ID: 977125765

View in Genome Browser
Species Human (GRCh38)
Location 4:93165594-93165616
Sequence CCCTAAGAGCAGAGTCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977125762_977125765 4 Left 977125762 4:93165567-93165589 CCTGTTATGACTCTTCCAAAAGA 0: 1
1: 0
2: 0
3: 9
4: 171
Right 977125765 4:93165594-93165616 CCCTAAGAGCAGAGTCCCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977125765 Original CRISPR CCCTAAGAGCAGAGTCCCAA AGG Intronic
900789029 1:4667113-4667135 CCCTAAGACCACAGCCCCAGAGG - Intronic
902116363 1:14124953-14124975 CCCTCAGAGCCGCGTCTCAATGG - Intergenic
902611265 1:17598583-17598605 TCATAAGAGCAGAGCCCCCATGG - Intronic
905848831 1:41257955-41257977 CTCTAAGAGCGCAGTCCCAGGGG + Intergenic
908153033 1:61324196-61324218 CCCTGAGAGCAGTGTCCCCAGGG + Intronic
908922938 1:69218202-69218224 CCCAAAGAGAAGAATGCCAAAGG + Intergenic
911094517 1:94044693-94044715 CCCAACGAGCACAGTCCCAGAGG + Exonic
918097416 1:181346619-181346641 CCCTTAGAGAAGGGTCCTAAGGG - Intergenic
919509856 1:198448464-198448486 ACCTTAGAGCTGAGACCCAAAGG + Intergenic
921827880 1:219694289-219694311 CCCTAAGATCAGGCTCCAAATGG + Intronic
923048149 1:230370315-230370337 CCTGAAGGGCAGAGTCCCCACGG - Intronic
924175976 1:241391404-241391426 CCCTGAGAGCTGATTCCCCAAGG - Intergenic
1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG + Intergenic
1073010357 10:100354361-100354383 CCCTATTAGGAGAATCCCAATGG - Intronic
1076265994 10:129110384-129110406 CACCAAGGGCAGAGCCCCAAGGG - Intergenic
1077169717 11:1160756-1160778 CCCTAAGACCAGTGGCCCTAGGG - Intronic
1081210166 11:40323266-40323288 TTCTAACAGCAGAGTCCAAATGG - Intronic
1083047385 11:59749076-59749098 CCCCAACAGCAGAGACCCCAGGG - Intronic
1084391162 11:68878041-68878063 GCCTCAGAGCTGACTCCCAAGGG - Intergenic
1085228487 11:74944253-74944275 TCCTATGAGCTAAGTCCCAATGG - Intronic
1085329372 11:75635149-75635171 CAAGAAGAGCAGAGTCCCCAGGG - Intronic
1086936372 11:92749819-92749841 CCCTAGGAGCACAGTCTCTATGG - Intronic
1088698775 11:112392942-112392964 CCCAAAGAGCAGAGACAGAATGG - Intergenic
1090791743 11:130096074-130096096 CCCTTTGAGCAGAGTCCTGAGGG + Intronic
1092140647 12:6180936-6180958 GCCTGGGAGCAGAGGCCCAAAGG + Intergenic
1092788407 12:12050502-12050524 TCCTAAGAGCAAAATGCCAAGGG + Intronic
1095317556 12:40784678-40784700 CCCAGAGAGCAGGATCCCAAAGG + Intronic
1096083290 12:48847852-48847874 CCCTAAGAAAACAATCCCAAAGG + Intronic
1096782042 12:53997192-53997214 CCCAAATAGCAGAGGCCCATAGG + Intronic
1100850846 12:98709445-98709467 CCCTAAGAGCAGATGCCCTAAGG + Intronic
1101598438 12:106188340-106188362 CCCTCAAAGAAGAGTCCCCAAGG + Intergenic
1102099421 12:110266923-110266945 CCCTAAGATCAGGGGCCCAGAGG - Intergenic
1104165952 12:126230013-126230035 CCTGAAGAGCAGAGCCCCAAAGG + Intergenic
1104596360 12:130122748-130122770 CCCTTAGAAAAGAGGCCCAAGGG - Intergenic
1106493494 13:30251473-30251495 CCCTAATAAAAGATTCCCAAGGG + Intronic
1107527087 13:41243512-41243534 CCCTGAGCCCAGAGTCCCACAGG - Intronic
1107799228 13:44088445-44088467 CCCCATGAGCAGAGACCCGAGGG - Intergenic
1108461978 13:50675911-50675933 CCCTCATACAAGAGTCCCAAAGG - Intronic
1113031581 13:105999289-105999311 CCCTAAGATCTGAGTCTCCATGG - Intergenic
