intergenic
1120002515 14:79318572-79318594 ACATGACAACAGCTGGAGAATGG - Intronic
1120358145 14:83459846-83459868 ACATAACCACCTGTGGTGGGAGG + Intergenic
1121678471 14:95773374-95773396 ACATCACAACTGGGGGTTGAGGG - Intergenic
1122381158 14:101308208-101308230 ACAGAATAACGGGTTGTGGAGGG + Intergenic
1122689477 14:103524933-103524955 AAATAACCACAGGTGTTGGGGGG - Intergenic
1123585318 15:21755099-21755121 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1123621965 15:22197706-22197728 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1124238148 15:28007179-28007201 ACATAATACCAGGGGTTGGATGG + Intronic
1125078209 15:35645724-35645746 AAATAAAAACAGGTAGTGGTGGG + Intergenic
1127002562 15:54526800-54526822 ACACAACAACAGGTGATGAGTGG - Intronic
1127194499 15:56569007-56569029 AGAGAGGAACAGGTGGTGGATGG - Intergenic
1127613707 15:60662156-60662178 ATATGACAACAGTTGGGGGATGG + Intronic
1129962528 15:79700503-79700525 CCATAACATCAAATGGTGGAAGG + Intergenic
1130861480 15:87894698-87894720 ACATACCAACAGTTGGAGAAGGG - Intronic
1131379665 15:91953573-91953595 ACAGAACTACAGGGCGTGGAAGG + Intronic
1131423886 15:92329711-92329733 ATATAACATCAGGTTGTGGAAGG + Intergenic
1131563553 15:93464907-93464929 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1132949242 16:2551285-2551307 ACAGAAAACCAGGTGGAGGAAGG - Intronic
1132965346 16:2650843-2650865 ACAGAAAACCAGGTGGAGGAAGG + Intergenic
1133288516 16:4702606-4702628 ACATAAAGACACGTGGTCGATGG - Intronic
1133390510 16:5406333-5406355 ATAGAACAAAAGGTGGAGGAGGG + Intergenic
1134887124 16:17803595-17803617 AAAAAAAAAAAGGTGGTGGAGGG - Intergenic
1135419266 16:22293991-22294013 AAAAAAAAAAAGGTGGTGGATGG + Intergenic
1138283550 16:55790902-55790924 ACATCAAGACAGGTGGTGGTGGG + Intergenic
1138285452 16:55806085-55806107 ACATCAAGACAGGTGGTGGTGGG - Intronic
1139403272 16:66698407-66698429 ACAGAAAAACAGGTGGGGCACGG - Intergenic
1144501961 17:15795958-15795980 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1144546111 17:16197390-16197412 ACATGACATCAGGAGGAGGATGG - Intronic
1144856312 17:18270274-18270296 CCAGAACAACAGGTGGAAGAAGG - Intergenic
1145164143 17:20598620-20598642 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1146740699 17:35280980-35281002 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1150422519 17:65051313-65051335 ACTTAAAAACAGGAGGTAGATGG + Intronic
1151633960 17:75331028-75331050 ACAAAAAAACAGGAGGTGGTAGG + Intronic
1152132751 17:78486804-78486826 ACATACCAAGGGCTGGTGGATGG + Intronic
1153279302 18:3399135-3399157 AAAGAACAAAAGGTGGAGGAAGG + Intergenic
1153402848 18:4700144-4700166 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1156381799 18:36568357-36568379 AAAAAAAAAAAGGTGGTGGAGGG + Intronic
1156922664 18:42541697-42541719 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1158062915 18:53368077-53368099 ACAAAACAACAAGTGTTGGCAGG - Intronic
1160161394 18:76474031-76474053 ATATAACTACAGCTGGGGGAGGG - Intronic
