ID: 977141077

View in Genome Browser
Species Human (GRCh38)
Location 4:93372991-93373013
Sequence TTCCTTTTTAAGCTTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977141070_977141077 9 Left 977141070 4:93372959-93372981 CCTTTGCCCATAACCAACAGTGA 0: 1
1: 1
2: 0
3: 10
4: 139
Right 977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG 0: 1
1: 0
2: 2
3: 38
4: 298
977141072_977141077 2 Left 977141072 4:93372966-93372988 CCATAACCAACAGTGAACCATCA 0: 1
1: 0
2: 0
3: 10
4: 132
Right 977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG 0: 1
1: 0
2: 2
3: 38
4: 298
977141071_977141077 3 Left 977141071 4:93372965-93372987 CCCATAACCAACAGTGAACCATC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG 0: 1
1: 0
2: 2
3: 38
4: 298
977141073_977141077 -4 Left 977141073 4:93372972-93372994 CCAACAGTGAACCATCATGTTCC 0: 1
1: 0
2: 2
3: 11
4: 124
Right 977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG 0: 1
1: 0
2: 2
3: 38
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977141077 Original CRISPR TTCCTTTTTAAGCTTGGTGG TGG Intronic
903123931 1:21235300-21235322 TGCATTTTTAAGCTTGGTTTGGG - Intronic
903258610 1:22119078-22119100 TTCCTTTTTCAGTTTCATGGAGG + Exonic
905836498 1:41127406-41127428 TTCCTTTATAAACTTGGGGTGGG - Intronic
907794558 1:57702281-57702303 TTTCTTTTTTATTTTGGTGGGGG + Intronic
907999308 1:59665230-59665252 TTCTTTGTTAAGCTTTTTGGGGG - Intronic
908481304 1:64542592-64542614 TTCAATTTTAAGATTTGTGGGGG + Intronic
909422752 1:75484756-75484778 ATCCTTTGAAAGCTAGGTGGAGG + Intronic
909490195 1:76217897-76217919 TTTCTTTATCAGCTTGTTGGCGG + Intronic
910623369 1:89280297-89280319 TTCCTTTCTCAACTTGTTGGGGG + Intergenic
911607251 1:99920767-99920789 TTCATTTTTAAGTTGGGTTGTGG - Intronic
912359759 1:109085564-109085586 TTCCTTTCTAAGGTTGTTGGAGG - Intergenic
912373209 1:109189581-109189603 TTCCTTTTCAGGCTGGGAGGTGG + Exonic
912924484 1:113902012-113902034 TGGCTTTTTAAGCTTGATAGAGG - Intronic
913036164 1:114968621-114968643 ATGCTTTTTTAGCTTGGAGGAGG + Intronic
914001610 1:143699379-143699401 TTGCTGTATAATCTTGGTGGTGG - Intergenic
914264112 1:146022907-146022929 TTCTTTTTTAAGGGGGGTGGGGG - Intergenic
915048814 1:153045332-153045354 TTCCTTTTTAACTTTTCTGGAGG - Intergenic
916798604 1:168192196-168192218 TTCAATTTTCAGCCTGGTGGCGG + Intronic
917513935 1:175691419-175691441 CTCCTTTTTAGGCTTGTTGTGGG - Intronic
920568786 1:207000131-207000153 TTCTATCTTATGCTTGGTGGTGG + Intergenic
920836925 1:209519766-209519788 ATCCTTTGGAATCTTGGTGGAGG - Intergenic
921573922 1:216811823-216811845 TTCCATTTTAAGCCTAGTGATGG + Intronic
922817917 1:228464149-228464171 CTCCTTTTGGAGCTTGGAGGTGG + Intergenic
923874637 1:238034479-238034501 TTCCTTTTGCAGCTGGGAGGTGG + Intergenic
1063913611 10:10857430-10857452 TTTGTTTTTAAGCTTTGTTGGGG - Intergenic
1064289635 10:14021694-14021716 TTCATTTTTAATCTGGGTGGTGG + Intronic
1064933619 10:20654979-20655001 TTCCTGGTTAATCTTGGTGGGGG + Intergenic
1065637700 10:27746869-27746891 TATTTCTTTAAGCTTGGTGGGGG - Intergenic
1066127810 10:32358946-32358968 TTCCTCTTTAAGATAGGTAGAGG + Intronic
