ID: 977131749

View in Genome Browser
Species Human (GRCh38)
Location 4:93248269-93248291
Sequence TTAAGAAGCATTTGCTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977131746_977131749 30 Left 977131746 4:93248216-93248238 CCCAGTACTATGGTAATAATTAT 0: 1
1: 0
2: 1
3: 23
4: 253
Right 977131749 4:93248269-93248291 TTAAGAAGCATTTGCTCATATGG 0: 1
1: 0
2: 0
3: 12
4: 226
977131747_977131749 29 Left 977131747 4:93248217-93248239 CCAGTACTATGGTAATAATTATT 0: 1
1: 0
2: 1
3: 18
4: 268
Right 977131749 4:93248269-93248291 TTAAGAAGCATTTGCTCATATGG 0: 1
1: 0
2: 0
3: 12
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977131749 Original CRISPR TTAAGAAGCATTTGCTCATA TGG Intronic
900882720 1:5393483-5393505 CTAATAAGCATTTGCTCCTATGG + Intergenic
900970201 1:5988213-5988235 TTAAGAAACTTCTGCTCGTAGGG + Intronic
901356048 1:8650221-8650243 TTTAGAAGCATGTGATCTTATGG - Intronic
906065701 1:42978735-42978757 TTAAGGATCATTTCCTCACAGGG + Intergenic
906357178 1:45116444-45116466 TAATGAAGCATTTGCTAGTAAGG - Intronic
908844297 1:68309229-68309251 TTGAGAAGCAGTTGCTTTTATGG - Intergenic
908953142 1:69587221-69587243 AGAAAAAGCATATGCTCATAAGG - Intronic
908996297 1:70159827-70159849 TTAAAAAGCATATGCTTATTTGG - Intronic
909121366 1:71608332-71608354 TTCAGAACCATTTGCTAAAAAGG - Intronic
909388233 1:75085566-75085588 TTAAAAAACTTTTGTTCATATGG + Intergenic
912224037 1:107711543-107711565 TTTAGAAGGATTTGCTTACAGGG - Intronic
912889333 1:113511891-113511913 TTCAGGAGCATTTGCTCCCAGGG + Intronic
917144128 1:171869427-171869449 TCCAGCAGCATTTCCTCATAAGG + Intronic
917192351 1:172431545-172431567 TAAAGCAGCAAGTGCTCATATGG + Intronic
917545668 1:175964673-175964695 TTAACAAGCATTTGATTAAATGG + Intronic
917756416 1:178103834-178103856 GTAAGAATCATTTCTTCATAAGG - Intronic
918067667 1:181112539-181112561 TTCAGCAGCATTTGTTCACAAGG - Intergenic
918380986 1:183955020-183955042 TTCAGGAGCATTTGATTATATGG + Intronic
920530346 1:206697463-206697485 TCAGGAAGCTTTTGCTCATGGGG + Intronic
921071618 1:211663723-211663745 TCAAAAAGTATTTGCTCTTATGG + Intronic
921256979 1:213350551-213350573 TTAAGAAGCAATAGCCAATATGG - Intergenic
921857273 1:220000661-220000683 TTAAGAATGATTTGCTTATGTGG - Intronic
922000384 1:221471727-221471749 TGAAGAAGCATTTGCTTAACAGG - Intergenic
1064379527 10:14828666-14828688 TCATGAAGCATTGACTCATATGG - Intronic
1064471557 10:15640773-15640795 CTCAGAAGCATTTGCTAAAAGGG + Intronic
1064895008 10:20225921-20225943 TTAAAATGCATATGCTGATATGG + Intronic
1065057421 10:21860970-21860992 TTAAGCAGCATTTGCTCTCCTGG - Intronic
1068923193 10:62506866-62506888 TTAAGAAGCAGTTTCTGACAAGG + Intronic
1069162497 10:65108744-65108766 TTAAGAAACAATTGCTCCTCTGG - Intergenic
1069456581 10:68558899-68558921 TTTTGAAGCATTGGCTCAGAAGG + Intergenic
1071887941 10:89971019-89971041 TTCAGAAGCATTTACTAATAAGG + Intergenic
1072319882 10:94238838-94238860 TTAAGAAGGATTTGTACATTTGG + Intronic