1160402722 18:78622461-78622483 ACAGAACAAAAGGCGGAGGAAGG + Intergenic
1160672442 19:372620-372642 CAACAACAACAGGTGGGGGAAGG - Exonic
1162287227 19:9747931-9747953 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1163234405 19:16022516-16022538 ACAGAACACCAGGTGGTGGCTGG - Intergenic
1164202345 19:23029339-23029361 ACAGAATAACGGGTTGTGGAGGG + Intergenic
1164317903 19:24110719-24110741 TCATAAAAACAGAAGGTGGAAGG - Intronic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1167650269 19:50724934-50724956 ACAAAACATCCGGGGGTGGAGGG - Intronic
925215705 2:2094261-2094283 AGGAAACAACAGGTGCTGGAGGG + Intronic
926023179 2:9515007-9515029 ATTTAAAAACAGGTGGTGGCAGG - Intronic
927801050 2:26100003-26100025 CCTTAACAACTGGTGGGGGATGG - Intronic
928018654 2:27683075-27683097 ACACAGCAAAAGGTGTTGGAAGG - Intronic
930330627 2:49978642-49978664 ACAGAAAAACAGCTGGGGGAGGG + Intronic
931684422 2:64781391-64781413 CCATAACAAAAGGAGGTGCAGGG - Intergenic
931687000 2:64802763-64802785 ACAGAACAAAAGGTGGAGGAAGG - Intergenic
931948423 2:67334818-67334840 ACAGAATAACAGATTGTGGAGGG - Intergenic
932081207 2:68716681-68716703 AGATAACATCATGTGGTTGAAGG - Intronic
932358652 2:71087536-71087558 ACAGAATAACAGGTAGTAGAGGG + Intergenic
934654480 2:96110090-96110112 ACAGCCCAACAGGTGGTGGCAGG + Intergenic
935825716 2:106947177-106947199 AGAAAACAACAGGTGCTGGAGGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936717889 2:115210667-115210689 AGGAAACAACAGGTGCTGGAGGG - Intronic
937058879 2:118966843-118966865 ATTTAACACGAGGTGGTGGATGG - Intronic
938249505 2:129803306-129803328 AGATAATAACAGGTGTTGGCAGG + Intergenic
938311854 2:130295786-130295808 ACATAACCATAGCTGTTGGAAGG - Intergenic
939941587 2:148358077-148358099 ACACCACAATAGGTGGAGGATGG - Intronic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
941559156 2:167023103-167023125 AGGAAACAACAGGTGCTGGAGGG - Intronic
942641396 2:178064629-178064651 ACATAATAACAGAAGGTAGAGGG - Intronic
943061731 2:183047105-183047127 ACAGAATAACGGGTTGTGGAGGG - Intergenic
943875804 2:193065947-193065969 AGGAAACAACAGGTGCTGGAGGG - Intergenic
943947573 2:194087712-194087734 AAATCACAACAGGAGCTGGACGG + Intergenic
944002027 2:194851207-194851229 AGGAAACAACAGGTGCTGGAGGG - Intergenic
944249101 2:197563145-197563167 AGGAAACAACAGGTGCTGGAGGG - Intergenic
944269909 2:197770840-197770862 AGGAAACAACAGGTGCTGGAGGG + Intronic
945262430 2:207856224-207856246 AAAACACAACAGGTGGTGGTGGG - Intronic
945554858 2:211264698-211264720 ACAGAACAATGGGTTGTGGAGGG - Intergenic
947233154 2:227909773-227909795 ATACAACAAAAGGTGGAGGAAGG - Intronic
947275427 2:228386339-228386361 AGGAAACAACAGGTGCTGGAGGG - Intergenic
948704933 2:239784183-239784205 ATAGAACAAAAGGTGGAGGAAGG - Intronic
1170014235 20:11763172-11763194 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1170906084 20:20516215-20516237 ACATACCAACAGGTGGGGATAGG - Intronic
1171086020 20:22239148-22239170 TGAAAACAACAGGTGGTGGATGG + Intergenic