1067667190 10:48288667-48288689 TTCCTTTTTCAGCTGGGTGCCGG - Intergenic
1068272332 10:54744974-54744996 TTCTTTGTTAAGACTGGTGGGGG - Intronic
1068761575 10:60716814-60716836 TTCCTTTTTAACATTGATGAAGG - Intronic
1069820957 10:71228271-71228293 TTCCTTTTTAAACTTGTGGGTGG + Intronic
1071349943 10:84730390-84730412 TTCCTTATTAGTCTTGGTAGCGG - Intergenic
1071740529 10:88353095-88353117 TTCTTTTTTAGTCTTGGTAGCGG + Intronic
1071763969 10:88641034-88641056 TTCCTTTTTAACCTTTTTGGTGG + Intergenic
1072271089 10:93777637-93777659 TTACTTTTTAAGCTTGCTAATGG + Intronic
1072912336 10:99514530-99514552 TTAATTCTTACGCTTGGTGGTGG - Intergenic
1074592858 10:114830013-114830035 TTCTTTTTTAAGCTTGGATTAGG - Intronic
1075567236 10:123513677-123513699 TTTCTCTCTGAGCTTGGTGGGGG + Intergenic
1075909866 10:126114768-126114790 TTGTTCTTAAAGCTTGGTGGTGG - Intronic
1076011463 10:126992609-126992631 TTGATTTTTAACCTGGGTGGAGG + Intronic
1077924083 11:6663221-6663243 TTCCTTTTCAGTCTTGGAGGAGG - Intergenic
1078123102 11:8530487-8530509 TTCTTTTTTATTCTTGGTGGTGG - Intronic
1078158789 11:8822114-8822136 TTCTTTCTTAAGCTAGGTGGTGG + Intronic
1079204772 11:18404910-18404932 TTCTTTCTTGAGCTGGGTGGTGG - Intronic
1080806750 11:35661096-35661118 TTTCCTTTTAAGCCTGGGGGAGG + Intergenic
1081422683 11:42890040-42890062 TTCCTTTTTAAGATTTTTGTGGG - Intergenic
1083142750 11:60735221-60735243 TTGTTTTTTAAGTTAGGTGGTGG - Intronic
1083331911 11:61902660-61902682 TTCCTTTGGAAGCCGGGTGGGGG - Intronic
1083723773 11:64617963-64617985 TTACTTTTAAAGCTGGGTGCTGG + Intronic
1085227838 11:74938409-74938431 TTCCTTTCTGACCTTGTTGGGGG - Intronic
1085291564 11:75403955-75403977 TTGTTTTTTAAACTTGGTGGAGG + Intronic
1086670900 11:89546433-89546455 TTCCCATTTAAGCTTGTTGCAGG + Intergenic
1087654952 11:100911311-100911333 TTCCATTTTAAGGTAGATGGGGG + Intronic
1087901741 11:103649141-103649163 TTCCTTCTTTCACTTGGTGGTGG - Intergenic
1088269956 11:108023935-108023957 TTTCTTTTCAAACATGGTGGAGG - Intronic
1088346806 11:108835818-108835840 TTCCATTTGAGGCGTGGTGGGGG + Intronic
1088494556 11:110420136-110420158 TTCCTTTTTTAGCATAGTGCGGG - Intergenic
1088782048 11:113145049-113145071 TTCCATATTAAGCTAAGTGGAGG - Intronic
1088817621 11:113432524-113432546 TTCCTTATCAGGCTTGATGGCGG + Intronic
1089121598 11:116139546-116139568 TTCCATGTTAACATTGGTGGCGG + Intergenic
1092370492 12:7913035-7913057 TTGCTTTTTCACCTTGGTGCTGG - Intergenic
1093250871 12:16803543-16803565 TTCCCTTTAATGCTTAGTGGTGG - Intergenic
1093399980 12:18733918-18733940 TTCTTTTTTAAGATTGGTTTTGG + Intronic
1093570711 12:20663166-20663188 ATCCTCTTTAATCTAGGTGGAGG - Intronic
1094466344 12:30757035-30757057 TTCCTTGCTAAGCTTGGAGGTGG - Intergenic
1095790136 12:46157780-46157802 TTCATTTTTAAGCATGGTGTAGG + Intergenic
1096564125 12:52462102-52462124 TTTCTTTTTATGACTGGTGGAGG - Intergenic
1096875672 12:54628567-54628589 ATCCTTTGAAATCTTGGTGGAGG - Intergenic
1097691257 12:62736428-62736450 TTGCTTTCTAACCTTTGTGGTGG - Intronic
1097760494 12:63459246-63459268 TTTCTTTTGCAGCTGGGTGGTGG + Intergenic
1097819729 12:64116347-64116369 TTTTTTCTTAAGCTTGGTGGTGG - Intronic