1072638439 10:97192918-97192940 TCAAGAAGCCTTTCCTCATGCGG + Intronic
1072975394 10:100052984-100053006 TGAAGAAGGCTGTGCTCATAAGG + Intronic
1076274663 10:129186947-129186969 TTATGAGGCCTTTGCTGATATGG - Intergenic
1078246467 11:9576363-9576385 TTAATAAGCATTAACACATAAGG + Intronic
1081101665 11:39009396-39009418 TTGAGAATCATTTGCACATAAGG - Intergenic
1082319566 11:50784302-50784324 TCAAGAAGAATTTTCTCAGAAGG + Intergenic
1082575199 11:54794753-54794775 TCAAAAAGCATTTTCTCAGAAGG + Intergenic
1083363172 11:62125339-62125361 TTAAAAAGTATTTGTTCAAATGG - Intronic
1083752852 11:64770840-64770862 TACAGAAGCTTTTCCTCATAGGG - Intronic
1088771206 11:113037572-113037594 TTAAGAAGCATCTGCTGGTTTGG + Intronic
1098572760 12:72007463-72007485 CTAAGAAGCATGAACTCATAAGG - Intronic
1101143520 12:101819994-101820016 TTAAGAGGCATAAGCTCACAGGG + Intronic
1107512759 13:41101482-41101504 TTTAGAAGCAATTTCTCAAAAGG - Intergenic
1107767874 13:43756682-43756704 TTAGTAAGGATTTGCTCATTAGG + Intronic
1109414137 13:62013209-62013231 TTAAGAAGGGTTTTCCCATATGG - Intergenic
1110753013 13:79137524-79137546 TTAAGAGGCATTAGGTCATGAGG + Intergenic
1111597642 13:90432040-90432062 TCAAGAAGGATTTCCTCAAAAGG + Intergenic
1114783908 14:25571780-25571802 TAAAGATGCATTTTCTCTTAAGG - Intergenic
1115726470 14:36222651-36222673 TCAAGAAACATTTACTTATAGGG - Intergenic
1116591393 14:46780450-46780472 TTGATATGCATTTGCTCATTTGG - Intergenic
1117373959 14:55103982-55104004 GTCTGAAGCATTTACTCATAGGG - Intergenic
1118586900 14:67361847-67361869 TTATTAAGCATTTGTTCTTAAGG + Intronic
1119888393 14:78163864-78163886 ATCAGGAGCATCTGCTCATATGG + Intergenic
1119900431 14:78254931-78254953 GTAAGAAGCATTTTCGCACAGGG - Intronic
1120494716 14:85220684-85220706 TGAAGAAGAATTTCCTGATAGGG + Intergenic
1123846545 15:24309069-24309091 ATAAGAAGGATGTGCTCTTATGG - Intergenic
1125199477 15:37088815-37088837 TTAAGAGGCATTTTATAATATGG - Intronic
1125465356 15:39945551-39945573 TGAAGCAGCATGTGCTCATGAGG + Intronic
1126586103 15:50289052-50289074 TTAAGTAGCTTTTTCTTATATGG + Intronic
1127635076 15:60861376-60861398 TTTATAAGTATTTGCTCATTGGG + Intronic
1127663895 15:61125632-61125654 TTAAAAAGAATTAGTTCATAGGG - Intronic
1128430161 15:67585228-67585250 TGAAGAAGCATTTGCTGAATTGG + Intronic
1131321274 15:91394026-91394048 TTAAGTAGCCTTTTCTCATAAGG - Intergenic
1131810363 15:96166982-96167004 TTTAGAAGCATGTGGTCATTCGG - Intergenic
1133135363 16:3707483-3707505 TTTAGAAACATTTCCTCTTAAGG - Intronic
1133666567 16:7973949-7973971 TTAATAAGCTTTTGCACACATGG + Intergenic
1133716262 16:8452291-8452313 TTAAAAAGCATGGGCTCAGAAGG - Intergenic
1137020631 16:35422941-35422963 TTCAGATGCATTTGATCACAAGG + Intergenic
1137257167 16:46785506-46785528 TTAGGAATCAGTTCCTCATATGG - Intronic
1137932168 16:52599282-52599304 TAAGGCAGCATTTGCTCATTAGG - Intergenic
1138991702 16:62398041-62398063 TTATGAAGCTTTTTCCCATATGG + Intergenic
