ID: 977143901

View in Genome Browser
Species Human (GRCh38)
Location 4:93411458-93411480
Sequence ACTCTATCACTCTGTCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 7, 3: 80, 4: 767}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977143901 Original CRISPR ACTCTATCACTCTGTCACAT AGG Intronic
900677027 1:3893868-3893890 ACTGTCTCACTCTGTCACCCAGG - Intronic
901623437 1:10607991-10608013 ACTGTCTCACTCTGTCACCCAGG + Intronic
901911390 1:12461278-12461300 ACCCTATCACTCCCTCAAATAGG + Intronic
902066725 1:13694502-13694524 ACTCTGTCATTCTGTCACCCAGG - Intergenic
902567955 1:17326934-17326956 ACCCTCTCACTCTGTCACCCAGG + Intronic
902867787 1:19291548-19291570 ACAGTCTCACTCTGTCACACAGG + Intergenic
902981104 1:20123848-20123870 ACGGTCTCACTCTGTCACCTAGG - Intergenic
903359756 1:22769430-22769452 TCTCATTCACTCTGTCACCTAGG + Intronic
903567828 1:24282303-24282325 ACAGTCTCACTCTGTCACCTGGG + Intergenic
903622911 1:24711017-24711039 AGACTCTCACTCTGTCACCTAGG + Intergenic
903710327 1:25318560-25318582 ACAGTCTCACTCTGTCACCTAGG - Intronic
903716782 1:25373854-25373876 ACAGTCTCACTCTGTCACCTAGG + Intronic
903763886 1:25719807-25719829 ACAGTTTCACTCTGTCACCTAGG + Intronic
903913087 1:26742942-26742964 ACAGTCTCGCTCTGTCACATAGG - Intronic
904106912 1:28092454-28092476 AGTCTCTCACTCTGTCACCCAGG - Intergenic
904175249 1:28623183-28623205 AGTGTCTCACTCTGTCACCTAGG - Intronic
904525760 1:31132629-31132651 AGTCTCTCACTCTGTCACCCAGG - Intergenic
905079127 1:35301518-35301540 ACCCTCTCACTCTGTCACCCAGG - Intronic
905131989 1:35768431-35768453 AGTGTCTCACTCTGTCACCTAGG + Intronic
906988588 1:50713297-50713319 AGTCTCTCACTCTGTCACCCAGG + Intronic
907381562 1:54095117-54095139 ACTGTCTCACTCTGTCACCTGGG - Intronic
907466211 1:54639167-54639189 ACAGTATCACTCTGTCACCCAGG - Exonic
907937622 1:59057010-59057032 ACTTTCTCTCTCTGTCCCATTGG + Intergenic
908456971 1:64313486-64313508 ACTATATTACTCTATCTCATGGG + Intergenic
908551890 1:65216718-65216740 ACTATCTCACTCTGTCACCCAGG + Intronic
908613898 1:65895522-65895544 AGTGTCTCACTCTGTCACACAGG - Intronic
908927639 1:69275455-69275477 ACTCTCTTACTCTTTCTCATGGG - Intergenic
909098758 1:71323480-71323502 GCTCTCTCACTCTGTCACCCAGG - Intergenic
909890603 1:81001548-81001570 ACCCTATCACTCTGTCACTCAGG - Intergenic
910963888 1:92788446-92788468 AGTCTCTCACTCTGTCACCTAGG - Intronic
910970364 1:92849994-92850016 ACTCACTCACTCTGTCACCCAGG + Intronic
910974258 1:92889671-92889693 AGGGTATCACTCTGTCACACAGG + Intronic
911584738 1:99678132-99678154 ACTGTCTCACTCTGTCACCCAGG + Intronic
911650817 1:100386139-100386161 ACTATCTCACTCTGTCACCCAGG - Intronic
911778257 1:101842519-101842541 ACAGTCTCACTCTGTCACCTAGG - Intronic
911813222 1:102310709-102310731 AGTGTATCACTCTGTCACACAGG - Intergenic
912059841 1:105653767-105653789 AGTCTCTCACTCTGTCACCCAGG - Intergenic
912206373 1:107513570-107513592 ACTCTGTCACTCTGTCACCCAGG - Intergenic
912375181 1:109203947-109203969 AGGCTCTCACTCTGTCACCTAGG + Intronic
912563673 1:110569203-110569225 TCTTTCTCACTCTGTCACCTAGG + Intergenic
912809157 1:112780726-112780748 GCTCTGTCACTCTGTCACTCAGG - Intergenic
914727881 1:150343214-150343236 TCTCTCTCACTCTGTCACCCAGG - Intronic
914749246 1:150522219-150522241 ACAGTCTCACTCTGTCACCTAGG - Intergenic
914846201 1:151284833-151284855 ACGGTATCACTCTGTCACCCAGG + Intronic
914951769 1:152121870-152121892 ACTTTATCACTCTTTCGCAAAGG + Intergenic
915188015 1:154123850-154123872 ACAGTCTCACTCTGTCACCTAGG - Intronic
915474094 1:156142607-156142629 ACAGTCTCACTCTGTCACCTAGG + Intergenic
916336376 1:163675583-163675605 ACTCTGGCACTCTGTAACCTTGG - Intergenic
916657267 1:166887312-166887334 CATCTATCAGCCTGTCACATAGG - Intergenic
916754508 1:167756172-167756194 ACAGTCTCACTCTGTCACACAGG + Intronic
916949190 1:169761616-169761638 AGTCTGTCACTCTGTCACCCAGG + Intronic
917556360 1:176093810-176093832 AGTCTCTCGCTCTGTCACCTAGG - Intronic
918787983 1:188789248-188789270 CCTCTCTCACTCTGTCACCCAGG - Intergenic
918932558 1:190873541-190873563 ACTCTGTCACTCTGTCACCTAGG - Intergenic
919102554 1:193112386-193112408 ACTGTCTCACTCTGTCACCCAGG + Intergenic
919167030 1:193908350-193908372 AGTCTCTCATTCTGTCACCTAGG + Intergenic
919317650 1:195994675-195994697 AATCTATCTCTATGTTACATTGG - Intergenic
920443574 1:205998530-205998552 ACTGTATCTCTCTGCCACTTTGG - Intronic
920975825 1:210784199-210784221 ACTTAATAACTCTCTCACATGGG + Intronic
921125334 1:212172784-212172806 ACTGTCTCACTCTGTCACCCAGG + Intergenic
921131074 1:212220535-212220557 GCTCTATCACTGTGTAACCTTGG + Intergenic
921231652 1:213079442-213079464 AGAGTATCACTCTGTCACCTAGG + Intronic
922142356 1:222901551-222901573 TCTCACTCACTCTGTCACCTGGG + Intronic
922312924 1:224413161-224413183 ACTATCTCACTCTGTCACCCAGG - Intronic
923145467 1:231194706-231194728 ACAGTCTCACTCTGTCACCTAGG + Intronic
923452362 1:234130613-234130635 TCTCTCTCTCTCTGTCACCTGGG - Intronic
923516117 1:234699232-234699254 TCTCACTCACTCTGTCACTTAGG - Intergenic
923609901 1:235481363-235481385 ACAGTCTCACTCTGTCACCTAGG + Intronic
923697441 1:236267503-236267525 ACTCTTTCACTCCTTCACTTTGG - Intronic
924472882 1:244358557-244358579 ACACTCTCACTCTATCACTTAGG - Intronic
924505518 1:244679839-244679861 AGTCTCTCACTCTGTCACCCAGG - Intronic
924531437 1:244897227-244897249 AGTGTCTCACTCTGTCACCTAGG + Intergenic
924661798 1:246026114-246026136 TCTCACTCACTCTGTCACATGGG - Intronic
1063279624 10:4612867-4612889 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1063679849 10:8176592-8176614 ACTCTTGCACTCTGTGTCATAGG + Intergenic
1064078579 10:12289693-12289715 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1064479968 10:15729887-15729909 ACTCTGTCACTCTATCGCCTAGG + Intergenic
1065026104 10:21540515-21540537 AGTCTCTCACTCTGTCACCCAGG - Intronic
1065224261 10:23526876-23526898 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1065702669 10:28440851-28440873 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1065776191 10:29122416-29122438 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1066343861 10:34562784-34562806 AGTGTCTCACTCTGTCACCTGGG + Intronic
1066397413 10:35039827-35039849 AGTGTCTCACTCTGTCACACAGG - Intronic
1066506458 10:36049688-36049710 ACTCTTTGACATTGTCACATGGG - Intergenic
1066550069 10:36546138-36546160 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1067311011 10:45113673-45113695 GCAGTATCACTCTGTCACATAGG + Intergenic
1067760343 10:49040306-49040328 ACAGTCTCACTCTGTCACCTAGG + Intronic
1068256076 10:54513284-54513306 ACAGTCTCACTCTGTCACCTGGG + Intronic
1068305917 10:55207941-55207963 AGACTGTCACTCTGTCACCTAGG - Intronic
1068672816 10:59741406-59741428 AGTATCTCACTCTGTCACCTAGG + Intergenic
1068914945 10:62420806-62420828 GCTCTGTCACTCTGTCACCTGGG + Intronic
1068998054 10:63230747-63230769 ACAGTCTCACTCTGTCACCTAGG - Intronic
1069133834 10:64739584-64739606 GTTCAATCACTCTTTCACATAGG - Intergenic
1069237558 10:66096546-66096568 AGTCTCTCACTCTGTCACCCAGG + Intronic
1069326843 10:67241395-67241417 ACAGTCTCACTCTGTCACCTAGG - Intronic
1069547845 10:69341488-69341510 ACAGTCTCACTCTGTCACTTAGG + Intronic
1070274303 10:74990167-74990189 AGTCTCTCACTCTGTCACCCAGG - Intronic
1070471565 10:76785522-76785544 ACTCTCTGACTCTGTGACCTTGG + Intergenic
1070810628 10:79296083-79296105 ACTGTGTTCCTCTGTCACATTGG + Intronic
1072699104 10:97627167-97627189 ACACTCTCACTCTGTCACCCAGG + Intronic
1072762604 10:98069393-98069415 ACTCTCTGACTCTGTCATGTAGG - Intergenic
1072837174 10:98727628-98727650 AGTGTCTCACTCTGTCACCTAGG - Intronic
1073021731 10:100450647-100450669 AATGTCTCACTCTGTCACCTAGG + Intergenic
1073078462 10:100839760-100839782 TCTCACTCACTCTGTCACCTAGG - Intergenic