1098619674 12:72579567-72579589 ATTATTTTTAAGCTTTGTGGTGG + Intronic
1098897710 12:76083241-76083263 TTCCTTTTTAAGATGGGAGGTGG - Intronic
1099014991 12:77333666-77333688 TTCCTTCTTAAGCCTGGTTCTGG + Intergenic
1101208817 12:102515581-102515603 TTCCTTTTTATGCTTCATTGAGG - Intergenic
1101424798 12:104579144-104579166 TTGCTCTTTAAGCTTGGCGAGGG + Intronic
1101464875 12:104938264-104938286 ATATTTTTTAAGCTTGGTGGTGG + Intronic
1102843268 12:116149374-116149396 TTCCTTTCTAGGGTTGTTGGGGG - Intronic
1104114922 12:125740467-125740489 TTCTTTTTTAAGCTTTATTGAGG - Intergenic
1106157743 13:27173076-27173098 TTCCATTATAAGCTTGCTTGGGG + Intergenic
1106750535 13:32760917-32760939 TTCATTCTTTAGCTTGTTGGGGG + Intronic
1107687900 13:42922498-42922520 TTCCTTTTGAAGCTTCCGGGGGG - Intronic
1108334525 13:49426031-49426053 TTCCTCTTAAAGCTTTGTGGGGG + Intronic
1108559852 13:51632187-51632209 TATTTTTTTAATCTTGGTGGAGG + Intronic
1108910655 13:55547123-55547145 TTCCTTTTTGACTTTGCTGGAGG - Intergenic
1109043045 13:57366374-57366396 TTTATTTTTAATGTTGGTGGTGG + Intergenic
1109953671 13:69536574-69536596 TTCCTTTGTAAGCTGGGGAGAGG + Intergenic
1111786481 13:92793630-92793652 TTCCTTATTAATCTTGCTAGTGG - Intronic
1114694819 14:24616836-24616858 TTTCTTTTAAATCTGGGTGGGGG - Intergenic
1115658190 14:35464332-35464354 TTCCTTTATAACCTTGGAGTAGG - Intergenic
1115854005 14:37610623-37610645 CTGCTTTTTAACCTTGGTGATGG - Intronic
1116580427 14:46634176-46634198 TTCTTTATTAAGCTAGGTGGTGG + Intergenic
1117096835 14:52307330-52307352 TTCCTTTCTAAGATTGATAGAGG - Intergenic
1117648329 14:57876226-57876248 TTCCCTTTTCATCTTGGTTGTGG - Intronic
1117729775 14:58710766-58710788 TTCTTGTTTAAGGTGGGTGGAGG + Intergenic
1119244480 14:73092190-73092212 TTTTTTTTTAAGGGTGGTGGGGG + Intronic
1120494519 14:85218513-85218535 TTCCTATAAAAGCTTGGTTGAGG + Intergenic
1121663226 14:95651331-95651353 TTCCTTTCTTAGCTTGCTGTAGG + Intergenic
1202901199 14_GL000194v1_random:40901-40923 TTTCTTTTTATACTTGGTGGAGG + Intergenic
1123939668 15:25210755-25210777 TGCCTCTTTGAGCTTGGTGGGGG + Intergenic
1126393254 15:48181904-48181926 TTCCTTTTTAAGCTTTAAAGAGG - Intergenic
1126595601 15:50381841-50381863 TTACTTTTAAAGCTTAGTGCAGG - Intergenic
1126912275 15:53429553-53429575 ATCCTTTTAAAGCTTGCTGTTGG + Intergenic
1128632200 15:69278858-69278880 TTCCATTTTAAGGTATGTGGAGG + Intergenic
1128643812 15:69360294-69360316 TTCCATTTCAAGGTAGGTGGGGG - Intronic
1128663287 15:69518654-69518676 TTGTTTCTTAAGCTTGGTGGTGG - Intergenic
1128970744 15:72102726-72102748 TTCCTCATTAAGCATGGTGTAGG - Intronic
1130304688 15:82705243-82705265 ATCCTTTTAAAGCCTGCTGGGGG - Intronic
1133458522 16:5965612-5965634 TTTCTTTTGAAGCTTTGTGGAGG - Intergenic
1133970546 16:10564696-10564718 TTCCTTTCTGAGAATGGTGGTGG - Intronic
1134170360 16:11963543-11963565 TTCTTTATTAAGCTGAGTGGTGG - Intronic
1134411485 16:14005897-14005919 TTCATTCTTAAGCTTGGCAGTGG - Intergenic
1135090250 16:19508549-19508571 GTCCTTTTTTATTTTGGTGGGGG - Intronic
1135428844 16:22364492-22364514 TTCTTTTTTAAGCTAGGTGGTGG + Intronic
1137262030 16:46838939-46838961 TTCTTTTTCAAGCTTGTTTGGGG - Intergenic