1140248549 16:73273354-73273376 ATAAAAAGCATTTCCTCATGTGG + Intergenic
1143206562 17:5144381-5144403 TAAAACAGCATTTGCTCACATGG - Intronic
1149903277 17:60501628-60501650 TTTAGAAGCATTTGGTCTTGAGG - Intronic
1151117112 17:71749361-71749383 TGCAGAAGCATATTCTCATATGG - Intergenic
1151524764 17:74657292-74657314 TGCAGAAGCATTTGCTCTTCAGG - Intergenic
1153493298 18:5671653-5671675 TTAAGAAGCACTAGCTGACAAGG + Intergenic
1154240807 18:12652150-12652172 TTAAAAAGCATTTGCTTTTCTGG - Intronic
1154944271 18:21146321-21146343 TTAAGAAGCATATGCCAAGAAGG - Intergenic
1157756522 18:50222696-50222718 TTAAAAAGCAATTGCTCCTCTGG - Intergenic
1158248540 18:55460070-55460092 TTTAGAAGCATTTGCAGTTATGG + Intronic
1163246883 19:16101581-16101603 TTAAGTAGCATTTATTCCTAAGG + Exonic
1168374561 19:55865714-55865736 TTAATGAGCATTTCTTCATATGG + Intronic
1168533537 19:57149830-57149852 ATAAGAAGCAATTCCTCATCAGG - Intergenic
929632167 2:43474630-43474652 ATAAGAAGGCTTTGCTTATAGGG + Intronic
929875623 2:45794229-45794251 TTAAAAAGCGATTGCTCATGTGG + Intronic
929981156 2:46681619-46681641 TTAAGAAGCACTAGGTCATCTGG + Intergenic
930409385 2:51004664-51004686 TAAACAAACATTTGCTCAAAAGG + Intronic
931979828 2:67682839-67682861 TTAGGAAGCAATTACTTATAAGG - Intergenic
932309024 2:70725004-70725026 TTCAGAAGCATTATCCCATAAGG + Intronic
933106411 2:78332168-78332190 TTAAAAAGTATTTGCTGAGATGG - Intergenic
935080449 2:99787837-99787859 TTAGGAGGCGTTTGCTGATAAGG - Intronic
935157006 2:100492243-100492265 TTAACAAGAATTAGCTCATTTGG - Intergenic
935459361 2:103310565-103310587 TGAAGAATCATTTGCTCAACAGG - Intergenic
936401988 2:112171760-112171782 TTAGGAAGCACTTCCTCCTAAGG + Intronic
936825698 2:116578369-116578391 TTCAGAAGCATTGGCCCATTAGG + Intergenic
937870008 2:126779921-126779943 TAAAGAACCATTTGCTAAGAAGG - Intergenic
938575154 2:132596695-132596717 CTAAGAAGCATTTGGGCAAAGGG - Intronic
939091878 2:137789569-137789591 TTAGGAGGCATTTGCTCCCAGGG - Intergenic
939245239 2:139615045-139615067 TTAAGAAGCTTTTGTTCAAAGGG - Intergenic
939856390 2:147364041-147364063 TTAGGAAGCATTGACTCATAAGG - Intergenic
942575225 2:177356094-177356116 TTCAGAAGTTTTTGCTTATAGGG + Intronic
943821003 2:192320923-192320945 TTAAGTAGTATTTGATTATAAGG - Intergenic
946005575 2:216521846-216521868 TTAAGAAACATTACCTCTTAGGG - Intronic
946015080 2:216597755-216597777 AGAAAAAGCATTTGCTTATAAGG - Intergenic
946061558 2:216946187-216946209 ATCAGATGCATTTGCTCACATGG - Intergenic
946646464 2:221841488-221841510 TTAAATAGCATTTGCTTATTAGG + Intergenic
946656636 2:221955491-221955513 TTTAGAAACATTTTCTAATAAGG - Intergenic
1168948592 20:1781314-1781336 TTGAGAAGCATCTGGTCAGATGG + Intergenic
1169550302 20:6695431-6695453 TTAAGCCTCAGTTGCTCATAAGG - Intergenic
1172928899 20:38567710-38567732 TAAAGTAACATTTGCTGATAAGG - Intronic
1173441403 20:43079924-43079946 TTTAGAAGCATTTTCTTTTAAGG - Intronic