1073390054 10:103167655-103167677 ACAGTCTCACTCTGTCACCTAGG + Intronic
1073826015 10:107322409-107322431 TCTCTCTCATTCTGTCTCATCGG - Intergenic
1074563445 10:114554668-114554690 AGTCTGTCACTCTGTCACCCAGG - Intronic
1074573149 10:114643601-114643623 AGTGTCTCACTCTGTCACACAGG + Intronic
1074724581 10:116295434-116295456 AGTCTCTCACTCTGTCACCCGGG + Intergenic
1074939196 10:118218287-118218309 ACAGTCTCACTCTGTCACTTAGG + Intergenic
1075152879 10:119950575-119950597 ACTCTCTCTCTCTCTCTCATTGG - Intergenic
1075378737 10:122000846-122000868 ACTCTGTCACTGTGTCACCCAGG + Intronic
1075688958 10:124382809-124382831 CCTCACTCACTCTGTCACTTAGG - Intergenic
1075765343 10:124888305-124888327 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1076528906 10:131131314-131131336 ACTTTATAACTCTTTCAAATGGG - Intronic
1076742150 10:132491421-132491443 AGTGTCTCACTCTGTCACTTGGG + Intergenic
1076863299 10:133153111-133153133 ACTCACTCACTGTGTCACTTAGG - Intergenic
1078261091 11:9709548-9709570 AATCTCTCACTTTGTCACCTAGG + Intronic
1078269935 11:9785824-9785846 AGTGTCTCACTCTGTCACCTAGG - Intronic
1078271032 11:9794637-9794659 ACTGTATCACTCTGTCTCCAAGG - Intronic
1078351183 11:10594948-10594970 ACAGTCTCACTCTGTCACGTAGG + Intronic
1079880800 11:25923897-25923919 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1080477158 11:32606834-32606856 ACTGTCTCACTCTGTCACCCAGG + Intronic
1080516717 11:33029464-33029486 ACATTCTCACTCTGTCACCTAGG - Intronic
1080622909 11:34002130-34002152 TCTGTCTCACTCTGTCACCTAGG - Intergenic
1081628850 11:44673645-44673667 AGTCTCTCTCTCTGTCACCTAGG - Intergenic
1081733869 11:45390438-45390460 CCTCATTCACTCTATCACATTGG - Intergenic
1081988088 11:47321736-47321758 ACTCCATCACTGAGTCCCATTGG - Intronic
1082041335 11:47687831-47687853 ACAGTCTCACTCTGTCACCTAGG + Intronic
1082831018 11:57617302-57617324 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1083750219 11:64756820-64756842 ACAGTCTCACTCTGTCACACAGG + Intronic
1083931256 11:65847031-65847053 AGTTTCTCACTCTGTCACCTAGG + Intronic
1083993552 11:66261031-66261053 AATGTCTCACTCTGTCACCTGGG - Intronic
1084074220 11:66760421-66760443 AGTCTCTCACTCTGTCACCCAGG - Intronic
1084718794 11:70890936-70890958 AGTCTATCACTCTGTCACCCAGG - Intronic
1084855235 11:71980370-71980392 AGTCTAACACTCTGTCACCTAGG + Intronic
1084893096 11:72246180-72246202 AGTCTTTCACTCTGTCACTCAGG + Intergenic
1085164289 11:74382522-74382544 AGAGTATCACTCTGTCACCTAGG + Intronic
1085661238 11:78369110-78369132 TCTCTGTCACTCTGTCACCCAGG - Intronic
1086802477 11:91194152-91194174 ACTCTTTCACTCTTTTACTTAGG - Intergenic
1086959898 11:92970983-92971005 AGTCTCTCACTCTGTCACCCAGG + Intronic
1088076011 11:105849164-105849186 AGTCTAGCACTCTGTCTCCTAGG - Intronic
1088253981 11:107885901-107885923 AGTCTCTCACTCTGTCACCCAGG + Intronic
1088860240 11:113791948-113791970 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1089720682 11:120417533-120417555 AGTCTCTCACTCTGTCACCCAGG + Intronic
1089955638 11:122568513-122568535 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1090005227 11:122996346-122996368 AGACTCTCACTCTGTCACCTAGG - Intergenic
1090680166 11:129047100-129047122 AGTCTTTCACTCTGTCACCCAGG - Intronic
1091106911 11:132930336-132930358 ACTGTCTCACCCTGTCACACAGG - Intronic
1091487679 12:905715-905737 ACTTCACCACTCTCTCACATTGG + Intronic
1091500856 12:1016668-1016690 ACTGTTTCACTCTGTCACCCAGG + Intronic
1092411373 12:8255754-8255776 ACGGTCTCACTCTGTCACCTAGG + Intergenic
1092483963 12:8885481-8885503 ACTCTCTCACTCTGTCACCCAGG + Intronic
1092838950 12:12519678-12519700 ACTATATCATTCTTCCACATAGG - Intronic
1092848085 12:12602690-12602712 AGTCTCACACTCTGTCACCTAGG - Intergenic
1093043558 12:14414585-14414607 ACTGTATATCTCTGTCATATTGG + Intronic
1093768079 12:22987774-22987796 ATTCTATCATTCTATCAAATGGG - Intergenic
1094019448 12:25898619-25898641 ACTCACTCACTCTGTCACCCAGG + Intergenic
1094458049 12:30660195-30660217 ACAGTCTCACTCTGTCACCTAGG - Intronic
1094694417 12:32803344-32803366 ACACTGTCACTCTGTCACCCAGG - Intronic
1094707338 12:32927100-32927122 CTTCTATCACTTTGTCACACAGG - Intergenic
1095297284 12:40541400-40541422 TCTCTTTCACTATGTCACAAGGG - Intronic
1095319945 12:40815014-40815036 TCTCTTTCACTGTGTCACAAGGG - Intronic
1095465929 12:42488013-42488035 AGGGTATCACTCTGTCACCTAGG - Intronic
1096087512 12:48875659-48875681 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1096097775 12:48948177-48948199 ATTCTCTCACTCTGTCACCTGGG - Intronic
1096288308 12:50319334-50319356 AGACTGTCACTCTGTCACCTAGG - Intergenic
1097852988 12:64432269-64432291 ATAGTCTCACTCTGTCACATAGG + Intronic
1098274972 12:68804053-68804075 ATGGTCTCACTCTGTCACATAGG + Intergenic
1099023025 12:77430155-77430177 AGGCTCTCACTCTGTCACATAGG + Intergenic
1099150208 12:79101878-79101900 AGTGTTTCACTCTGTCACCTAGG - Intronic
1099468814 12:83021323-83021345 ACTCTATCACTCCACTACATAGG + Intronic
1099856715 12:88177298-88177320 AGTATATCACTCTGTCACCCAGG - Intronic
1100187237 12:92151331-92151353 GGTCTCTCACTCTGTCACCTAGG + Intergenic
1100335078 12:93621514-93621536 ACTCTATCACCCAGGCACAGTGG + Intergenic
1100651073 12:96589770-96589792 ACTCACTCACTCTGTCACCCAGG + Intronic
1100810468 12:98332263-98332285 ACAGTATCACTCTGTCACCCAGG - Intergenic
1101106556 12:101445986-101446008 ACTCTGTCACTCTGTCACCTAGG - Intergenic
1101146549 12:101846070-101846092 TCTCACTCACTCTGTCACCTAGG + Intergenic
1101147820 12:101857953-101857975 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1101327221 12:103726463-103726485 AGTGTCTCACTCTGTCACCTAGG - Intronic
1102424708 12:112833753-112833775 AGTGTCTCACTGTGTCACATAGG + Intronic
1102696580 12:114804270-114804292 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1103375779 12:120454911-120454933 ACTGTCTCACTCTGTCACCCAGG + Intronic
1103828520 12:123760930-123760952 AGTGTCTCACTCTGTCACCTAGG + Exonic
1104398020 12:128452117-128452139 TCTCTCTCACTCTGTCACCCAGG + Intronic
1104802350 12:131562805-131562827 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1105757598 13:23483345-23483367 TATCTATCACTCTGTCACCCAGG - Intergenic
1106117242 13:26828485-26828507 TCTCGCTCACTCTCTCACATAGG + Intergenic
1106610315 13:31273118-31273140 TCTCTCTCACTCTGTCACCCAGG + Intronic
1106644902 13:31623258-31623280 ACTCTATCACTCTTACTAATAGG + Intergenic
1107035806 13:35901462-35901484 AGTCTCTCACTCTGTCACCTAGG - Intronic
1107339131 13:39387518-39387540 AGTCTCTCACTCTGTCACCCAGG - Intronic
1107772481 13:43803868-43803890 AGGCTTTCACTCTGTCACCTGGG - Intergenic
1107860787 13:44659390-44659412 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1107925239 13:45254034-45254056 GCTCTGTCACTCTGTCACTCAGG - Intronic
1108554196 13:51577204-51577226 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1109334460 13:60975291-60975313 ACTCTATCTCAGTGTCACATTGG + Intergenic
1110021955 13:70485625-70485647 ACTCTATCACACTGAAATATGGG - Intergenic
1110565789 13:76956536-76956558 ACAGTCTCACTCTGTCACCTAGG + Intronic
1111146799 13:84192403-84192425 ACTGTATCTGTCTGGCACATAGG + Intergenic
1111522487 13:89424756-89424778 ACTCTCTTGCTCTGTCACCTAGG + Intergenic
1111825224 13:93258922-93258944 AGTGTCTCACTCTGTCACCTAGG - Intronic
1111981783 13:95024179-95024201 AGTCTCTCACTCTGTCACCCAGG - Intronic
1112035598 13:95493582-95493604 ACAGTCTCACTCTGTCACCTAGG + Intronic
1112068445 13:95820125-95820147 ACAGTTTCACTCTGTCACACAGG - Intronic
1112144083 13:96678646-96678668 ACTCTGTCACTCTGTCACCCAGG - Intronic
1112205527 13:97320283-97320305 AGTCTCTCACTCTGTCACCCAGG + Intronic
1112222809 13:97508229-97508251 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1112578746 13:100660303-100660325 ACAGTCTCACTCTGTCACCTGGG - Intronic