1137966428 16:52938400-52938422 TTACTGTTCAATCTTGGTGGTGG - Intergenic
1139318431 16:66093178-66093200 TTCTTTGTTCAGCTTGGAGGTGG - Intergenic
1139320641 16:66111157-66111179 ATCCTTTCTAACCTAGGTGGAGG - Intergenic
1140284027 16:73583302-73583324 TTCTTTTTTAAGATTAGTTGTGG - Intergenic
1141343223 16:83222721-83222743 TTCCTTTGTAAACTAGTTGGAGG - Intronic
1143073110 17:4315028-4315050 TTCCTTTTTGAGTTTGGCAGTGG + Intronic
1144433365 17:15216631-15216653 TTCATTTTTTAGTTTGTTGGAGG - Intergenic
1144660213 17:17063222-17063244 TTACCTTTTCAGCTGGGTGGGGG + Intronic
1145098875 17:20056619-20056641 TTCCATTTTAAGCTTAGGTGAGG - Intronic
1146477127 17:33172063-33172085 TTCAGTTTCAAACTTGGTGGAGG - Intronic
1149132831 17:53327256-53327278 TTCCTGTTTTAGCTTGGTGCTGG + Intergenic
1149796908 17:59529176-59529198 TGCCTGTTTTACCTTGGTGGAGG + Intergenic
1149921409 17:60663322-60663344 GTCCTTTTAAAGTTTGTTGGAGG - Exonic
1149944080 17:60902201-60902223 TTCTTTTATAATCTTTGTGGAGG + Intronic
1149969080 17:61198006-61198028 TTAGATTTTAAGCTTGTTGGGGG + Intronic
1150169151 17:62973646-62973668 TTCTTTTTTATGTTTGCTGGTGG + Intergenic
1151201135 17:72468781-72468803 TTCCTTTCTGATCTGGGTGGAGG - Intergenic
1151234377 17:72708328-72708350 TTCCTTTTCCTACTTGGTGGTGG - Intronic
1151523770 17:74649569-74649591 CTCTTTCTTAAGCTGGGTGGGGG - Intergenic
1151757735 17:76084144-76084166 TTCCTTTTTCACCTTTTTGGTGG - Intronic
1153557042 18:6325683-6325705 TTCATTCTTAAGCTGGATGGTGG + Intronic
1153761832 18:8339209-8339231 TTCCCTTTGGGGCTTGGTGGTGG + Intronic
1154956361 18:21259862-21259884 TTCCTTTTTTTTCATGGTGGGGG + Intronic
1155486275 18:26346252-26346274 TTCTTTTTTCTGCTTGGTGTAGG - Intronic
1155537951 18:26836958-26836980 TTCCTTTGTAAGCTTGATTGAGG + Intergenic
1155545517 18:26910378-26910400 TTCCTTTGGAAGCTTGGCGGGGG + Exonic
1155896151 18:31329465-31329487 TGCCTTTTTAAAGTTTGTGGGGG - Intronic
1156057920 18:33033173-33033195 TTCCTTTTGTAGGTTGTTGGAGG - Intronic
1156705595 18:39877758-39877780 TTTCTTTTTTAGCTTGTAGGAGG - Intergenic
1156993454 18:43438506-43438528 TTTCTTTTTACTCATGGTGGTGG + Intergenic
1157699716 18:49753535-49753557 TTACTTTATAAGCTGGGTGATGG - Intergenic
1158617268 18:58999836-58999858 TTACTTTTTAAGCTGGGTGGTGG + Intergenic
1159299625 18:66546166-66546188 TTCCTTTAGAAGCATGGAGGAGG + Intronic
1163164081 19:15483449-15483471 TTCCCTTTAAAGCTTGGAGTTGG + Intronic
1164692377 19:30221073-30221095 TTTGTTTTTCAACTTGGTGGTGG - Intergenic
1164937013 19:32223013-32223035 TTCCTTTCCCAGCTTGGGGGAGG - Intergenic
1166535157 19:43568964-43568986 TTTTTTTTTAAGCTTTTTGGAGG - Intronic
1166778469 19:45326730-45326752 TTTCTATTTAAGCTGGGTAGTGG - Intergenic
1167658738 19:50783338-50783360 TTTTTTTTTAAGCCTGGAGGGGG + Intergenic
925433725 2:3818621-3818643 ATCCTTTTAAAGCTTGCTGTGGG + Intronic
926445428 2:12935957-12935979 TCCCTTTTTCAGCTTGGTCAGGG + Intergenic
926844306 2:17117944-17117966 TTCATTTTTAAGAATGTTGGTGG - Intergenic
929938023 2:46308947-46308969 TTGCTTTTGAAGGTTGGGGGTGG + Intronic
930102609 2:47614913-47614935 TTTTTTTTCAAGTTTGGTGGTGG - Intergenic
