ID: 977132462

View in Genome Browser
Species Human (GRCh38)
Location 4:93258970-93258992
Sequence TGCTGACTAGAGTACCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977132458_977132462 9 Left 977132458 4:93258938-93258960 CCCCAGGTGAGGAATATTAATAA 0: 1
1: 0
2: 1
3: 16
4: 193
Right 977132462 4:93258970-93258992 TGCTGACTAGAGTACCACTGAGG No data
977132459_977132462 8 Left 977132459 4:93258939-93258961 CCCAGGTGAGGAATATTAATAAG 0: 1
1: 0
2: 2
3: 17
4: 301
Right 977132462 4:93258970-93258992 TGCTGACTAGAGTACCACTGAGG No data
977132460_977132462 7 Left 977132460 4:93258940-93258962 CCAGGTGAGGAATATTAATAAGG 0: 1
1: 0
2: 1
3: 13
4: 207
Right 977132462 4:93258970-93258992 TGCTGACTAGAGTACCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977132462 Original CRISPR TGCTGACTAGAGTACCACTG AGG Intronic
No off target data available for this crispr