1113099394 13:106701074-106701096 AGTCTTTCGCTCTGTCACCTAGG + Intergenic
1114463388 14:22902798-22902820 ACTCTGTCACTCTGTCACTGAGG + Intronic
1115055816 14:29125305-29125327 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1115234030 14:31190979-31191001 AGTGTCTCACTCTGTCACTTAGG + Intronic
1115274369 14:31591186-31591208 ACTTTATCACTCTGTCACCCAGG + Intronic
1116883635 14:50196891-50196913 AGTGTCTCACTCTGTCACCTAGG + Intronic
1117134281 14:52717997-52718019 AGGCAATCACTCTGTCACCTAGG - Intronic
1117273620 14:54170192-54170214 ACCCTTTCTATCTGTCACATGGG - Intergenic
1118010288 14:61603792-61603814 AGTGTCTCACTCTGTCACCTAGG - Intronic
1118122536 14:62861293-62861315 AGTCTCTCACTCTGTCACCCAGG + Intronic
1118185132 14:63530659-63530681 ACACTCTCACTCTGTCACCCAGG + Intronic
1118190731 14:63577789-63577811 AGTCTCTCTCTCTGTCACCTAGG + Intergenic
1118207762 14:63739080-63739102 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1119033488 14:71210749-71210771 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1119237232 14:73029806-73029828 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1119276574 14:73362229-73362251 AAGGTATCACTCTGTCACCTAGG - Intronic
1119307543 14:73619935-73619957 CCTGTATCACTCTGTCACATAGG + Intergenic
1119373795 14:74171337-74171359 AGGCTCTCACTCTGTCACCTAGG - Intronic
1119847584 14:77841816-77841838 ACTCTGTCACTCTGTCACTCAGG - Intronic
1120199160 14:81517952-81517974 ACAGTCTCACTCTGTCACCTAGG + Intronic
1120359311 14:83476525-83476547 AGTCTCTCACTCTGTCACTCAGG - Intergenic
1120865991 14:89295611-89295633 ACTCTGTCACTCTGTCACCCAGG + Intronic
1120905032 14:89612791-89612813 ACTCTGTCACTCTGTCACCCAGG - Intronic
1120964586 14:90156177-90156199 AGACTCTCACTCTGTCACCTAGG - Intronic
1122158070 14:99762772-99762794 AGTGTTTCACTCTGTCACCTAGG - Intronic
1122682807 14:103479044-103479066 ACGGTCTCACTCTGTCACCTAGG + Intronic
1122832834 14:104409855-104409877 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1123398216 15:19957799-19957821 ATTCTGTCATTCTGTCATATGGG + Intergenic
1125016734 15:34945732-34945754 ACTCTATCACCTTTTCACTTTGG + Intronic
1125548561 15:40527194-40527216 ACTGTCTCACTCTGTCACCTAGG + Intergenic
1125633438 15:41167339-41167361 ACACTCTCACTCTGTCACCCAGG - Intergenic
1125761047 15:42095750-42095772 AGTGTATCACTCTGTCACCCAGG - Intergenic
1125855676 15:42947109-42947131 AGTCTCTCACTCTGTCACCCAGG - Intronic
1125883484 15:43212039-43212061 AGTCTCTCACTCTGTCACCCAGG - Intronic
1125981872 15:44009651-44009673 ACAGTCTCACTCTGTCACTTAGG - Intronic
1126213425 15:46126657-46126679 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1126563334 15:50068777-50068799 TCTCTCACTCTCTGTCACATAGG - Intronic
1126708698 15:51432069-51432091 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1126813797 15:52435300-52435322 ACTCTGTCACTCTGTCACCCAGG + Intronic
1127115788 15:55725795-55725817 ACAGTCTCACTCTGTCACATAGG + Intronic
1128288212 15:66456329-66456351 TCTATGTCACTATGTCACATCGG - Intronic
1128924257 15:71640106-71640128 ACAGTCTCACTCTGTCACCTAGG + Intronic
1129290649 15:74564624-74564646 AGGGTATCACTCTGTCACCTGGG + Intronic
1129473471 15:75767721-75767743 AGTCTGTCACTGTGTCTCATAGG + Intergenic
1129527057 15:76225312-76225334 AGTCTCTCACTCTGTCACCCAGG + Intronic
1131096999 15:89662470-89662492 ACCGTATCACTCTGTCACCCAGG - Intergenic
1131162022 15:90112018-90112040 ACTCTCTCACTCTGTCACCCAGG - Intergenic
1131929204 15:97420036-97420058 ACCTTCTCACTCTGTCACACGGG - Intergenic
1131973086 15:97912323-97912345 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1132199523 15:99940726-99940748 ATTCTCTCACTCTGTCACCCAGG + Intergenic
1132545760 16:532527-532549 AGGGTATCACTCTGTCACCTAGG - Intronic
1132780624 16:1622785-1622807 AGTCTCTCACTCTGTCACCCAGG + Intronic
1133164028 16:3933866-3933888 AGTGTATCACTCTGTCACCCAGG - Intergenic
1133630578 16:7616587-7616609 AGTCTCTCACTCTGTCACCTAGG + Intronic
1134245544 16:12536948-12536970 TCTCTCTCACTCTGTCGCCTAGG - Intronic
1134597089 16:15504471-15504493 AGTGTCTCACTCTGTCACCTAGG + Intronic
1134749077 16:16611433-16611455 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1134759315 16:16699571-16699593 TCTCTCTCTCTCTGTGACATGGG + Intergenic
1134986758 16:18659626-18659648 TCTCTCTCTCTCTGTGACATGGG - Intergenic
1134996388 16:18742203-18742225 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1135264640 16:21012785-21012807 ACTCTCTTACTCTGTCACCCAGG + Intronic
1135280152 16:21147243-21147265 AGTCTCTCACTCTGTCACCCAGG + Intronic
1135350167 16:21722234-21722256 ACAGTCTCACTCTGTCACCTAGG - Intronic
1135563652 16:23495486-23495508 AGTCTCTCACTCTGTCACCCAGG + Intronic
1135733343 16:24912427-24912449 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1136584875 16:31178096-31178118 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1136845957 16:33575948-33575970 AGGGTATCACTCTGTCACCTAGG - Intergenic
1137235983 16:46618665-46618687 ACGGTCTCACTCTGTCACCTAGG + Intronic
1137603369 16:49771226-49771248 ACTCTCTCACTCTGTCACCCAGG + Intronic
1137850487 16:51737160-51737182 AGTATCTCACTCTGTCACCTAGG + Intergenic
1137928524 16:52564562-52564584 ACAGTCTCACTCTGTCACACAGG + Intergenic
1138322549 16:56128670-56128692 AGTCTCTCACTCTGTCACCTTGG - Intergenic
1138394677 16:56695112-56695134 AAGCTATCACTCTGTCACCCAGG + Intronic
1138817458 16:60219595-60219617 ACTCTCTTACTCTGTCACCTAGG + Intergenic
1139406978 16:66726940-66726962 AGTCTCTCACTCTGTCACCCTGG + Intronic
1139626856 16:68196666-68196688 AGTCTCTCACTCTGTCACCCAGG - Intronic
1139695916 16:68674707-68674729 AGGGTATCACTCTGTCACTTAGG - Intronic
1139791396 16:69439590-69439612 ACAGTCTCACTCTGTCACCTAGG + Intronic
1140093807 16:71858420-71858442 AGGATATCACTCTGTCACCTAGG - Intronic
1140271967 16:73474171-73474193 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1140424882 16:74852633-74852655 ACTCTTTCACTCTGTCACCCAGG + Intergenic
1140605857 16:76536219-76536241 ACTCTGTCACTCTGTCACCCAGG + Intronic
1141073417 16:80979644-80979666 AGTCTCTCACTCTGTCACCCAGG + Intronic
1141391833 16:83671272-83671294 ACAGTCTCACTCTGTCACCTAGG + Intronic
1141985056 16:87574552-87574574 AGTGTCTCACTCTGTCACACAGG + Intergenic
1142192929 16:88726160-88726182 GCTCTGCCACTCTGTGACATGGG - Intronic
1203107665 16_KI270728v1_random:1424601-1424623 AGGGTATCACTCTGTCACCTAGG - Intergenic
1142770504 17:2093395-2093417 ACGATATCACTCTGTCACCCTGG - Intronic
1142778856 17:2164580-2164602 ACTCTCTTACTCTGTCACTCAGG - Intronic
1144122426 17:12168007-12168029 ACAGTATCACTCTGTCACCCAGG + Intergenic
1146301046 17:31689979-31690001 ACTCTGTCACTTTGTCATCTAGG + Intergenic
1146771431 17:35571888-35571910 ACTCCCTCACTCTGTCACCCAGG - Intergenic
1146813841 17:35926105-35926127 ACAGTCTCACTCTGTCACCTAGG - Intronic
1147005844 17:37403395-37403417 AGTGTCTCACTCTGTCACCTAGG + Intronic
1147300068 17:39519329-39519351 ACCGTCTCACTCTGTCACCTAGG + Intronic
1147385643 17:40080041-40080063 ACTCTGTCGCTCTGTCACCCAGG - Intronic
1147691643 17:42319210-42319232 AGTCTGTCACTCTGTCACCCAGG - Intronic
1148577370 17:48721349-48721371 AGAGTCTCACTCTGTCACATAGG + Intergenic
1148739784 17:49886252-49886274 ACGTTCTCACTCTGTCACCTGGG - Intergenic
1149536238 17:57435779-57435801 AATCCATCACTCAGTCCCATTGG - Intronic
1149898751 17:60453563-60453585 AGGCTCTCACTCTGTCACCTAGG + Intronic
1149923620 17:60681177-60681199 ACAGTCTCACTCTGTCACCTAGG - Intronic
1150646561 17:66981957-66981979 ACGGTCTCACTCTGTCACACAGG + Intronic
1150718894 17:67597526-67597548 TCTCAATCACTCTGTCGCCTAGG - Intronic