931168662 2:59778815-59778837 ATCTTTTTTAAGGTTAGTGGTGG + Intergenic
931541445 2:63333970-63333992 TTCTTTTTCAAGATTGTTGGGGG + Intronic
932922356 2:75931147-75931169 TTCCTTCCTAAGCTGGGTTGGGG + Intergenic
934876146 2:97922802-97922824 TTAGTTTTTAATCTGGGTGGTGG + Intronic
935239519 2:101166308-101166330 TTTCTTTTTAATGATGGTGGGGG + Intronic
935830495 2:106996739-106996761 TTCTTTTTGAGGCTTGGGGGAGG - Intergenic
936650971 2:114425578-114425600 TTCCCTTTTCAGCTAGGTGTGGG - Intergenic
938459182 2:131486610-131486632 TTTTTTTTTAAGAGTGGTGGGGG + Intronic
938598317 2:132811692-132811714 TTTCTTTCTCAGCTGGGTGGTGG - Intronic
940246040 2:151617201-151617223 TTCAATTTTGAGCTTTGTGGTGG - Intronic
940700127 2:157030183-157030205 TTACTTGTAAAGCTTGGTGCTGG - Intergenic
942028556 2:171935546-171935568 TTCATTTTAAGTCTTGGTGGGGG + Intronic
942327127 2:174785417-174785439 TTTCTTCTTAACCTGGGTGGTGG + Intergenic
942686081 2:178533425-178533447 TCCCATTTTAATGTTGGTGGGGG + Exonic
943776473 2:191772258-191772280 TTTCTTTTTTAGTGTGGTGGTGG + Intergenic
944733674 2:202540572-202540594 ATCTTTTTTAATATTGGTGGAGG + Intronic
945437050 2:209831043-209831065 TTCATTTTCAAGCTTTCTGGTGG - Intronic
945627183 2:212224690-212224712 TGCCTTTTTAAGCTACGTGTTGG - Intronic
946544140 2:220717924-220717946 TTTCTTTTTAAGCTAGATGCTGG - Intergenic
946831918 2:223736218-223736240 TTTCTTTTTAAGTTTGTTGTGGG - Intergenic
947354023 2:229273401-229273423 TTCCTGTTTTAGCTTCCTGGGGG - Intergenic
947716534 2:232342033-232342055 TTGTTTTTTAAGGTTGTTGGGGG + Intronic
947801849 2:232933638-232933660 TGCATTTGTGAGCTTGGTGGTGG + Intronic
1169228026 20:3868195-3868217 GGGCTTTTTAAGATTGGTGGTGG - Exonic
1169316514 20:4595437-4595459 TACATTTTTAAGCTTGATGGTGG - Intergenic
1170477104 20:16726353-16726375 TTCTTTTTTAAGAATGGTTGGGG - Intergenic
1171893182 20:30735690-30735712 TTTCTTTTTATACTTGGTGGAGG - Intergenic
1174013312 20:47468180-47468202 AGCCTTTTTAAATTTGGTGGGGG + Intergenic
1174861081 20:54091534-54091556 TTCCATTTTCATCTTGGTTGTGG - Intergenic
1175610966 20:60351100-60351122 TTTCTTTTTATGCTTGGAGCAGG + Intergenic
1176620574 21:9055679-9055701 TTTCTTTTTATACTTGGTGGAGG + Intergenic
1177025194 21:15914137-15914159 TTCCTTATTAATCTTGCTAGTGG + Intergenic
1177031038 21:15982506-15982528 ATCCTTTTAAAGCATGGTGTGGG + Intergenic
1177119703 21:17124490-17124512 ATCCTTTTAAAGCTTGCTGTGGG - Intergenic
1177238920 21:18430471-18430493 TTCATTCTTTATCTTGGTGGTGG + Intronic
1177895577 21:26853001-26853023 TTCACTATGAAGCTTGGTGGTGG + Intergenic
1181873047 22:25917524-25917546 TTCATTTTAAAGCTTTGTAGGGG + Intronic
1182282050 22:29223549-29223571 TTTCTTTTTTTGGTTGGTGGAGG - Intronic
1183500648 22:38176721-38176743 TTTCTTTGTGAGCTTGGAGGTGG - Intronic
1183874722 22:40769945-40769967 TCCCTTTATAAACTTGGTGTAGG - Exonic
1184395513 22:44234115-44234137 TTCATTTTTGTGCTTGCTGGAGG + Intergenic
950849190 3:16045725-16045747 GTCCTTTTTAAGCATGCTGCTGG - Intergenic
951026075 3:17831758-17831780 CTACTTCTTAAGCTGGGTGGGGG - Intronic
952576180 3:34776563-34776585 TTCCTCTTTATGCTTAGTGAGGG + Intergenic