1173262871 20:41452036-41452058 ACATACAGACAGGTGTTGGAGGG + Intronic
1173600088 20:44288553-44288575 ACATAACAACTGGCTGTGGTGGG + Intergenic
1173763613 20:45586693-45586715 ACAGAATAACGGGTTGTGGAGGG + Intergenic
1173997247 20:47347882-47347904 ACAGAACAGGAGGTGGTAGAGGG - Exonic
1177428326 21:20955605-20955627 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1177962675 21:27687713-27687735 ACATAAAAAAAGGTGTTGGAAGG - Intergenic
1179217034 21:39376403-39376425 ACCTAAAAACAGGTGCTGGCTGG - Intergenic
1180049767 21:45325796-45325818 ACAGAACCACAGCTCGTGGAGGG - Intergenic
1181516825 22:23419020-23419042 ACAACACAACACGTGGAGGAAGG + Intergenic
1182152792 22:28042072-28042094 AGGAAACAACAGGTGCTGGAGGG + Intronic
1182972134 22:34589019-34589041 ACATGACACCAGCTGGGGGAGGG + Intergenic
949133743 3:536989-537011 ATAAAACAAAAGGTGGAGGAAGG - Intergenic
949289936 3:2452552-2452574 CCATAACATTAGGTGGAGGAGGG + Intronic
949507281 3:4739645-4739667 AGATAACTACAGGTGGAGGTGGG - Intronic
949585335 3:5431495-5431517 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
950883812 3:16345539-16345561 ACAGAACAAAGGGTGGAGGAAGG + Intronic
951198692 3:19853972-19853994 AGGAAACAACAGGTGCTGGAGGG + Intergenic
953599273 3:44347522-44347544 ACAGAATAATGGGTGGTGGAGGG + Intronic
953904156 3:46859982-46860004 ACCCAATCACAGGTGGTGGAGGG - Intronic
954633852 3:52061040-52061062 CCATAGCAACAGGTTCTGGATGG + Intergenic
956176185 3:66475379-66475401 ACCAAACAAAAGGTGGTGGTTGG + Intronic
957061400 3:75484106-75484128 AGGAAACAACAGGTGTTGGAGGG - Intergenic
959604576 3:108228018-108228040 AAAGAAAAAGAGGTGGTGGAGGG + Intergenic
961142593 3:124567612-124567634 TCACAGCAGCAGGTGGTGGAGGG + Intronic
962242931 3:133766587-133766609 ACATAGCAACAAGGGCTGGAAGG + Intronic
963983949 3:151570383-151570405 AGGAAACAACAGGTGCTGGAGGG - Intergenic
963987516 3:151614163-151614185 AGGAAACAACAGGTGCTGGAGGG + Intergenic
964753499 3:160074146-160074168 TGATAACAACAGGTGGTGGGCGG - Intergenic
965132377 3:164717571-164717593 ACATATTGACAGGCGGTGGAAGG - Intergenic
966642303 3:182204529-182204551 AAATAATAACAGCTGGTGGTAGG - Intergenic
968264124 3:197349576-197349598 AGAAAACCACAGGTTGTGGAGGG + Intergenic
970230586 4:13906524-13906546 ACATAACAAGAGGTGTAGGGAGG - Intergenic
970245481 4:14057344-14057366 AGGAAACAACAGATGGTGGAGGG - Intergenic
971128938 4:23784683-23784705 AGGAAACAACAGGTGCTGGAGGG + Intronic
975518338 4:75271228-75271250 AGGAAACAACAGGTGCTGGAGGG - Intergenic
975989435 4:80242173-80242195 AAATAACAACTGGTGGTCAAGGG - Intergenic
976928040 4:90526555-90526577 ACATAGACACAGGTGGGGGATGG - Intronic
977121388 4:93106067-93106089 ACATAACAACAGGTGGTGGAAGG - Intronic
977782271 4:100994266-100994288 ACAGAACAATGGGTTGTGGAGGG + Intergenic
978012294 4:103702393-103702415 AGGAAACAACAGGTGCTGGAGGG + Intronic
978977044 4:114890359-114890381 AAATAATAACAGGTGGTCAAGGG + Intronic
979686132 4:123511901-123511923 AGGAAACAACAGGTGCTGGAAGG - Intergenic
981178628 4:141713368-141713390 TTATAAAAACAGGTGGTTGATGG - Intronic
