ID: 977122144

View in Genome Browser
Species Human (GRCh38)
Location 4:93115651-93115673
Sequence GACTCACAGTTCCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20276
Summary {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977122139_977122144 22 Left 977122139 4:93115606-93115628 CCATACCTGAGACTGGGTAATTT 0: 10
1: 33
2: 41
3: 64
4: 158
Right 977122144 4:93115651-93115673 GACTCACAGTTCCACAGGACTGG 0: 14
1: 381
2: 3819
3: 7199
4: 8863
977122140_977122144 17 Left 977122140 4:93115611-93115633 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 977122144 4:93115651-93115673 GACTCACAGTTCCACAGGACTGG 0: 14
1: 381
2: 3819
3: 7199
4: 8863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977122144 Original CRISPR GACTCACAGTTCCACAGGAC TGG Intronic
Too many off-targets to display for this crispr