954482915 3:50818136-50818158 TTCTCTTTTCAGATTGGTGGTGG + Intronic
955992985 3:64648250-64648272 TTCTTTCCTTAGCTTGGTGGTGG - Intronic
956218763 3:66879434-66879456 TTCCTTTGTAATCTTTGTTGAGG + Intergenic
958469825 3:94503048-94503070 TTCCTTTGAAATCTAGGTGGAGG + Intergenic
958528386 3:95291961-95291983 ATCCTTTGAAAACTTGGTGGGGG - Intergenic
960375802 3:116900105-116900127 TGCCTTTTTAAGGTTGTTAGAGG + Intronic
961489382 3:127242797-127242819 TTCCTTTTTAAGTTTAGTTTAGG - Intergenic
962216319 3:133525047-133525069 TTTCTTTTTAAGATGGTTGGGGG + Intergenic
963572815 3:147019020-147019042 TTTGTTTTTAAGCTTTGTTGTGG + Intergenic
963807780 3:149743092-149743114 TTATTTGTTAAGCTTGGTGGTGG + Intronic
963834577 3:150044537-150044559 TTCTTTTTCAGGCTTGCTGGAGG - Intronic
965893933 3:173550397-173550419 TTCTTTGTGAAGATTGGTGGAGG - Intronic
967466116 3:189807899-189807921 TTCCATTTTGAGGTTGTTGGTGG - Intronic
967621812 3:191642738-191642760 TTCCTTCTTTAGGCTGGTGGCGG - Intergenic
971087598 4:23296925-23296947 ATCCTTTTGAAACTTGGGGGTGG + Intergenic
971321701 4:25611103-25611125 TTATTTTTGAAACTTGGTGGTGG + Intergenic
972452128 4:39212022-39212044 TTCTTTTTTAAGATTGCTGTTGG - Intronic
972564624 4:40258811-40258833 TTCTTTCTGAAGCTTGGGGGTGG + Intergenic
972844036 4:42965999-42966021 TTCATTTTTTAGTTTGGTTGGGG - Intronic
973156207 4:46956303-46956325 TTCATTTTTAAACTTGGTTTTGG - Intronic
973993391 4:56434273-56434295 TTCTAATTTAAGTTTGGTGGAGG + Intronic
974299825 4:60048946-60048968 TTCTTTTTTAGTCTTGCTGGCGG + Intergenic
974720164 4:65727845-65727867 TTCCTTATTAATCTTGCTAGTGG - Intergenic
975241716 4:72067085-72067107 GTCCTTTGAAATCTTGGTGGAGG + Intronic
976175565 4:82348150-82348172 TTCCTTTTTTTTTTTGGTGGGGG - Intergenic
976959940 4:90957923-90957945 TGCCTTTTCAAGCTTGCTGCAGG - Intronic
977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG + Intronic
977363603 4:96037882-96037904 TTCCCATTCAAGCTTTGTGGTGG + Intergenic
981575613 4:146201713-146201735 TTCCATTTTATTCTTGGTGTGGG + Intergenic
982032216 4:151312184-151312206 CCCCTTTTTCAGCTTTGTGGAGG - Intronic
982217748 4:153096835-153096857 TTACGTCTTAAGCTGGGTGGTGG - Intergenic
982671881 4:158330526-158330548 TTCATTTTTTATCTTGGTGCTGG + Intronic
984275824 4:177607681-177607703 TTACTTTTCAAGCTTGGTAAGGG - Intergenic
985168658 4:187124901-187124923 TTCTTTTTTAAGCTTTATTGAGG + Intergenic
986084861 5:4434014-4434036 ATCCTTTGAAATCTTGGTGGAGG + Intergenic
988095421 5:26602411-26602433 TTCCTTTGTATGCCTTGTGGTGG + Intergenic
988126645 5:27047728-27047750 TTTCTTTTTAAATTTGGTGGAGG - Intronic
988194236 5:27980755-27980777 TTCCTTTTTAAGGCTGGCGGGGG + Intergenic
988208652 5:28173654-28173676 TTACTTTTTATTGTTGGTGGAGG + Intergenic
988269374 5:28994267-28994289 TTCTTTTTTAGTCTTGGTAGCGG - Intergenic
991329894 5:65482732-65482754 TTCCTTTTTTTTTTTGGTGGTGG - Intergenic
991936400 5:71805899-71805921 TTATTTTTTAAGTTGGGTGGTGG - Intergenic
991944169 5:71883568-71883590 TTGCATTTTAAGGTTGGAGGCGG + Intergenic
992884458 5:81144246-81144268 TGCTTTTATATGCTTGGTGGTGG + Intronic
995810255 5:116098805-116098827 TTCTTTTTTAAGCTTTATCGAGG + Intronic