1176904271 21:14480783-14480805 CAAAGCAGCATTTCCTCATAGGG - Intergenic
1178252054 21:31012789-31012811 TTAAGCAGCATTTTTTCATGTGG + Intergenic
1182846732 22:33437570-33437592 TCAGTAAGCATTTGCTCTTATGG + Intronic
1203325390 22_KI270738v1_random:9089-9111 CTACAAAGCATTTGCTCACATGG + Intergenic
949564589 3:5233037-5233059 ATCAGAAGCACCTGCTCATAAGG - Intergenic
952173482 3:30835639-30835661 TTAAGAAGCATTCACTCTTAGGG - Intronic
955301813 3:57787456-57787478 TTATGTAGCATTTGCTTATTGGG + Intronic
955735817 3:62037228-62037250 TAAGGATACATTTGCTCATATGG + Intronic
956302170 3:67783982-67784004 TTAAGTAGCATTGGGTCATGTGG - Intergenic
956413100 3:68998871-68998893 TTAAGAAACATCTGTTCATCAGG + Intronic
956763285 3:72462487-72462509 TTAAGATTCATTTGGTCATACGG + Intergenic
957144494 3:76405871-76405893 TTGAAAATGATTTGCTCATATGG + Intronic
957533743 3:81474238-81474260 TTAAGAACCATATGCCCAAATGG + Intergenic
957788387 3:84909516-84909538 TTAGGTTGCATTTGCTCTTAAGG - Intergenic
957833302 3:85551460-85551482 CTAAGTAGCCTTTGATCATATGG + Intronic
959330911 3:105003393-105003415 TTTAGAAGCAATTGCTAAGATGG - Intergenic
959527024 3:107388776-107388798 TTAATTAGAATTTGCTCACACGG + Intergenic
959549069 3:107633693-107633715 TTAGAAAGAATTTCCTCATACGG + Intronic
962681443 3:137804389-137804411 TTAAGAAGTATATCATCATAAGG - Intergenic
965548419 3:169938709-169938731 TTCATTAGCATTTGCTCCTAAGG - Exonic
966317816 3:178668266-178668288 ATAGGAAGCTTTTGCTCAGAGGG + Intronic
966382646 3:179358909-179358931 TTAGGAAGCAATTGGTTATATGG - Exonic
966478483 3:180377639-180377661 TTATGAAGCAGGTGCTGATAGGG + Intergenic
967674165 3:192276497-192276519 ATGAGAATCATTTTCTCATAAGG - Intronic
969628953 4:8324208-8324230 CCAAGAAGCACTTGCTCATGGGG + Intergenic
970291022 4:14572434-14572456 TTAAGATGCATTTGCACAAGTGG - Intergenic
971120526 4:23699438-23699460 ATAAGATGCATTTGGACATAAGG - Intergenic
972022960 4:34337899-34337921 TTAAGCAGCAATTGCTTATGTGG + Intergenic
973948132 4:55981664-55981686 TTAAGCAGAAGTTTCTCATATGG + Intronic
974371135 4:61017962-61017984 TTCAGAAACATTTGTTCACAGGG + Intergenic
974658527 4:64856448-64856470 TTCAGCAGCATTTCCTTATAGGG - Intergenic
974906248 4:68061318-68061340 GTAAGTTGAATTTGCTCATACGG - Intronic
975444024 4:74442120-74442142 GTTAGGAGCATTTGCTCTTAGGG + Intergenic
975954122 4:79815652-79815674 TTAAGAAGCATTGTCTTAAATGG + Intergenic
977131749 4:93248269-93248291 TTAAGAAGCATTTGCTCATATGG + Intronic
977381137 4:96275032-96275054 TTAAAAAGCATTTTCTTAAAAGG - Intergenic
977498074 4:97802179-97802201 TGAAGAAGAATGTGCTCTTATGG - Intronic
977875663 4:102147076-102147098 TTAAAAAGTATTTGTTAATAAGG - Intergenic
977963778 4:103118318-103118340 ATATGAAGCATCTGTTCATATGG + Intronic
978089447 4:104696462-104696484 TTAATTAGCATTTCATCATATGG + Intergenic
978992126 4:115097379-115097401 TTAAGCATCATTTACTTATATGG - Intronic
979052055 4:115947294-115947316 TTAATAAGGAATTCCTCATAAGG - Intergenic