1150737357 17:67751899-67751921 AGGCTCTCACTCTGTCACACAGG - Intergenic
1150915909 17:69436845-69436867 ACTGTCTCACTCTGTCACCCAGG + Intronic
1151166009 17:72204382-72204404 GCTCCATCATTCTGTCTCATAGG - Intergenic
1151214835 17:72570289-72570311 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1151532867 17:74718266-74718288 AGTGTCTCACTCTGTCACCTAGG - Intronic
1151638240 17:75368239-75368261 AGTCTCTCACTCTGTCACCCAGG + Intronic
1151846872 17:76662609-76662631 ACTGTCTCACTCTGTCACCCAGG + Intergenic
1152082689 17:78198201-78198223 ACGGTTTCACTCTGTCACACAGG - Intronic
1152583117 17:81177518-81177540 ACTCTATCACCCTATCACCCAGG - Intergenic
1153042273 18:824458-824480 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1153055898 18:946013-946035 ACAGTCTCACTCTGTCACCTGGG + Intergenic
1153061684 18:1001477-1001499 ACACTCTCACTCTGTCACCCAGG - Intergenic
1153231047 18:2936470-2936492 AGGGTCTCACTCTGTCACATGGG + Intronic
1153538523 18:6129947-6129969 ACTCCATCACTCTCTGAAATGGG + Intronic
1153801195 18:8670712-8670734 AGGCTCTCACTCTGTCACCTAGG - Intergenic
1154010605 18:10570967-10570989 ACTGTCTCACTCTGTCACTCAGG - Intergenic
1154437069 18:14353670-14353692 ACCCCATCACTCTCTCACCTGGG - Intergenic
1155139251 18:23029240-23029262 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1155268453 18:24116519-24116541 ACACTCTCACTCTGTCACCCAGG - Intronic
1155306660 18:24485044-24485066 TCTTTCTCACTCTGTCACACAGG - Intergenic
1155748918 18:29395756-29395778 ACACTCTCACTCTGTCATACCGG + Intergenic
1156074302 18:33254917-33254939 ACCCTGTAACACTGTCACATTGG - Intronic
1157155052 18:45257117-45257139 ACACTGTCACTCTTTCACATGGG - Intronic
1157255187 18:46132383-46132405 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1157759263 18:50248092-50248114 AGTATCTCACTCTGTCACTTAGG - Intronic
1158960367 18:62583076-62583098 ACGGTCTCACTCTGTCACCTAGG - Intronic
1159063734 18:63544600-63544622 TCTCTATGTCTCTGTCATATTGG + Intergenic
1159699282 18:71604581-71604603 ACACTTTCATTCTGGCACATGGG - Intergenic
1160614986 18:80119384-80119406 AGTCTGTCACTCTGTCACCCAGG - Intronic
1160988392 19:1850693-1850715 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1161665183 19:5571482-5571504 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1162173954 19:8815758-8815780 TCTCACTCACTCTGTCACCTAGG - Intronic
1162231992 19:9274655-9274677 TGTCTGTCACTCTGTCACCTAGG - Intergenic
1162455759 19:10783724-10783746 ACAGTCTCACTCTGTCACCTAGG + Intronic
1162526039 19:11207217-11207239 AAGGTTTCACTCTGTCACATAGG + Intronic
1162771327 19:12951036-12951058 ACACTCTCACTCTGTCACCCAGG - Intronic
1162887420 19:13706024-13706046 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1162927896 19:13939235-13939257 ACTCTGTCACTCTGTCGCCTAGG + Intronic
1162945431 19:14040395-14040417 AATCTATCACCCGGTCACAGTGG + Intronic
1163281664 19:16322178-16322200 ACTCTGTCACCCTGTCACCCAGG + Intergenic
1163387096 19:17006495-17006517 TCTCTCTCATTCTGTCACCTAGG - Intronic
1163474459 19:17516908-17516930 ACTCTGTCACTCTGTCACCTAGG + Intronic
1163528160 19:17833825-17833847 ACTATCTCCCTCTGTCACCTAGG - Intronic
1163788040 19:19287243-19287265 ACGGTATCACTCTGTCACCCAGG - Intronic
1164027825 19:21369125-21369147 AGTGTCTCACTCTGTCACATAGG + Intronic
1164069904 19:21758006-21758028 AGTGTCTCACTCTGTCACACAGG - Intronic
1164125594 19:22313080-22313102 AGGGTCTCACTCTGTCACATGGG + Intronic
1164572344 19:29383503-29383525 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1164782667 19:30906158-30906180 ACAGTTTCACTCTGTCACCTAGG - Intergenic
1164858313 19:31542612-31542634 TTTGTCTCACTCTGTCACATAGG + Intergenic
1165284642 19:34831896-34831918 AGCGTATCACTCTGTCACACAGG - Intergenic
1165306881 19:35008301-35008323 AATCTCTCACTCTGTCACCTAGG - Intronic
1165336904 19:35177043-35177065 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1165608747 19:37132086-37132108 ACACTGTCACTCTGTCACCCAGG - Intronic
1166721256 19:44997653-44997675 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1166738754 19:45101690-45101712 AGGGTCTCACTCTGTCACATAGG - Intronic
1167131489 19:47588991-47589013 ACACTCTCACTCTGTCACCCAGG - Intergenic
1167287395 19:48606283-48606305 AGTCTCTCACTCTGTCACCCAGG - Intronic
1167584846 19:50368464-50368486 AGTGTCTCACTCTGTCACCTGGG - Intronic
1167785791 19:51635167-51635189 ACTGTGTCACTTTGTCACCTTGG - Intronic
1168050985 19:53829770-53829792 AGTCTATCCCTCTTTCAAATTGG - Intergenic
925190629 2:1880361-1880383 AGACTCTCACTCTGTCACACAGG + Intronic
925989675 2:9244268-9244290 AGGGTCTCACTCTGTCACATAGG - Intronic
926061053 2:9805294-9805316 AATCTCTCATTCTGTCATATCGG - Intergenic
927026637 2:19074928-19074950 ACAGTATCACTCTGTCACCCAGG + Intergenic
927299547 2:21495932-21495954 AGTGTATCACTCTGTCACCCAGG - Intergenic
927683005 2:25152462-25152484 CCCCCATCACTCTGTAACATGGG - Intronic
929000155 2:37340285-37340307 ACTGTCTCTCTCTGTCACACAGG + Intergenic
929036239 2:37694668-37694690 AGTGTCTCACTCTGTCACCTAGG - Intronic
929198149 2:39207357-39207379 AGGGTCTCACTCTGTCACATAGG - Intronic
929224039 2:39494740-39494762 AGACTATCACTCTGTCACCCAGG - Intergenic
929482376 2:42322577-42322599 ATTCTTTCACTTTGTCACTTGGG + Intronic
929651291 2:43682330-43682352 ACAGTCTCACTCTGTCACCTGGG + Intronic
929678204 2:43959856-43959878 ACAGTCTCACTCTGTCACCTAGG - Intronic
929710988 2:44266517-44266539 AGTCTCTCACTCTGTCACCCAGG - Intergenic
929926147 2:46211846-46211868 ATTCTGTCACTCTGTCACCCAGG + Intergenic
930657348 2:54019400-54019422 ACAGTCTCACTCTGTCACTTAGG + Intronic
931276338 2:60746878-60746900 ACTCTACCCCCCTGTCACAGGGG + Intergenic
931438859 2:62272821-62272843 AAGGTCTCACTCTGTCACATAGG - Intergenic
931527179 2:63169915-63169937 ACCCTATCACTCTGCCACCCAGG + Intronic
931726619 2:65117590-65117612 AGGCTCTCACTCTGTCACCTAGG + Intronic
932960465 2:76407034-76407056 ACTCTGTTATTCTGACACATGGG - Intergenic
933103501 2:78289946-78289968 ACAGTCTCACTCTGTCACCTAGG - Intergenic
933118047 2:78498834-78498856 ACTGTCTCACTCTGTCACCCAGG + Intergenic
935689663 2:105719438-105719460 CCTCTGTCACCCTGTCTCATGGG - Intergenic
935926153 2:108071497-108071519 ACAGTCTCACTCTGTCACTTAGG - Intergenic
937217663 2:120322980-120323002 TCTCTCTCTCTCTGTCACCTAGG - Intergenic
937680105 2:124634532-124634554 ACGGTATCACTTTGTCACCTAGG + Intronic
937935882 2:127244298-127244320 ACAGTATCACTCTGTCACCCAGG - Intergenic
938601487 2:132846342-132846364 ACAGTCTCACTCTGTCACCTTGG + Intronic
938784627 2:134614826-134614848 AGTCTCTCACTCTGTCGCACAGG - Intronic
939242835 2:139583808-139583830 ACTCAATCTCTCTGTGACTTTGG - Intergenic
939283777 2:140101519-140101541 ACTTTATCACTCTGTCACCCAGG - Intergenic
939435887 2:142177215-142177237 GGTCTGTCACTCTGTCACAGAGG + Intergenic
939894850 2:147778904-147778926 ACTCTATCATTCTGTTTCAAAGG + Intergenic
941008143 2:160268779-160268801 AGTGTATCTCTCTGTCACACAGG + Intronic
941403228 2:165057660-165057682 TCTCTACCACTCTGTCACCCAGG + Intergenic
941757084 2:169198386-169198408 ACAGTCTCACTCTGTCACCTGGG - Intronic
941774556 2:169377992-169378014 GATCTCTCACTCTGTCACCTAGG - Intergenic
941926388 2:170899497-170899519 ACGGTCTCACTCTGTCACCTAGG + Intergenic
941999642 2:171633092-171633114 ACAATCTCACTCTGTCACCTGGG - Intergenic
942171726 2:173296106-173296128 ACAGTCTCACTCTGTCACCTAGG - Intergenic
942213402 2:173694028-173694050 ACTGTCTCATTCTGTCACCTAGG + Intergenic
942313436 2:174677124-174677146 AGTTTCTCACTCTGTCACCTAGG - Intronic
944249589 2:197567713-197567735 ACAGTCTCACTCTGTCACCTAGG - Intergenic
944829349 2:203517006-203517028 AGTCTTTCACTCTGTCACCCAGG - Intronic
945078881 2:206068723-206068745 AGTGTCTCACTCTGTCACCTAGG + Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945827358 2:214739121-214739143 CCTCCCTCACTCTGTCACACAGG - Intronic