996172956 5:120318388-120318410 TTCCTTTTTCAGCTTTATTGAGG + Intergenic
998195369 5:140064931-140064953 TTCCTTTTTAACCTCTGTGTAGG + Intergenic
998856946 5:146403047-146403069 TTCCTTTTTAAGCTTCATGTTGG - Intergenic
1001424691 5:171615575-171615597 TTCCTTTGAAATATTGGTGGTGG - Intergenic
1002810280 6:621557-621579 TTCCTTTTTTGACTGGGTGGGGG + Intronic
1004102228 6:12625353-12625375 TTCTTTTTTAAGCTTTATTGAGG - Intergenic
1004272363 6:14206954-14206976 TTATTTTTCAAGCTTGGTGGCGG - Intergenic
1004962006 6:20800621-20800643 TTCTTTTTTGAGGGTGGTGGGGG + Intronic
1005731886 6:28705629-28705651 TTGCTTGATAAGTTTGGTGGGGG - Intergenic
1005902849 6:30233361-30233383 TTCCTTTCTAACTTTGGAGGAGG + Intergenic
1008111660 6:47501616-47501638 TTCCTTTTTTTTTTTGGTGGTGG + Intronic
1009955080 6:70444012-70444034 TTCCATTTTAAGAGTTGTGGTGG - Intronic
1010452446 6:76018086-76018108 TCCCTTTTTATCCTTGGTGGAGG + Intronic
1012304408 6:97633923-97633945 TTCCTTTTTAACCTTGATATGGG - Intergenic
1015647751 6:135413356-135413378 TTCCTTTTTAATTTTTGTTGTGG - Intronic
1017239258 6:152148577-152148599 TTCCTGTTTAAGCTTGGATAAGG + Intronic
1017258043 6:152356749-152356771 TTCTTTTTTAACCTTTGTGGTGG + Intronic
1018316299 6:162559660-162559682 TATCTGTTTAAGCTTTGTGGTGG - Intronic
1020648839 7:10850301-10850323 TTCCTCTTTAATCTTTGTGTAGG + Intergenic
1022124403 7:27341637-27341659 TTTCTTTTTCAGGGTGGTGGTGG + Intergenic
1022483880 7:30762931-30762953 ACCCCTTTTAAGCTGGGTGGTGG + Intronic
1023317073 7:38949853-38949875 TTCCTCCTTAAACTTGGTGGTGG - Intergenic
1023326276 7:39060939-39060961 TTTTTTTTTAAGCTTAGTGATGG - Intronic
1023430759 7:40088577-40088599 TTCCTTTTTACTCTTAGTGCAGG + Intronic
1024033633 7:45486929-45486951 GTCCTTTTTATTGTTGGTGGTGG - Intergenic
1026415958 7:70180941-70180963 TTGCTTTTCAAGCTGGGTGGTGG - Intronic
1028425376 7:90681368-90681390 TTCCATTACAGGCTTGGTGGAGG + Intronic
1028990061 7:97039667-97039689 TTCCTTTTGCAGGTGGGTGGGGG - Intergenic
1029051034 7:97687825-97687847 TGGCTTTTTAAGCATGGTGACGG - Intergenic
1029619510 7:101681113-101681135 TTTCTTTTTAATTTTGGGGGTGG - Intergenic
1030555818 7:111022342-111022364 TTCCTTTGTTAGATTGATGGGGG - Intronic
1032287545 7:130552751-130552773 TTTCTTTTTATGCTTGGGGCTGG - Intronic
1033369101 7:140693225-140693247 TTCATTCTGAAGCTGGGTGGGGG - Intronic
1033464910 7:141581541-141581563 ATCCTTTTAAAGCTTGCTGTGGG + Intronic
1035662957 8:1361043-1361065 TTTCCTTTTAAGCTTTGTGTGGG + Intergenic
1037183950 8:16039271-16039293 TTCTTATTTAAGCTTTGTTGGGG - Intergenic
1037256705 8:16963751-16963773 TTCCTTTTTAAGCTAAGAAGGGG - Intergenic
1038039644 8:23714033-23714055 TTCCTTTTTAACCTCAGTGTAGG - Intergenic
1038390294 8:27192024-27192046 ATCCTTTTCTAACTTGGTGGTGG - Intergenic
1038574578 8:28693988-28694010 TTCCCTTTGAAGATTGCTGGGGG + Intronic
1038685453 8:29713118-29713140 TTGCTTTATAAGCTTTGTAGTGG - Intergenic
1038848343 8:31250561-31250583 GTCCTTCTTAAGATGGGTGGAGG + Intergenic
1038889770 8:31707113-31707135 TTCCTTTATAATCTTGGAAGGGG - Intronic
1039496274 8:37982991-37983013 TTCGGTTTTCAGCTTGGAGGAGG + Intergenic
1040530074 8:48260048-48260070 TTCTTTCTTAAACTGGGTGGAGG + Intergenic