979501869 4:121449637-121449659 TTCAGAATGATTAGCTCATAGGG + Intergenic
980295362 4:130907738-130907760 GGAAAAAGCATTTGATCATATGG - Intergenic
980490452 4:133519048-133519070 TTGAGAAGCATTAGCTCGAAAGG - Intergenic
981644374 4:146981937-146981959 TTCAGCAGCATTTGCTGATAGGG - Intergenic
981706152 4:147661143-147661165 TTAAGAAATCTTTGCTCATGAGG - Intronic
982344967 4:154347271-154347293 TTAAGAAGCCGTTCCCCATATGG - Intronic
983423225 4:167547425-167547447 ATAAGACACATTTGATCATAGGG + Intergenic
985937341 5:3107027-3107049 TCAAAAAGCAGTTCCTCATAGGG - Intergenic
986995639 5:13604232-13604254 TTATGAAGGATCTGCTGATATGG + Intergenic
987197775 5:15544424-15544446 TTAAGAATCATTATTTCATATGG + Intronic
988020625 5:25615432-25615454 TTCAAAAGCAATTGCACATATGG - Intergenic
988174528 5:27704425-27704447 TTAGGAAGCATTGGGTAATAAGG + Intergenic
989351402 5:40491523-40491545 TTAAGAAGCAATGGCTTCTAAGG - Intergenic
991082094 5:62612725-62612747 TCAAGAAGTATTTGCTTATATGG - Intronic
991273549 5:64815881-64815903 TTAAGAATCCTTTGGTTATAAGG + Intronic
991489781 5:67171359-67171381 TCAATAAGTATTTGCTGATATGG + Intergenic
993873394 5:93277729-93277751 TTAATAAGCATTTACTCTGAGGG - Intergenic
996948463 5:129096776-129096798 TTATGAAGCATTTCCTGTTACGG + Intronic
998624802 5:143834295-143834317 GGATGAAGCATTTGCTTATAAGG - Intergenic
1003287079 6:4743995-4744017 TTAAGATGTAGTTTCTCATAAGG + Intronic
1003802879 6:9691189-9691211 TTTAGAAGCAGATGCTCTTAAGG - Intronic
1004105768 6:12666437-12666459 TTAAGAAGCAATTGCAAAAAAGG + Intergenic
1005142212 6:22646013-22646035 TAAAGAAGCATTTGCACTTCTGG - Intergenic
1008002671 6:46376896-46376918 TTTAAAAGCAGTTGCTCATGTGG + Intronic
1009664575 6:66658632-66658654 TTAAAAAGCATTTACAAATATGG - Intergenic
1013919571 6:115386865-115386887 TTTAGAAGCATATGCTTCTAAGG + Intergenic
1013954863 6:115830155-115830177 CTAAGAAGCTTTTGTTTATATGG - Intergenic
1015371230 6:132455927-132455949 TTAAGAAACATTTCTTTATATGG + Exonic
1017218955 6:151943620-151943642 ATAAGAATGACTTGCTCATAAGG - Intronic
1017272381 6:152523081-152523103 TTTAGTTGCATTTGCTCTTAGGG + Intronic
1018157145 6:160995918-160995940 TTATGCAGCATGTACTCATAAGG - Intronic
1018516562 6:164586096-164586118 TAAAGAAGCATTTTCTCATCTGG - Intergenic
1020396043 7:7719455-7719477 TGAAGAAACATGTGCTCATGAGG - Intronic
1020868558 7:13597590-13597612 TAAATAAGCATTTGCTCTTGTGG - Intergenic
1022881439 7:34592112-34592134 TTAAGAGGCATTTAGTCATGAGG + Intergenic
1024174905 7:46828946-46828968 TTAAGATGCTTTTGCACATCTGG + Intergenic
1025521306 7:61733450-61733472 TCACGAAGCAGTTTCTCATAAGG + Intergenic
1027672096 7:81114023-81114045 TTAAAAAGCATTTATTCAGATGG - Intergenic
1028555249 7:92116579-92116601 TTAAAGACCATTTTCTCATACGG + Intronic
1030535759 7:110764619-110764641 TTTTGAAATATTTGCTCATAAGG + Intronic
1035615225 8:994648-994670 TTAAGATGCATTTACACACAGGG + Intergenic