982312383 4:153999670-153999692 AAATACAAACAGGTGGAGGAAGG - Intergenic
983661610 4:170135175-170135197 ACATACCACCAGGTGGGGGTAGG + Intergenic
984439385 4:179747121-179747143 AAACAACAACAAGTGGTGTAGGG + Intergenic
986428220 5:7655532-7655554 AGAGAACAAAAGGTGGAGGAAGG - Intronic
990237053 5:53779682-53779704 ACATCAGAACAGCTGTTGGAAGG + Intergenic
992952111 5:81869699-81869721 ACATCACCACAGGTAGTGAAGGG - Intergenic
993779975 5:92054486-92054508 AGGAAACAACAGGTGCTGGAGGG + Intergenic
995963806 5:117879307-117879329 ACAGAAGAATAGGTGGGGGATGG - Intergenic
998268988 5:140690153-140690175 ACATAACCACATGTGGTGGCCGG + Intronic
1001061874 5:168497879-168497901 ACATATTAACAGGTGGGGGATGG - Intronic
1004648565 6:17586428-17586450 ACAGAACAAGAAGTGGAGGAAGG + Intergenic
1008566301 6:52771877-52771899 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1008634880 6:53400699-53400721 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1009822905 6:68827462-68827484 ACATAACAGCAGTTTGTAGAGGG + Intronic
1012418916 6:99040318-99040340 ACATCATAACAGTAGGTGGAAGG - Intergenic
1012689742 6:102296144-102296166 ACAGAATAACAGGTAGTAGAGGG - Intergenic
1012747836 6:103117235-103117257 ACAGAACAAGAGGTGGAGAAAGG + Intergenic
1013156459 6:107495397-107495419 ACATCACACCAGTTCGTGGATGG - Intronic
1015801216 6:137063823-137063845 ACAGAATAATAGGTTGTGGAGGG + Intergenic
1020355012 7:7266276-7266298 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1021639618 7:22724728-22724750 ACATAAAAACACTTAGTGGAGGG + Intergenic
1021898050 7:25256069-25256091 AGACAACAACAGATGGCGGATGG + Intergenic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1023065700 7:36375188-36375210 AGGAAACAACAGGTGCTGGAGGG - Intronic
1023346437 7:39276394-39276416 AGGAAACAACAGGTGCTGGAGGG + Intronic
1023839823 7:44090455-44090477 ATATAAGAACCGGTGGTGGCGGG + Intergenic
1024721488 7:52141871-52141893 ACATTACAAAAGGTGTTAGAAGG - Intergenic
1024797232 7:53035347-53035369 ACATCACAAGAGGGGGAGGAAGG + Intergenic
1026421841 7:70246630-70246652 AAATAATAAGAGGTGGGGGAGGG - Intronic
1027025093 7:74845629-74845651 ACATAACAACAAATGGAGGCAGG + Intronic
1027062671 7:75098489-75098511 ACATAACAACAAATGGAGGCAGG - Intronic
1030180999 7:106709386-106709408 ACATAAAAACAGCTCTTGGACGG + Intergenic
1030449193 7:109687782-109687804 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035773271 8:2167160-2167182 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1036482476 8:9151032-9151054 CCAGAACAACAGGTGGTAAAGGG + Intronic
1036715273 8:11116802-11116824 ACAAAACATCAAGTGGTTGAAGG - Intronic
1037384722 8:18326233-18326255 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1037418273 8:18674598-18674620 AGATCACAGCAGGGGGTGGATGG + Intronic
1038489242 8:27958020-27958042 TTATAAAAACAGGTGGTGGCTGG + Intronic
1040509224 8:48078793-48078815 ACAGAACAAAAAGTGGAGGATGG - Intergenic
1040575927 8:48651485-48651507 ATGTAACAACAGTTGGAGGAAGG - Intergenic