1040627120 8:49161634-49161656 TTCCTTTTTTAGCTGGTTGTGGG + Intergenic
1041968011 8:63702997-63703019 TTGCTTTTTGAGGTTGGGGGAGG - Intergenic
1044156284 8:88851595-88851617 TTCATTTAGAAGTTTGGTGGTGG + Intergenic
1044258485 8:90092928-90092950 ATCCTTTTAAAGCTTGCTGTGGG + Intronic
1044334041 8:90955475-90955497 TTCTCTTTTCAGCTTCGTGGTGG + Exonic
1044654642 8:94534850-94534872 TTCCTTTTCAAACTTGGTTGTGG + Exonic
1046146575 8:110168992-110169014 ATCATTTCTAAACTTGGTGGAGG + Intergenic
1046355343 8:113077044-113077066 TTCTGTTTTGAGCATGGTGGTGG + Intronic
1049317390 8:141976590-141976612 TTCCATTCTAAAGTTGGTGGTGG - Intergenic
1050226936 9:3469883-3469905 TTCCTTTTTAAGGCTGGTTTAGG - Intronic
1051499243 9:17759058-17759080 TTCCCTTTTAAGCTCTGTGTAGG - Intronic
1054355456 9:64057031-64057053 TTTCTTTTTATACTTGCTGGAGG + Intergenic
1054911917 9:70462837-70462859 TTACCTGTTAAGCTTGGTGAGGG - Intergenic
1055000225 9:71440555-71440577 TGCCTCTTTAAGTGTGGTGGTGG - Intronic
1057362818 9:94390523-94390545 TTCATTTTTAATCTTATTGGGGG + Intronic
1057660520 9:96997570-96997592 TTCATTTTTAATCTTATTGGGGG - Intronic
1203743786 Un_GL000218v1:26128-26150 TTTCTTTTTATACCTGGTGGAGG + Intergenic
1203566326 Un_KI270744v1:93407-93429 TTTCTTTTTATACTTGGTGGAGG - Intergenic
1185858297 X:3555847-3555869 ATCCTTTTAAAGCATGGTGTGGG + Intergenic
1187094738 X:16135620-16135642 TTCTTTTTTCCGTTTGGTGGTGG + Intronic
1187692573 X:21884658-21884680 TTTCTTCTTTAGCTTGGTTGTGG + Exonic
1189566296 X:42244911-42244933 TTCCTTTTTTGGCTTTGTGTGGG + Intergenic
1189611504 X:42741254-42741276 TCACTCTTCAAGCTTGGTGGAGG - Intergenic
1190825993 X:54018524-54018546 TTTCTTTTAAATCATGGTGGAGG + Intronic
1191084882 X:56554894-56554916 TTCCTATTTAAGCTTTGAGAAGG + Intergenic
1192496221 X:71618049-71618071 TTCCTTCTCAAGCTAAGTGGGGG - Intronic
1193101798 X:77622695-77622717 TTTCTTTTGCAGCTTGGAGGTGG + Intronic
1193324146 X:80159716-80159738 TTCTTTATTAATCTTGGTAGTGG - Intergenic
1194689866 X:96970634-96970656 TTCTTTTTTAATCTAGGTAGCGG + Intronic
1194896772 X:99451957-99451979 TTCCTTTTTAAACATGTTTGTGG + Intergenic
1195095391 X:101496657-101496679 TTCCTTTATAAGGTTGGTTAAGG + Intronic
1195777326 X:108421859-108421881 TTACTTCTTAAGCTGGGTGATGG + Intronic
1196775105 X:119331554-119331576 TTCCCTTTTACCCTTGGTGTAGG - Intergenic
1198910103 X:141604044-141604066 TTCCTTTTTAATCATAGAGGTGG + Intronic
1199797919 X:151219777-151219799 TTTCTTTTTAACCTTGGTGTAGG - Intergenic
1200214430 X:154361305-154361327 TACCTTGCTAGGCTTGGTGGGGG + Exonic
1200692428 Y:6320103-6320125 TTCTGTTTCAAGCTTTGTGGAGG + Intergenic
1201042844 Y:9854624-9854646 TTCTGTTTCAAGCTTTGTGGAGG - Intergenic
1201157111 Y:11141109-11141131 TTTCTTTTTATACCTGGTGGAGG + Intergenic
1201246607 Y:12010271-12010293 TTCCTTTTTAGTCTTGCTAGTGG + Intergenic
1202163029 Y:21955282-21955304 TTCTGTTTCAAGCTTTGTGGAGG + Intergenic
1202228327 Y:22631086-22631108 TTCTGTTTCAAGCTTTGTGGAGG - Intergenic
1202314830 Y:23565090-23565112 TTCTGTTTCAAGCTTTGTGGAGG + Intergenic
1202555971 Y:26105503-26105525 TTCTGTTTCAAGCTTTGTGGAGG - Intergenic