1113580017 13:111421948-111421970 GCCCACGAGCAGAGTCTCAAGGG - Intergenic
1116245727 14:42409010-42409032 TCATAAGAGCAGAGTCCGCATGG - Intergenic
1117816719 14:59606461-59606483 CCCTTAGAAAAGAGGCCCAAGGG + Intronic
1119650716 14:76381086-76381108 CCCTCAGAGGAGAGGCCCATAGG + Intronic
1124156009 15:27225853-27225875 CCCTAAGAACAGACTCCACATGG + Intronic
1125578508 15:40770379-40770401 CCCTAGGAGCAGAGGCCTCAGGG - Exonic
1129461064 15:75700341-75700363 CCCTGACAGAAGAGTCCCAGGGG - Intronic
1129723757 15:77891384-77891406 CCCTGACAGAAGAGTCCCAGGGG + Intergenic
1131153530 15:90061612-90061634 CCCTGAGATCTGTGTCCCAAGGG + Intronic
1132877740 16:2147953-2147975 CCCTGAGGGCAGAGTCCCGTGGG + Intronic
1136674515 16:31890800-31890822 TCATGAGGGCAGAGTCCCAATGG + Intronic
1142502325 17:339998-340020 CCCTCAGAGCAGAGGCACAAAGG + Intronic
1142956883 17:3528633-3528655 CCCCAGGTGCCGAGTCCCAAGGG - Intronic
1146415380 17:32627356-32627378 CCCTCATGGCAGTGTCCCAAAGG - Intronic
1146649936 17:34600515-34600537 ACCTCAGGGCAGACTCCCAAGGG - Intronic
1146931754 17:36782805-36782827 CCCTCAAAGGACAGTCCCAAGGG - Intergenic
1152665971 17:81569722-81569744 CCCTCAGAGCTGATACCCAAAGG + Intronic
1155355371 18:24947230-24947252 TCCTGACAGCAGAGTGCCAATGG - Intergenic
1157269748 18:46263530-46263552 CCCTAAGATGGGAGTGCCAATGG - Exonic
1159026575 18:63187958-63187980 CCCTATGAGCAGGGGCCAAATGG - Intronic
1164720476 19:30428402-30428424 CCAAAAGAACTGAGTCCCAAGGG - Intronic
1165997929 19:39858222-39858244 CCCTAAGAGTAGAGCCAAAAGGG - Intergenic
932548075 2:72736448-72736470 CCCTTAGAGCAGAGTCTCCCAGG + Intronic
938026028 2:127949166-127949188 CCCTTAGAGCAGTTTCCAAATGG + Intronic
940358894 2:152776137-152776159 CCCTCACAGCAGAGTCCCATGGG - Intergenic
945918625 2:215731393-215731415 CCCTAAGAGCAGGGTGGGAAAGG + Intergenic
948749937 2:240125933-240125955 CCCTGAGAGCAGAATCGCATCGG + Intergenic
948786159 2:240354060-240354082 CCCGAAGAGCAGCTTCCCTAGGG + Intergenic
1171419044 20:25005525-25005547 CCCTACCAGCAGAGTTCCCAGGG - Intergenic
1174739612 20:52999295-52999317 CCCTGAGAGCAGGGTCCTGATGG - Intronic
1179039864 21:37793005-37793027 CCCTAGGATCAGAGTCCCCCCGG - Intronic
1180076548 21:45466163-45466185 CCCTAAGATAAGGGACCCAAGGG + Intronic
1181831589 22:25564705-25564727 CCCTCAGTGCACAGTCCCAGCGG - Intergenic
1184562552 22:45271778-45271800 TCCTAAGAGCTGATTCACAAGGG + Intergenic
952952032 3:38533114-38533136 CCCTGAGAGCAGGGTTCCAAGGG - Intronic
953713360 3:45294038-45294060 CCTTAAAAGCAGAGTTCCCATGG + Intergenic
954279936 3:49570216-49570238 CCCATAGAGCAGAGTCAGAAGGG + Intronic
954327207 3:49870000-49870022 CCTTAAGGGCAGAATCCCACTGG + Exonic
955941217 3:64148702-64148724 CCCTTATAACAGAGGCCCAAGGG + Intronic
960016003 3:112888906-112888928 CTCTAAAAGCAGAGACCCACAGG + Intergenic
961366290 3:126401943-126401965 CCATGGGAGCAGAGCCCCAAGGG - Intronic
962981018 3:140490191-140490213 CCCACAGAGCAGAGACCCAGAGG - Intronic
964279513 3:155048279-155048301 CTCTTAGAGCAGAGTCACAAAGG + Intronic
966060600 3:175749606-175749628 CCATAAAAGCAGAGCCCCCAAGG + Intronic
966351571 3:179037338-179037360 CAGTAATGGCAGAGTCCCAAGGG - Intronic
966924453 3:184635310-184635332 CCCTGAGAGTGGAGTCCCAGGGG - Intronic