1038330660 8:26605930-26605952 TTAAGAATCATTTGGTCAAATGG - Intronic
1039496022 8:37980841-37980863 TTAAGAAGAGTTTGCCCAAAGGG + Intergenic
1040963568 8:53061615-53061637 TTTGGAAGCATTTACACATACGG - Intergenic
1040972004 8:53145264-53145286 TAAAGAAATATTTGCTCAAATGG - Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1041908540 8:63061735-63061757 GTAAGAATCACTTGCACATAAGG - Intronic
1042994183 8:74675857-74675879 TTAGGAAGCATGTACTAATAAGG - Intronic
1044060691 8:87631505-87631527 TCAAGAAGTATTTCGTCATAGGG + Intergenic
1046268153 8:111858642-111858664 TTAAGAGGCATTGGACCATAAGG - Intergenic
1046472384 8:114693650-114693672 TTAAGAAGGAATTCCACATATGG + Intergenic
1046940823 8:119929666-119929688 TTTACAAGTATTAGCTCATATGG + Intronic
1047830114 8:128620287-128620309 TCAAGAAACAATTGCTCAGAAGG - Intergenic
1048052485 8:130831213-130831235 GAAAGAAGCATTAGCTCATTTGG - Intronic
1048139688 8:131782122-131782144 TTCAGACACTTTTGCTCATAGGG - Intergenic
1050245973 9:3690201-3690223 GTAAGAATCAATTGGTCATAAGG - Intergenic
1050975752 9:11936173-11936195 TTAAGAAGAATTGGCTCACGTGG + Intergenic
1052282510 9:26748954-26748976 GTAAGAAGAATTGGCTCACATGG - Intergenic
1056772108 9:89485394-89485416 TTAAGAAGCATTTATTGAAAAGG - Intronic
1057435259 9:95034412-95034434 TTAAGTAGCATTTACCCATTTGG - Intronic
1059643632 9:116242098-116242120 TTTAGAACCATGTGCTCATGAGG - Intronic
1060226970 9:121798366-121798388 TTGAGAAGGTTTTGCTCTTAAGG - Intergenic
1203373480 Un_KI270442v1:340302-340324 TTAAGAAGAAGTTTCTCAGAAGG - Intergenic
1186187257 X:7033297-7033319 TTAAGGAGCATTGACTCACATGG - Intergenic
1187309581 X:18128911-18128933 TTCTAAAGCATTTTCTCATATGG - Intergenic
1187408109 X:19022654-19022676 TTAAGAAGCACATGCACACAGGG - Intronic
1189234230 X:39475413-39475435 TTCAGAAGGCTTTGCTCAGAAGG + Intergenic
1189411129 X:40772437-40772459 TTAAGTAGCACTTAGTCATATGG - Intergenic
1189455793 X:41188143-41188165 TTAAGAAACATTTGTTTACAAGG - Intronic
1192036292 X:67566457-67566479 TTAAAATGCAATTTCTCATAAGG - Intronic
1192162635 X:68800006-68800028 TTAAAAAGCCTCTGCTCAGATGG + Intergenic
1193820823 X:86162386-86162408 ATAAGAAACATTTTCTCATCAGG - Intronic
1194336550 X:92654282-92654304 TTATGAAGTATTTGCCCATGTGG - Intergenic
1194349136 X:92803874-92803896 TTAAAAAGCACTTGATCATTGGG - Intergenic
1195621801 X:106963732-106963754 TTCAAAAGCAATTGCACATATGG + Intronic
1195878557 X:109568543-109568565 TTAGGAAGCAGTTGGTTATATGG - Intergenic
1196183909 X:112725104-112725126 CAGAGAAGCATTTACTCATAAGG + Intergenic
1199059124 X:143332288-143332310 TTATGAAGCATGTGGTCACATGG + Intergenic
1200644981 Y:5771030-5771052 TTATGAAGTATTTGCCCATGTGG - Intergenic
1200657461 Y:5920478-5920500 TTAAAAAGCACTTGATCATTGGG - Intergenic
1202250700 Y:22868784-22868806 TTAATAAGCATTTTCACATGTGG + Intergenic
1202403689 Y:24502533-24502555 TTAATAAGCATTTTCACATGTGG + Intergenic
1202467090 Y:25167549-25167571 TTAATAAGCATTTTCACATGTGG - Intergenic