ID: 977124612

View in Genome Browser
Species Human (GRCh38)
Location 4:93149668-93149690
Sequence CTGTCACCAAAGCTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9230
Summary {0: 1, 1: 14, 2: 425, 3: 3284, 4: 5506}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977124612 Original CRISPR CTGTCACCAAAGCTGGAGTA TGG Intronic
Too many off-targets to display for this crispr