945886637 2:215383028-215383050 AGTCTCTCACTCTGTCACCCAGG + Intronic
945894734 2:215469233-215469255 ACAGTCTCACTCTGTCACCTAGG + Intergenic
946068691 2:217012174-217012196 ACTATGTCACTCTGTCACCCAGG - Intergenic
946271849 2:218600801-218600823 ACAGTCTCACTCTGTCACCTAGG - Intergenic
946791217 2:223302090-223302112 ACCCTGTCACTCTGTCACCCAGG - Intergenic
946910486 2:224456053-224456075 AGTTTCTCACTCTGTCACCTAGG + Intergenic
947520426 2:230841715-230841737 ACCGTATCACTCTGTCACCCAGG + Intergenic
947604923 2:231479765-231479787 ACTCTCTCGCTCTGTCACCCAGG - Intronic
947698374 2:232211884-232211906 AGAGTATCACTCTGTCACACAGG + Intronic
948987987 2:241537239-241537261 AGTGTCTCACTCTGTCACCTAGG + Intergenic
1169494614 20:6102649-6102671 ACAGTTTCACTCTGTCACCTAGG - Intronic
1170869931 20:20196053-20196075 ACAGTATCACTCTGTCACCCAGG - Intronic
1171482802 20:25466772-25466794 ACATTATCACTCTGTCACCCAGG - Intronic
1171536826 20:25899633-25899655 AGGGTATCACTCTGTCACCTAGG - Intergenic
1171870643 20:30521752-30521774 TCTCTGTCTGTCTGTCACATTGG - Intergenic
1171954202 20:31447640-31447662 ACGGTTTCACTCTGTCACTTAGG + Intronic
1172056320 20:32156971-32156993 ACTCTCTCACTCTGTCACCCAGG + Intronic
1172381589 20:34497602-34497624 AATGTATCACTCTGTCACCCAGG + Intronic
1172536998 20:35681670-35681692 AGAGTATCACTCTGTCACCTAGG - Intronic
1172665980 20:36600573-36600595 AGTCTCTCACTCTGTCACCCAGG + Intronic
1172675142 20:36664713-36664735 ACGGTCTCACTCTGTCACCTAGG + Intronic
1172738243 20:37145294-37145316 AGTCTCTCACTCTGTCACCCAGG + Intronic
1173400938 20:42725252-42725274 ACAGTCTCACTCTGTCACCTAGG - Intronic
1174280987 20:49439136-49439158 ACAGTCTCACTCTGTCACCTGGG + Intronic
1174572821 20:51514845-51514867 AGTCTATCACTCTGTCACACAGG - Intronic
1175094280 20:56529180-56529202 ACGGTCTCACTCTGTCACTTAGG - Intergenic
1175289276 20:57863057-57863079 ACAGTCTCACTCTGTCACCTGGG - Intergenic
1176721021 21:10392919-10392941 AATGTCTCACTCTGTCACCTGGG + Intergenic
1176839969 21:13831972-13831994 ACCCCATCACTCTCTCACCTGGG + Intergenic
1177118736 21:17116152-17116174 AAGGTATCACTCTGTCACCTAGG - Intergenic
1177150981 21:17455241-17455263 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1177626036 21:23660893-23660915 AGTCTCTCACTCTGTCACCTAGG - Intergenic
1178677789 21:34645910-34645932 AATCTCTCACTCTGTCACCCAGG + Intergenic
1179039523 21:37789953-37789975 ACTCTATCACTCACACACCTGGG - Intronic
1179360305 21:40700760-40700782 TCTCCCTCACTCTGTCACACAGG + Intronic
1179589833 21:42399780-42399802 ACTGTCTCACTCTGTCACCCCGG + Intergenic
1179953023 21:44722280-44722302 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1180302209 22:11045709-11045731 AATGTCTCACTCTGTCACCTGGG + Intergenic
1181470845 22:23138534-23138556 AGTCTCTCACTCTGTCACCCAGG - Intronic
1181842053 22:25671599-25671621 ACTCTGTCACTGTGTGACCTTGG + Intronic
1182247130 22:28967898-28967920 ACGGTGTCACTCTGTCACCTAGG - Intronic
1182415286 22:30217410-30217432 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1182611563 22:31552276-31552298 ACTGTCTCACTCTGTCACCCAGG + Intronic
1182856014 22:33518342-33518364 ACACTCTCACTCTGTCGCCTAGG + Intronic
1182869499 22:33633663-33633685 ACTCTCTCAGTCTGTCTGATAGG - Intronic
1183330429 22:37217727-37217749 GCTCTCTCACTCTGTCACCCAGG + Intergenic
1183468444 22:37992418-37992440 ACTCTTTCACTCTGTTGCCTAGG + Intronic
1183960187 22:41406803-41406825 ACTGTTTCACTCTGTCACCCAGG + Intergenic
1184197701 22:42941800-42941822 ACTCTGTCACTCTGTCACCCAGG + Intronic
1184326760 22:43793749-43793771 ACTCTATCACTCTATCTCCACGG + Intronic
1184374941 22:44105852-44105874 ACTCTATCACTCTATCACCCAGG + Intronic
1184487203 22:44786991-44787013 ACTCTGTCACTCTGTCACCCAGG - Intronic
1184576514 22:45372015-45372037 AGTCTCTCACTCTGTCACCCAGG - Intronic
1184881661 22:47308831-47308853 TCTCTGTCGCTCTGTCGCATAGG + Intergenic
1203314288 22_KI270736v1_random:172424-172446 AGTATATCACTGTGTCACACAGG - Intergenic
949288320 3:2432832-2432854 ACGGTCTCACTCTGTCACCTAGG + Intronic
949323041 3:2832900-2832922 ACTCTATGACTTTAACACATCGG - Intronic
949527099 3:4915833-4915855 AGTCTCTCACTCTGTCACCCAGG + Intergenic
950249332 3:11451235-11451257 TCTATATCACTCTGTCACCCAGG + Intronic
950314034 3:11984844-11984866 TCTCTCTCACTCTGTCACCCAGG + Intergenic
951224863 3:20109340-20109362 ATTCTGTCACTCTGTCACCCAGG + Intronic
951636088 3:24778809-24778831 AAAGTCTCACTCTGTCACATAGG + Intergenic
951912264 3:27763461-27763483 AGAGTATCACTCTGTCACCTAGG + Intergenic
953335987 3:42094395-42094417 AGAGTCTCACTCTGTCACATAGG + Intronic
953965252 3:47299799-47299821 ACAGTATCACTCTGTCACGCAGG - Intronic
954023879 3:47766546-47766568 TCTCTCTCACTCTGTCACTCAGG - Intronic
954467447 3:50664527-50664549 ACTCTGTCACCCTGTCACCCAGG - Intergenic
954482697 3:50816345-50816367 ACACTCTCACTCTGTCACCCAGG + Intronic
955180230 3:56661170-56661192 ACAGTCTCACTCTGTCACCTAGG + Intronic
955240691 3:57175445-57175467 AGTCTCTCACTCTGTCACCCTGG + Intergenic
955301292 3:57782496-57782518 ACGGTCTCACTCTGTCACCTAGG + Intronic
955727611 3:61949771-61949793 GCTCTGTCACTCTGTCACCCAGG + Intronic
955809735 3:62775061-62775083 AGTCTCTCACTCTGTCACTCAGG + Intronic
956362443 3:68463171-68463193 ACTCTATCAATGTGTCAACTTGG - Intronic
956960750 3:74397523-74397545 TCTCTCTCTCTCTGTCTCATTGG + Intronic
956977851 3:74602359-74602381 TATCTCTCACTCTGTCACATTGG - Intergenic
957178522 3:76845475-76845497 CTTCTATATCTCTGTCACATTGG - Intronic
957396218 3:79641991-79642013 AGTCTCTCACTCTGTCACCCAGG - Intronic
957664194 3:83202575-83202597 ACTCTTTCAGTGTGTCACATGGG + Intergenic
958647503 3:96891057-96891079 TCTCTTTCACTCTGTCACCCAGG - Intronic
958973594 3:100640420-100640442 ACTCTTTGACTCTGTCAAAGTGG + Intronic
960069897 3:113418111-113418133 ACTCTGTCACTCTGTCACCCAGG + Intronic
960582206 3:119290258-119290280 AGAGTATCACTCTGTCACCTAGG - Intergenic
960934924 3:122893023-122893045 AGTGTCTCACTCTGTCACCTAGG - Intergenic
961320902 3:126074704-126074726 AGGCTCTCACTCTGTCACCTAGG + Intronic
961753228 3:129109888-129109910 AGGCTCTCACTCTGTCACTTAGG + Intronic
961824873 3:129593813-129593835 ACTTTATCCCTCTCTCACATGGG + Intronic
961948791 3:130723035-130723057 AGTCTCTCACTCTGTCACCCAGG - Intronic
962798483 3:138869406-138869428 ACTCTGTCACTCTGTCACCCTGG + Intergenic
963104707 3:141637120-141637142 AAAATCTCACTCTGTCACATAGG - Intergenic
963163128 3:142173173-142173195 CCTGTCTCACTCTGTCACCTAGG - Intronic
963324315 3:143844794-143844816 ACAGTCTCACTCTGTCACCTAGG + Intronic
963932140 3:151014412-151014434 CCTCTATCACCCTGAAACATAGG - Intergenic
964029311 3:152118247-152118269 AGTCTTTCACTCTATCACTTGGG + Intergenic
964332249 3:155616451-155616473 ACTCTGTTATTCTGACACATGGG - Intronic
964336726 3:155662440-155662462 ACGGTGTCACTCTGTCACCTAGG - Intronic
964402384 3:156312677-156312699 ACAGTCTCACTCTGTCACCTAGG - Intronic
964991257 3:162815426-162815448 AGTCTCTCACTCTGTCACCCAGG + Intergenic
965144714 3:164886823-164886845 ACAGTCTCACTCTGTCACCTAGG + Intergenic
965177218 3:165351002-165351024 GCTGTATCACTCTGTCACCCAGG + Intergenic
965642638 3:170846776-170846798 ACAGTCTCACTCTGTCACCTAGG - Intronic
965916271 3:173850760-173850782 ACTTTCTCACTCTGTCACCCAGG + Intronic
966071282 3:175881551-175881573 ACTCTTTCCCTCTGTCAATTCGG + Intergenic
966517881 3:180838951-180838973 ACAATCTCACTCTGTCACACAGG - Intronic
966550872 3:181202766-181202788 AGTCTCTCACTCTGTCACCCAGG + Intergenic
966987481 3:185194773-185194795 AGGGTCTCACTCTGTCACATAGG - Intronic
967467048 3:189819775-189819797 AGTCTCTCACTCTGTCACTCAGG + Intronic
967673557 3:192268938-192268960 AGTCTCTCACTCTGTCACCCAGG + Intronic