1041262783 8:56036299-56036321 ACAGAGCAAAAGGTGGAGGAAGG + Intergenic
1043706839 8:83360750-83360772 ATAGAACAAAAGGTGGAGGATGG + Intergenic
1044605979 8:94047790-94047812 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1044682963 8:94800397-94800419 AAAAAAAAACAGGTGGTGGGGGG + Intergenic
1045267054 8:100628082-100628104 AGGAAACAACAGGTGCTGGAGGG + Intronic
1045395913 8:101760428-101760450 AGATGACAACAGGAGGGGGAAGG + Intronic
1046520514 8:115319319-115319341 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1046868230 8:119174706-119174728 AAATAAAAACAGGTGGGGCACGG - Intronic
1048135624 8:131743937-131743959 ACAGAATAACGGGTTGTGGAGGG - Intergenic
1052103987 9:24488625-24488647 ACATAAAAACAGTTGTTAGAAGG + Intergenic
1052391355 9:27882021-27882043 ACATGACAAAAGGAGGAGGAAGG + Intergenic
1052408850 9:28097177-28097199 AGGAAACAACAGGTGCTGGAGGG + Intronic
1053878679 9:42568972-42568994 ACAAAACCAGAGGCGGTGGAAGG + Intergenic
1054233009 9:62532723-62532745 ACAAAACCAGAGGCGGTGGAAGG - Intergenic
1055494713 9:76842818-76842840 AGGTAACAACAGATGCTGGAGGG + Intronic
1055808325 9:80121665-80121687 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1057012122 9:91613938-91613960 AGGAAACAACAGGTGCTGGAGGG + Intronic
1057498629 9:95579495-95579517 ATAAAACAAAAGGTGGAGGAAGG + Intergenic
1058348783 9:103996878-103996900 ACAGGACAACAGGTGGTTGGTGG + Intergenic
1060790345 9:126481689-126481711 AGAAAACAACAGCTGGGGGATGG + Intronic
1186535918 X:10348426-10348448 ACATCACATCAGTTGGTAGAAGG - Intergenic
1191183977 X:57591202-57591224 ACAGTACAACCGATGGTGGAAGG + Intergenic
1191798743 X:65053756-65053778 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1192096970 X:68222271-68222293 AGGAAACAACAGGTGCTGGAGGG + Intronic
1192595378 X:72401522-72401544 AGATAATAACAAGTGGTGGCCGG - Intronic
1192624829 X:72715682-72715704 AGAGAGCAACAGGTGGGGGATGG - Intergenic
1192731356 X:73805399-73805421 ACATAATAATGGGTTGTGGAGGG + Intergenic
1193234776 X:79093327-79093349 ATATAACAAAAGGTGAAGGATGG + Intergenic
1193567556 X:83096965-83096987 AGGAAACAACAGGTGTTGGAGGG + Intergenic
1193657526 X:84216648-84216670 CCATTACAGCAGGTGGTGCATGG + Intergenic
1193779622 X:85686087-85686109 ACAAAGGAACTGGTGGTGGACGG + Intergenic
1194761072 X:97796928-97796950 ACATAACAAAAGCTAGTGAAGGG + Intergenic
1195673622 X:107489484-107489506 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1195677294 X:107516524-107516546 AGGAAACAACAGGTGCTGGAGGG - Intergenic
1197646527 X:129023967-129023989 AGGAAACAACAGGTGCTGGAGGG + Intergenic
1198975858 X:142334418-142334440 ACATAACAACATGTATTGCAAGG + Intergenic
1199493213 X:148424106-148424128 ATAGAACAAAAGGTGGAGGATGG - Intergenic
1199805740 X:151298573-151298595 ACATGACAACATGTGGTGTTTGG + Intergenic
1200833022 Y:7705691-7705713 AGGAAACAACAGGTGCTGGAAGG - Intergenic
1200863482 Y:8017775-8017797 AGGAAACAACAGGTGCTGGATGG + Intergenic
1201582869 Y:15529280-15529302 ACAAAACAAAAGCTAGTGGAAGG - Intergenic