970786520 4:19803827-19803849 CCCAGAGGGCATAGTCCCAAGGG - Intergenic
977125765 4:93165594-93165616 CCCTAAGAGCAGAGTCCCAAAGG + Intronic
982366435 4:154584549-154584571 CCCTAAGAACAGAGCCCCTTTGG + Exonic
984139526 4:175986061-175986083 CCCAAAGTGCAGGGTCCCAAAGG + Intronic
988885589 5:35554270-35554292 TCCTGAGAGCAGTATCCCAACGG + Intergenic
990314343 5:54569886-54569908 CTCTAAGAGAGGAGTACCAAAGG + Intergenic
990971381 5:61510328-61510350 CCCCAAAAGCAGAGTGCCAGTGG - Intronic
991960005 5:72034978-72035000 CCCTGAGAGACCAGTCCCAAAGG + Intergenic
992105462 5:73447016-73447038 CCCTTGGTGCAGAGTCCCCAAGG + Exonic
995038346 5:107560822-107560844 CCCTGAGATCAGAATCCCAAAGG + Intronic
996267793 5:121562527-121562549 CAATAAGAGCAGAGCCCTAATGG + Intergenic
996646607 5:125825632-125825654 CCCTGAGAGGAAAGGCCCAAAGG + Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001568734 5:172716628-172716650 CCCAAAGTGCAGAGCCCCAAAGG - Intergenic
1002019334 5:176352585-176352607 CCCTCAGAGTAGAGTGCCATAGG - Intronic
1002133769 5:177096248-177096270 GCCTCAGTGCAGAGTCCCACAGG - Intronic
1003626918 6:7749598-7749620 TCCTCAGAGGAGAGTCCCAAAGG - Intronic
1007965312 6:45999069-45999091 CCCTGAGAGCAGAGTCCTTTTGG + Intronic
1015325336 6:131917934-131917956 CCCTCAGAGGACAGTCCCAGTGG - Intergenic
1016012653 6:139154435-139154457 CCCCTAGATCAGAGTTCCAATGG - Intronic
1028900837 7:96098912-96098934 CCCTACCAACAAAGTCCCAATGG - Intronic
1033319739 7:140328595-140328617 CTCTAGGGCCAGAGTCCCAAGGG - Intronic
1035610993 8:964420-964442 CCCACAGAGCAGAGTCGCAGAGG + Intergenic
1036111446 8:5907389-5907411 TCCTCATAGCAGAGTCCAAAAGG - Intergenic
1036581325 8:10078466-10078488 GCCTGAGGGCAGAGTCCCAGTGG - Intronic
1038291316 8:26252261-26252283 CCCTAATAAAAGAGACCCAAGGG - Intergenic
1040728642 8:50414518-50414540 CTGTACGAGCAGAGACCCAAAGG - Intronic
1045388295 8:101691382-101691404 CCATAGCAGCAGAGTCCCAGTGG + Intronic
1045683158 8:104683926-104683948 CCATGAGAGCAGAGTCCTTATGG + Intronic
1047346990 8:124038237-124038259 CCCTTTGAGCAGAGCCCTAAAGG - Intronic
1048890387 8:138941813-138941835 CCATAAAAGCTGAGTCCTAAAGG + Intergenic
1049078876 8:140425173-140425195 CCCCAAGAGCAGAGGCCAGAAGG + Intronic
1049209535 8:141379110-141379132 CCCTCAGATCAGGGTCCCCAGGG - Intergenic
1049373026 8:142276713-142276735 CACTACGATCAGAGTCCCCAGGG - Intronic
1050113355 9:2239640-2239662 CCCTAAGGACAGGGTTCCAAGGG - Intergenic
1051410297 9:16782666-16782688 CCCTAAGCCCAGAGTTCCATCGG - Intronic
1055033752 9:71796317-71796339 CCCTCCCAGTAGAGTCCCAAAGG + Intronic
1058027115 9:100153859-100153881 TCATAAGGGCAGAGCCCCAATGG + Intronic
1186582701 X:10838000-10838022 CCCTAAGAGCAGAGACCTAAAGG - Intergenic
1189380018 X:40496083-40496105 CCATGAGGGCAGAGTCCCCAGGG - Intergenic
1192704753 X:73518064-73518086 CCATGAGAGCAGAGTCCTTATGG + Intergenic
1195819343 X:108926444-108926466 CCCTAATAAAAGAGGCCCAAAGG + Intergenic
1196687740 X:118526638-118526660 CCCTAAGAGAAACCTCCCAAGGG + Intronic
1198838074 X:140825727-140825749 CCATAAGGGCACAGTCCCTATGG + Intergenic
1199004184 X:142675580-142675602 CCCTCAGGGCACAGTCCCTATGG + Intergenic
1200286737 X:154830076-154830098 CCCTAAGAGCAGAGGAGAAAGGG + Intronic