967693391 3:192503629-192503651 AGTCTCTCACTCTGTCACCCAGG + Intronic
967782931 3:193459458-193459480 ACTCTATCACTCTGTCACCCAGG + Intronic
967816421 3:193802742-193802764 AGTCTCTCACTCTGTCACCCAGG - Intergenic
968670072 4:1844720-1844742 ACAGTCTCACTCTGTCACCTAGG - Intronic
968721591 4:2210555-2210577 ACTTTCTCACTCTGTCGCACAGG - Intronic
968744631 4:2353272-2353294 AGTCTATCACTGTGTCACCGTGG - Intronic
968834203 4:2950867-2950889 ACTCTCTCTCTCTGTCTCAAAGG - Intronic
969280698 4:6168873-6168895 AGGCTCTCACTCTGTCACCTAGG - Intronic
969814481 4:9676606-9676628 ACAGTCTCACTCTGTCACCTAGG - Intergenic
970116949 4:12708150-12708172 AGTCTCTCACTCTGTCACCCAGG + Intergenic
970288523 4:14546010-14546032 AAAGTCTCACTCTGTCACATAGG - Intergenic
970297677 4:14648515-14648537 AGGGTATCACTCTGTCACCTAGG + Intergenic
970445334 4:16119209-16119231 ACTCTGTCACTCTGTCACCCAGG - Intergenic
970629623 4:17925843-17925865 ACTCTGTCACTCTGTCACCCAGG - Intronic
970965516 4:21923553-21923575 AGTGTCTCACTCTGTCACCTAGG - Intronic
971638024 4:29088536-29088558 ACTCTATCACTCTATCACCCAGG - Intergenic
971931198 4:33086072-33086094 ACACTTTCTCTCTGTCACACTGG + Intergenic
971937631 4:33172914-33172936 TCTCTGTCACTATGTCACCTTGG - Intergenic
972110342 4:35550186-35550208 ACTTCATAACTTTGTCACATTGG + Intergenic
972438410 4:39058589-39058611 AGGGTATCACTCTGTCACACAGG - Intronic
973216401 4:47673943-47673965 ACACTCTCACTCTGTCACCGAGG - Intronic
973802339 4:54491786-54491808 ACACTGTCCCTCTGTCACCTAGG + Intergenic
973896605 4:55420068-55420090 AGTGTCTCACTCTGTCACCTAGG - Intronic
973897351 4:55427366-55427388 TCTATCTCACTCTGTCACCTGGG + Intronic
974026223 4:56735683-56735705 AGTTTCTCACTCTGTCACCTAGG - Intergenic
974477567 4:62403776-62403798 GATCTATCACTCTGTCACCTAGG + Intergenic
975324092 4:73040780-73040802 AGTCTCTCACTCTGTCACCCAGG + Intergenic
975693462 4:76988532-76988554 AGTATATCACTCTGTCACCCAGG + Intronic
975830915 4:78367374-78367396 ACTCTGTCACCCTGTCACCCAGG - Intronic
976005759 4:80428550-80428572 ACAGTCTCACTCTGTCACCTGGG + Intronic
976242675 4:82974831-82974853 AGTCTGTCACTCTGTCACTCAGG - Intronic
976494785 4:85715055-85715077 ACCCAATTACTCTGTAACATAGG - Intronic
976603329 4:86959509-86959531 TCTCTACCAGTCTCTCACATTGG - Intronic
977143901 4:93411458-93411480 ACTCTATCACTCTGTCACATAGG + Intronic
977625110 4:99181477-99181499 AGGCTATCACTCTGTCACCAAGG + Intergenic
977839266 4:101681815-101681837 ACAGTCTCACTCTGTCACACAGG - Intronic
978775958 4:112507201-112507223 ACTATATCTCTGTGTGACATTGG - Intergenic
979131972 4:117058695-117058717 AATTTATCCCTCTGTCACCTAGG + Intergenic
979179012 4:117702161-117702183 TCTCACTCACTCTGTCACCTAGG + Intergenic
979655340 4:123186009-123186031 ACTATATCATGGTGTCACATAGG + Intronic
980004365 4:127524529-127524551 AGGGTATCACTCTGTCACCTAGG + Intergenic
980275500 4:130645165-130645187 ACGGTTTCACTCTGTCACCTAGG - Intergenic
980404554 4:132339563-132339585 AGGCTATCACTCTGTCACCCAGG - Intergenic
980481448 4:133393403-133393425 ACTCTAGCACTCATTAACATTGG + Intergenic
981324821 4:143433731-143433753 CCTCTGTCTCTCTCTCACATGGG - Intronic
981506858 4:145511301-145511323 ACGCTCTCACTCTGTCACTCAGG + Intronic
981648336 4:147025932-147025954 ACTATATAACTCTGCCACTTAGG + Intergenic
981995942 4:150975498-150975520 ACAGTCTCACTCTGTCACTTAGG - Intronic
982098972 4:151949988-151950010 ACTGTATCCCTCTGGAACATGGG - Intergenic
982266793 4:153545188-153545210 ACTGAATCCCTGTGTCACATTGG + Intronic
982632805 4:157853483-157853505 ACAGTCTCACTCTGTCACACAGG - Intergenic
982686733 4:158499466-158499488 TCTCTCTCTCTCTGTCACAGTGG + Intronic
983152586 4:164302841-164302863 AGTCTCTCACTCTGTCACCCAGG - Intronic
983904110 4:173167554-173167576 AGTCTCTCACTCTGTCACCCAGG - Intergenic
984223205 4:177003361-177003383 TCTCTCTCACTCTGTCACCCAGG - Intergenic
984338366 4:178420893-178420915 AGTCTCTCACTCTGTCACCTAGG - Intergenic
984530003 4:180904445-180904467 ACTCTGTCACTCTGTCACCCAGG + Intergenic
984777675 4:183497037-183497059 AGTCTCTCACTCTGTCACCCAGG + Intergenic
985823604 5:2177622-2177644 ACAGTCTCACTCTGTCACCTAGG + Intergenic
986730353 5:10630845-10630867 ACAGTCTCACTCTGTCACCTAGG - Intronic
986834430 5:11619380-11619402 ACAGTCTCACTCTGTCACCTAGG - Intronic
986964956 5:13258786-13258808 AGTCTCTCCCTCTGTCACCTAGG - Intergenic
987156132 5:15091420-15091442 TCTCTCTCACTCTGTCACCCTGG + Intergenic
987351136 5:17023205-17023227 ACGGTCTCACTCTGTCACGTGGG - Intergenic
987570101 5:19646363-19646385 TCTCTCTCACTCTGTCACCCAGG + Intronic
987690639 5:21262324-21262346 AGTGTCTCACTCTGTCACCTAGG + Intergenic
987720989 5:21632417-21632439 AGAGTCTCACTCTGTCACATAGG + Intergenic
987820555 5:22961216-22961238 TCTCTCTCACTCTGTCACCCAGG + Intergenic
988448341 5:31312663-31312685 ACTCTCTCACTCTGTCACCCAGG - Intronic
988493962 5:31728878-31728900 TCTCTCTCTCTCTGTCACCTAGG + Intronic
988534122 5:32050793-32050815 AGTCTCTCACTCTATCACCTAGG - Intronic
988709813 5:33762164-33762186 TCTTTATCACTCTGTCACCCAGG - Intronic
989732086 5:44661467-44661489 AGTCTCTCACTCTGTCACCCAGG + Intergenic
989829986 5:45904595-45904617 ACAGTCTCACTCTGTCACCTGGG + Intergenic
990318132 5:54603264-54603286 AGGCTATCACTCTGTCACCCAGG + Intergenic
990428061 5:55708302-55708324 ACAGTCTCACTCTGTCACCTGGG - Intronic
990473003 5:56134551-56134573 AGTCTCTCACTCTGTCACCCAGG - Intronic
990746634 5:58965377-58965399 ACAGTCTCACTCTGTCACCTAGG - Intergenic
990816162 5:59787475-59787497 ACTCTATCACCCATACACATGGG + Intronic
991589522 5:68235375-68235397 ACACTTTCACTCTGTCACCCAGG - Intronic
992456100 5:76917098-76917120 ACAGTCTCACTCTGTCACCTAGG - Intronic
992601232 5:78402895-78402917 ACTGTTTCACTCTGTCACCCAGG + Intronic
992784653 5:80157758-80157780 ACTCTGTCACTATGTCACACAGG + Intronic
993112574 5:83676976-83676998 AAACTATTACTCTTTCACATTGG - Intronic
993375747 5:87148079-87148101 ACAGTCTCACTCTGTCACCTAGG + Intergenic
993886945 5:93426071-93426093 ACTCTGTCACTCTGTCACCCAGG + Intergenic
993999373 5:94760709-94760731 ACAGTATCACTCTGTCACCCAGG + Intronic
994169703 5:96644948-96644970 ACACTCTCACTCTGTCACCCAGG - Intronic
994217364 5:97153001-97153023 ACTCTATCACTCTATCACCCAGG + Intronic
995011671 5:107262571-107262593 AGTGTCTCACTCTGTCACACAGG - Intergenic
995199739 5:109412607-109412629 ACAGTCTCACTCTGTCACCTAGG - Intergenic
995512696 5:112924136-112924158 ACTGTCTCACTCTGTCACGCAGG + Intergenic
995513908 5:112935626-112935648 TCTCATTCACTCTGTCACCTAGG + Intergenic
995545296 5:113224118-113224140 ACTCACTCACTCTGTCACCCAGG + Intronic
996375970 5:122807234-122807256 ACGGTCTCACTCTGTCACCTAGG - Intronic
997308278 5:132856776-132856798 TCTCTCTCACTCTGTCACCCAGG - Intergenic
997331835 5:133069273-133069295 ACAATATCACTGTGTCACCTAGG + Intronic
997967032 5:138365970-138365992 ACAGTATCACTCTGTCACCCAGG - Intronic
998005678 5:138655348-138655370 ACAGTCTCACTCTGTCACACAGG - Intronic
998108543 5:139483798-139483820 AGGGTATCACTCTGTCACTTAGG - Intergenic
999179355 5:149658016-149658038 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1000027091 5:157368756-157368778 AGTCTCTCACTCTGGCTCATGGG - Intronic
1000786068 5:165545186-165545208 AGAATATCACTCTGTCACACAGG - Intergenic
1000912156 5:167035763-167035785 ACAGTTTCACTCTGTCACCTAGG + Intergenic
1001511745 5:172328150-172328172 ACTCTCTCACTCTGTCACTCAGG + Intronic
1002041755 5:176519876-176519898 ACAGTATCACTCTGTCACCCAGG - Intergenic
1003019824 6:2500162-2500184 ATTATCTCACTCTGTCACCTAGG + Intergenic
1004163013 6:13230988-13231010 TCTCTCTCTCTCTGTCACCTGGG - Intronic
1004250806 6:14021780-14021802 CCTCTCTCACTCTGTCACCCAGG + Intergenic
1004462736 6:15853645-15853667 ACAGTCTCACTCTGTCACACAGG + Intergenic
1004974627 6:20950942-20950964 ACTGTTTCACTCTGTCACCCAGG - Intronic
1005486667 6:26306856-26306878 ACTCTGTCACTCTGTTACCCAGG - Intergenic
1005518191 6:26574269-26574291 AGTCTGTCACTCTGTCACCCAGG - Intergenic
1005773562 6:29103390-29103412 ACGGTCTCACTCTGTCACACAGG + Intergenic
1005887881 6:30111055-30111077 AGTCTCTCACTCTGTCACTCAGG + Intronic
1005915599 6:30348124-30348146 ACAGTCTCACTCTGTCACACAGG - Intergenic
1005966058 6:30727423-30727445 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1005991671 6:30906996-30907018 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1006710361 6:36063561-36063583 CATATATCACTCTGTCACCTGGG - Intronic
1006841374 6:37029987-37030009 AGTCTGTCACTCTGTCACCCAGG + Intergenic
1007900403 6:45406438-45406460 AGTCTCTCACTCTGTCACCCAGG + Intronic
1008322752 6:50137311-50137333 ACTATATAACTTTCTCACATGGG - Intergenic
1008913288 6:56759423-56759445 AGTCTCTCACTCTGTCACCCAGG - Intronic
1009391520 6:63149290-63149312 AGTTTCTCACTCTGTCACATAGG - Intergenic
1009460582 6:63908083-63908105 TCTCTATCAATCTATAACATTGG + Intronic
1009713337 6:67353647-67353669 ACTGTATTACTCTTTCAAATTGG + Intergenic
1009970925 6:70624798-70624820 ACTGTCTCACCCTGTCACCTAGG - Intergenic
1010180622 6:73082914-73082936 AGGGTCTCACTCTGTCACATAGG + Intronic
1010645565 6:78384509-78384531 ACGGTCTCACTCTGTCACACAGG + Intergenic
1011171794 6:84513058-84513080 ACTCTGTCACTCTGTCACCCAGG + Intergenic
1011583509 6:88899286-88899308 AGCCTATCACTCTGTCACCTAGG + Intronic
1011666177 6:89636703-89636725 ACTGTCTCACTCTGTCACCCAGG + Exonic
1011692149 6:89879934-89879956 AATCTCTCACTCTGTCACCCAGG - Intergenic
1011763942 6:90598735-90598757 AAGCTGTCACTCTGTCACACAGG - Intergenic
1011798229 6:90981420-90981442 ACTGTCTCACTCTGTCACCTAGG + Intergenic
1012484012 6:99700324-99700346 GGTGTCTCACTCTGTCACATGGG + Intergenic
1012988398 6:105899342-105899364 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1013381503 6:109576854-109576876 AGACTCTCACTCTGTCACCTAGG + Intronic
1013754416 6:113444167-113444189 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1013834052 6:114311566-114311588 ACAGTCTCACTCTGTCACACAGG + Intronic
1014290540 6:119552916-119552938 ACACCATCACTGTGCCACATTGG + Intergenic
1015602021 6:134919932-134919954 AATGTCTCACTCTGTCACCTGGG + Intronic
1015765535 6:136712205-136712227 ACTCTGTCACTCTATCACCCAGG + Intronic
1017142265 6:151201955-151201977 ACGGTCTCACTCTGTCACCTAGG - Intergenic
1017247345 6:152240699-152240721 ACTCTATAACTCTATGAGATAGG + Intronic
1017474640 6:154777153-154777175 ACACTCTCACTCTGTCACCCAGG - Intronic
1017568301 6:155712557-155712579 ACCCTGTCATTCTGTCACATTGG - Intergenic
1017733991 6:157343871-157343893 AGAGTCTCACTCTGTCACATAGG - Intergenic
1017834511 6:158165179-158165201 AGTCTCTCACTCTGTCACCCAGG + Intronic
1019680989 7:2349464-2349486 AGTTTATCACTCTGTCACTCAGG + Intronic
1020189106 7:5981270-5981292 ACTGTCTCACTCTGTCACCCAGG + Intronic
1020293810 7:6743387-6743409 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1021537427 7:21721595-21721617 TCTTTCTCTCTCTGTCACATGGG - Intronic
1021733878 7:23623568-23623590 ACAGTCTCACTCTGTCACCTAGG - Intronic
1021804873 7:24344742-24344764 GCTCTGTCACTCTGTCACCCAGG - Intergenic
1022178110 7:27891805-27891827 ACTGTATCACTCTATCACCTAGG - Intronic
1022495045 7:30847763-30847785 AGGGTATCACTCTGTCACCTAGG + Intronic
1022722566 7:32954268-32954290 AGGCTCTCACTCTGTCACCTAGG + Intergenic
1022797768 7:33745730-33745752 AGTGTCTCACTCTGTCACCTGGG - Intergenic
1023710020 7:42982235-42982257 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1023789669 7:43743647-43743669 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1023878482 7:44305757-44305779 ACTCCATCACTCGGTCACGCTGG + Intronic
1024012568 7:45282546-45282568 AGAGTATCACTCTGTCACCTGGG + Intergenic
1024934730 7:54700707-54700729 ACAGTCTCACTCTGTCACTTAGG + Intergenic
1025050308 7:55728664-55728686 AGGCTTTCACTCTGTCACCTAGG - Intergenic
1025097833 7:56111021-56111043 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1025902185 7:65753560-65753582 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1025955448 7:66179171-66179193 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1026072579 7:67135328-67135350 AGTCTCTCACTCTGTCACCCAGG + Intronic
1026253895 7:68694050-68694072 ACAGTCTCACTCTGTCACCTAGG - Intergenic
1026999473 7:74642334-74642356 TCTCTCTCACTCTGTCACCCAGG - Intergenic
1027360015 7:77398740-77398762 AGGGTATCACTCTGTCACTTGGG - Intronic
1027487222 7:78776991-78777013 ACTTTCTCACCCTGTCTCATAGG + Intronic
1027683579 7:81252901-81252923 ACTTTATCACTGTGTAACTTTGG + Intergenic
1027859907 7:83564392-83564414 AGACTCTCACTCTGTCACCTTGG - Intronic
1027941171 7:84681993-84682015 ACTCTGTCACTTTTTCACCTTGG - Intergenic
1028026524 7:85848989-85849011 TCTGTCTCACTCTGTCACAATGG + Intergenic
1029726240 7:102407187-102407209 ATTCTCTCACTCTGTCACCCAGG - Intronic
1030402359 7:109067883-109067905 ACTGTCTCACTCTGTCACCCAGG - Intergenic
1031055579 7:116989811-116989833 AGGGTATCACTCTGTCACCTAGG - Intronic
1032126165 7:129194806-129194828 ACAGTCTCACTCTGTCACCTAGG + Intronic
1032373020 7:131378802-131378824 AGTCTCTCACTCTGTCACCCAGG - Intronic
1032718844 7:134534145-134534167 ACACTCTCACTCTGTCACCCAGG + Intronic
1032814205 7:135454856-135454878 ACGCTGTCACTCTGTCACACAGG - Intronic
1032930580 7:136664121-136664143 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1033069499 7:138189118-138189140 ACTCTGTCACTCTGTCACCTAGG - Intergenic
1033888719 7:145981139-145981161 ACACTCTCACTCTGTCACCCAGG + Intergenic
1034145671 7:148869369-148869391 ACAGTCTCACTCTGTCACACAGG + Intronic
1034524689 7:151650187-151650209 GCTCTCTCACTCTGTCACTCAGG - Intronic
1036377820 8:8215633-8215655 ACGGTGTCACTCTGTCACTTAGG - Intergenic
1036814670 8:11892727-11892749 AGACTCTCACTCTGTCACCTAGG + Intergenic
1036851746 8:12207510-12207532 ACGGTCTCACTCTGTCACTTAGG + Intergenic
1036873113 8:12450029-12450051 ACGGTCTCACTCTGTCACTTAGG + Intergenic
1037169590 8:15874882-15874904 ACACTCTCACTCTGTCACCCAGG - Intergenic
1037620707 8:20561159-20561181 ACTGTGTCACTCTGTCACCCAGG - Intergenic
1038229005 8:25683506-25683528 TCTCTCTCACTCTGTCACCTAGG + Intergenic
1038708163 8:29915655-29915677 AGGCTCTCACTCTGTCACCTAGG + Intergenic
1039052681 8:33509107-33509129 ACATTATCACTCTGTCGCCTGGG - Intronic
1039064403 8:33596554-33596576 ACAGTATCACTCTGTCACCCAGG - Intronic
1039233513 8:35475232-35475254 CCTTTATCCCTCTGTCTCATTGG - Intronic
1039957209 8:42216747-42216769 ACGGTCTCACTCTGTCACCTAGG - Intergenic
1040422466 8:47252972-47252994 ACTCTGTCACTCTGTTACCCAGG + Intergenic
1040948828 8:52915251-52915273 ACTCTATCACCATGTCAGCTTGG - Intergenic
1041454047 8:58038724-58038746 TCTCAATCACTCTGTCACCCAGG - Intronic
1042682487 8:71401192-71401214 CATCTATCAATCTGTCACCTAGG - Intergenic
1042921797 8:73927369-73927391 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1043406823 8:79944719-79944741 AAGGTCTCACTCTGTCACATAGG + Intronic
1043590123 8:81821673-81821695 AATCGCTAACTCTGTCACATTGG + Intronic
1044450161 8:92326611-92326633 AGGCTCTCACTCTGTCACCTAGG + Intergenic
1044662439 8:94604887-94604909 ACAGTCTCACTCTGTCACCTAGG + Intergenic
1045492229 8:102678928-102678950 AATGTCTCACTCTGTCACCTAGG + Intergenic
1045742127 8:105373794-105373816 ACGCTGTCCCTCTGTCAGATAGG + Intronic
1045990309 8:108298829-108298851 TCTCTCTCACTCTGTCACCCAGG + Intronic
1046423052 8:114009421-114009443 ACTCTATGCATCTGTCAAATAGG - Intergenic
1046490495 8:114946127-114946149 ACTCCATTATTCTGACACATGGG - Intergenic
1046698822 8:117376682-117376704 ACTCTATATCTCTGTGACACCGG - Intergenic
1047287901 8:123504052-123504074 TCTCTCTCACTCTGTCACCCAGG - Intronic
1047599785 8:126414580-126414602 AGGCTATCACTCTGTCACCAGGG + Intergenic
1047915225 8:129575742-129575764 AACCTATCACTCTGTCACCCAGG + Intergenic
1047950921 8:129933846-129933868 ACTCTGTCACCCTGTCACCCAGG - Intronic
1048773509 8:137920437-137920459 ACTCTGTCTCTCTGTGACCTAGG - Intergenic
1048842554 8:138578395-138578417 TCTCTGTCACTCAGTCCCATGGG + Intergenic
1049258555 8:141626661-141626683 ACTCTGTCACTGTGTGACCTTGG + Intergenic
1049559283 8:143300320-143300342 ACAGTCTCACTCTGTCACACAGG - Intergenic
1049955933 9:692974-692996 AGTGTATCACTCTGTCACTTAGG - Intronic
1049959865 9:728224-728246 CCTCTGTCACTCTGTCACCCAGG + Intronic
1050452286 9:5795750-5795772 ACAGTCTCACTCTGTCACCTAGG - Intronic
1050656799 9:7837423-7837445 TCTCACTCACTCTGTCACCTAGG + Intronic
1050816151 9:9814823-9814845 AGAATTTCACTCTGTCACATGGG + Intronic
1050850600 9:10280627-10280649 AGGCTCTTACTCTGTCACATAGG + Intronic
1051969824 9:22875298-22875320 ACTCTCTCACTCTGTTACCCAGG + Intergenic
1052942917 9:34144595-34144617 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1055503177 9:76922086-76922108 AGACTATCACTCTTTCACATGGG + Intergenic
1055805458 9:80088045-80088067 ACAGTATCACTCTGTCACTGAGG - Intergenic
1056318212 9:85411810-85411832 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1056463599 9:86832112-86832134 ACACTCTCACTCTGTCACCCAGG + Intergenic
1056523087 9:87418216-87418238 ACTGTCTCACTGTGTCACCTAGG + Intergenic
1056976992 9:91266922-91266944 GCACTAGCAGTCTGTCACATGGG - Intronic
1057375827 9:94521651-94521673 ACTCTGTCACTCTGTCACCCAGG - Intergenic
1057395682 9:94677738-94677760 AGAGTATCACTCTGTCACCTAGG - Intergenic
1057664315 9:97032370-97032392 TCTCTCTCACTCTGTCACCAAGG - Exonic
1058155229 9:101507259-101507281 ACTCTATCTATCTGTTACAATGG + Intronic
1058671416 9:107363536-107363558 ACTATCTCACTCTGTCACTCAGG - Intergenic
1058698602 9:107582184-107582206 AGTCTCTCACTCTGTCACCCAGG + Intergenic
1058782470 9:108352222-108352244 CCCCTATCTCTCTGCCACATTGG - Intergenic
1058850656 9:109008919-109008941 ATTCTGTCACTCTGTCACCCAGG + Intronic
1058870670 9:109198882-109198904 ACTCTGTCACTCTGTCACCCAGG - Intronic
1058901096 9:109443099-109443121 AGGGTATCACTCTGTCACAAAGG + Intronic
1058917743 9:109584113-109584135 ACTCTGTCACTCTGTCACCCAGG + Intergenic
1059259880 9:112965694-112965716 ACTCTGTCACTCTGTCACCCAGG + Intergenic
1059297614 9:113285837-113285859 ACAGTGTCACTCTGTCACCTAGG - Intronic
1059523852 9:114970151-114970173 ACTTTTTCACTCTGTCACCCTGG - Intergenic
1059661264 9:116403946-116403968 ACTTTATTAATCTGTCAAATGGG + Intergenic
1060079537 9:120629613-120629635 ACTGTCTCACTCTGTCACCCAGG - Intronic
1060519804 9:124287797-124287819 ACAGTGTCACTCTGTCACCTAGG - Intronic
1060630987 9:125158685-125158707 ACAGTATCACTCTGTCACCCAGG + Intronic
1061025964 9:128049730-128049752 CCTCACTCACTCTGTCACCTAGG - Intergenic
1061032875 9:128097452-128097474 ACAGTTTCACTCTGTCACACAGG + Intronic
1061555738 9:131367555-131367577 AGTGTCTCACTCTGTCACCTAGG - Intergenic
1061628645 9:131857287-131857309 TCTCACTCACTCTGTCACCTAGG + Intergenic
1062660151 9:137626495-137626517 TCTCTCTCACTCTGTCACCCAGG - Intronic
1062674995 9:137737184-137737206 AGTGTCTCACTCTGTCACCTAGG - Intronic
1185800218 X:3003692-3003714 AGTCTCTCACTCTGTCACCTAGG - Intergenic
1186233310 X:7479624-7479646 AGTGTATCACTCTGTCACCCAGG - Intergenic
1187034949 X:15528630-15528652 AGGGTCTCACTCTGTCACATAGG - Intronic
1187056513 X:15746061-15746083 GCTCTGTCACTCTGTCACTCAGG + Intronic
1187160599 X:16761645-16761667 AGTCTCTCACTCTGTCACCCAGG - Exonic
1187262790 X:17702659-17702681 ACAGTCTCACTCTGTCACCTAGG - Intronic
1187312086 X:18154758-18154780 ACAGTATCACTCTGTCACCCAGG - Intergenic
1187326852 X:18298792-18298814 ACAGTCTCACTCTGTCACCTAGG - Intronic
1187411627 X:19055757-19055779 TCTCTCTCACTCTGTCACCCAGG + Intronic
1187723196 X:22173278-22173300 CCTCTGTAACTCTCTCACATTGG + Intronic
1187772563 X:22717206-22717228 AAGGTATCACTCTGTCACACAGG + Intergenic
1187952351 X:24483736-24483758 AGGCTCTCACTCTGTCACCTAGG + Intronic
1188144338 X:26591250-26591272 ACTCTATTACTCTTTCAGACAGG + Intergenic
1188858594 X:35228698-35228720 ACCCTATTATTCTGACACATGGG - Intergenic
1189245034 X:39556883-39556905 ACAGAATCACTCTGTCCCATGGG + Intergenic
1189329127 X:40132351-40132373 ACAGTATCACTCTGTCACCCAGG + Intronic
1189449437 X:41114504-41114526 ACTATCTCACTCTGTCACCCAGG + Intronic
1189606988 X:42689327-42689349 TCTCACTCACTCTGTCACCTGGG - Intergenic
1189747767 X:44187762-44187784 ACTTTCTCACTCTGTCACCCAGG - Intronic
1189816146 X:44825912-44825934 ACAGTTTCACTCTGTCACCTAGG - Intergenic
1190392634 X:49947298-49947320 ACTCCAGCACTCTGTCTCAGTGG - Intronic
1191205420 X:57828234-57828256 ACGGTCTCACTCTGTCACAGAGG + Intergenic
1191977745 X:66892439-66892461 ACTCTCTGACTCTGTGACTTTGG - Intergenic
1192113668 X:68390571-68390593 ACAGTTTCACTCTGTCACCTGGG - Intronic
1193041878 X:77012409-77012431 AATCTATAAGTCTGTAACATTGG + Intergenic
1193049899 X:77088768-77088790 TCTCTATGCCTCTGTCATATTGG - Intergenic
1193138937 X:78005053-78005075 AATGTCTCACTCTGTCACCTAGG - Intronic
1193239169 X:79146181-79146203 TTTCTATCTCTCTCTCACATAGG - Intergenic
1193693623 X:84680046-84680068 ACATTATCACTGTGCCACATTGG - Intergenic
1195110239 X:101640817-101640839 AGTCTCTCGCTCTGTCACCTAGG + Intergenic
1195670457 X:107465442-107465464 ACTGTATCACTCTGTCACCCAGG - Intergenic
1196667374 X:118330659-118330681 AATCTCTCACTCTGTCACCCAGG - Intergenic
1196680379 X:118463946-118463968 ACACTATCACTTTGGCCCATTGG + Intergenic
1196712106 X:118773463-118773485 AGTCTCTCACTCTGTCACCCAGG - Intronic
1196802135 X:119553126-119553148 ACAGTCTCACTCTGTTACATAGG - Intronic
1197311905 X:124915497-124915519 AAAGTCTCACTCTGTCACATAGG - Intronic
1197373471 X:125654032-125654054 ACTCTGTCACTGTGTCACCCAGG + Intergenic
1197751617 X:129967859-129967881 ATTCTGTCACTCTGTCACTCAGG + Intergenic
1197941848 X:131798247-131798269 AGTCTCTCACTCTGTCACCCAGG - Intergenic
1197982966 X:132237785-132237807 ACTCTGTCACTGTGTCACCCAGG + Intergenic
1198104320 X:133448041-133448063 ACAGTATCACTCTGTCACCCAGG + Intergenic
1198183172 X:134229773-134229795 ACTCTCTCGCTCTGTCACCCAGG - Intergenic
1198470957 X:136946413-136946435 ACAGTATCACTCTGTCACCCAGG - Intergenic
1198555073 X:137784045-137784067 ACACTCTCACTCAGTCACCTAGG - Intergenic
1199891896 X:152092765-152092787 AGGGTATCACTCTGTCACCTAGG - Intergenic
1200094870 X:153652914-153652936 ACTCTGTCACTCTGTCATGCAGG - Intergenic
1201100610 Y:10668803-10668825 AAGATCTCACTCTGTCACATTGG + Intergenic
1201101044 Y:10672948-10672970 AGTATTTCACTCTGTCACACAGG + Intergenic
1201103092 Y:10693271-10693293 AGTATCTCACTCTGTCACACAGG + Intergenic
1201109237 Y:10786869-10786891 AGTATATCACTCTGTTACACAGG + Intergenic
1201131840 Y:10958411-10958433 ACTATATCACTGTGTCACGCAGG + Intergenic
1201133055 Y:10969313-10969335 ACAATGTCACTCTGTCACAAAGG + Intergenic
1201173763 Y:11294970-11294992 AATATTTCACTCTGTCACACTGG + Intergenic
1201255155 Y:12100159-12100181 ACTGTCTCACTCTGTCACCCAGG + Intergenic
1201331097 Y:12822388-12822410 ACAGTATCACTCTGTCACCCAGG + Intronic
1201851672 Y:18489857-18489879 ACTGGATCCCACTGTCACATGGG - Intergenic
1201881648 Y:18830523-18830545 ACTGGATCCCACTGTCACATGGG + Intergenic
1202296933 Y:23368499-23368521 AGTCTCTCACTCTGTCACCCTGG + Intergenic
1202346954 Y:23941143-23941165 ACTGGATCCCACTGTCACATGGG + Intergenic
1202523817 Y:25728947-25728969 ACTGGATCCCACTGTCACATGGG - Intergenic
1202573874 Y:26302098-26302120 AGTCTCTCACTCTGTCACCCTGG - Intergenic
1202622967 Y:56831521-56831543 AGGATGTCACTCTGTCACATAGG + Intergenic