ID: 977144806

View in Genome Browser
Species Human (GRCh38)
Location 4:93425433-93425455
Sequence CTTTCCCCAGAAACTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 1, 2: 3, 3: 48, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977144806_977144810 12 Left 977144806 4:93425433-93425455 CCTTCTGGAGTTTCTGGGGAAAG 0: 1
1: 1
2: 3
3: 48
4: 438
Right 977144810 4:93425468-93425490 CTCAAGCCCTTCTGACTTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977144806 Original CRISPR CTTTCCCCAGAAACTCCAGA AGG (reversed) Intronic
900535306 1:3174107-3174129 CTTCCCCTAGGACCTCCAGAGGG - Intronic
900779427 1:4608083-4608105 CCTTTCCCAGAACCTTCAGAGGG - Intergenic
900801464 1:4739470-4739492 ATTTCCCCAGAAAGCTCAGAAGG - Intronic
901652719 1:10752318-10752340 ATTACCCCAGAAACTTCAGGTGG + Intronic
902238152 1:15070893-15070915 ATTTTCCCAGACACCCCAGATGG + Intronic
904310708 1:29627814-29627836 CCTTCCCCAGCATCTTCAGACGG + Intergenic
904353962 1:29926608-29926630 CTCTCCCCTGAACCTCCAGGGGG - Intergenic
904364917 1:30004289-30004311 GTTCTCCTAGAAACTCCAGAAGG + Intergenic
905930076 1:41780579-41780601 CTTTCCCCAGAGCCTCCTGCAGG - Intronic
906891504 1:49720971-49720993 CTTTACCCAGGAAGTCCAGCTGG - Intronic
908009913 1:59765434-59765456 CTTTGCCCAGAGTCACCAGATGG + Intronic
909358979 1:74740883-74740905 CTTGACCCAGAAAGTCCAGCTGG + Intronic
909747212 1:79112724-79112746 CTTGACCCAGAAAGTCCAGCTGG - Intergenic
910103961 1:83610529-83610551 CTTTCTTCAGATCCTCCAGAAGG + Intergenic
910578096 1:88790005-88790027 TTATCCCCAAAAGCTCCAGAAGG + Intronic
911247858 1:95538641-95538663 CTTGACCCAGAAAGTCCAGCTGG + Intergenic
911462340 1:98206482-98206504 TTTTCCCTAGAGCCTCCAGAAGG - Intergenic
912322126 1:108723817-108723839 CTATTCCCAGCAACTCCAGTTGG - Intronic
912819778 1:112857640-112857662 TTTTTCCCAGAGCCTCCAGAAGG + Intergenic
912894013 1:113566068-113566090 ATTACCCTAGAAACTCCAGAAGG + Intronic
913701533 1:121379246-121379268 CTTCACCCAGAGACTCCACAAGG - Intronic
913706100 1:121424419-121424441 CTTTCCCAAAATAGTCCAGAAGG - Intergenic
914042092 1:144059714-144059736 CTTCACCCAGAGACTCCACAAGG - Intergenic
914135997 1:144900773-144900795 CTTCACCCAGAGACTCCACAAGG + Intronic
914432752 1:147634034-147634056 AATTCCTCAGAAACTTCAGAGGG - Intronic
914687509 1:149994007-149994029 CTTTCCACAAAAACTACAAAAGG + Intronic
914991959 1:152506555-152506577 TTTTCCCTAGAGCCTCCAGAAGG - Intergenic
916292770 1:163184798-163184820 TTTCCCCCAGAACCTCCAGGAGG + Intronic
919178574 1:194052371-194052393 TTTTCCCTAGAGCCTCCAGAAGG + Intergenic
920488959 1:206397966-206397988 CTTCACCCAGAGACTCCACAAGG - Intronic
920739344 1:208565486-208565508 CTTTCCCTTTAAAATCCAGAGGG + Intergenic
921054780 1:211535496-211535518 CTTTCCCCAGGAGGGCCAGAGGG + Intergenic
921189097 1:212694191-212694213 TCTTCTCCAGAACCTCCAGAAGG + Intronic
921913967 1:220585510-220585532 CTTTCCCCAGTAATTAAAGAGGG - Intronic
922466031 1:225846024-225846046 CATTCCCCAGAATCCCCAGGAGG + Exonic
923655942 1:235917151-235917173 CTTTCTACAAGAACTCCAGAAGG + Intergenic
923674436 1:236067226-236067248 CTTTCCTCAGCAACTACAGGAGG + Intergenic
923917482 1:238525425-238525447 CCTTCCCCACAAATTACAGAGGG - Intergenic
924473819 1:244366522-244366544 CTTCTTCCAGAAACTACAGAAGG + Intronic
1062922985 10:1293836-1293858 TTTTCAGCAGAAAGTCCAGATGG + Intronic
1065198934 10:23295318-23295340 CTTTCCCCAGAATGTCCAGCTGG + Intronic
1065753481 10:28909878-28909900 CTTTCCCAGGAAAATTCAGAAGG - Intergenic
1066142043 10:32514485-32514507 CCTTCCCCAGATATTTCAGAGGG + Intronic
1066209364 10:33222224-33222246 CTTTCCCAAGAATCCCCAGAAGG + Intronic
1067719857 10:48720082-48720104 GCTTGCCCAGCAACTCCAGAAGG + Exonic
1068599064 10:58936601-58936623 CTTTCAGCTGAGACTCCAGATGG + Intergenic
1069086580 10:64146923-64146945 ATTGCCCCTGAACCTCCAGAAGG + Intergenic
1069467994 10:68659158-68659180 ATTACCCCAGAAGCTCAAGAGGG - Intronic
1069717431 10:70530035-70530057 GGTCCTCCAGAAACTCCAGAAGG + Exonic
1069788433 10:71004497-71004519 CCTTCCCCAGCAGCCCCAGATGG + Intergenic
1073814698 10:107193748-107193770 TTTTCCCCAGAGCTTCCAGAAGG + Intergenic
1073839219 10:107479368-107479390 TTTTCCACTGAAACCCCAGACGG - Intergenic
1073887022 10:108050980-108051002 TTCTCCCCAGAGCCTCCAGAAGG + Intergenic
1073952879 10:108830806-108830828 TATTCCCTAGAGACTCCAGAAGG + Intergenic
1074234222 10:111568701-111568723 CTTTCCTCAGAAAGTGCACATGG - Intergenic
1074540879 10:114364387-114364409 TCTTCCCCAGAGACTCCAGAGGG - Intronic
1074779089 10:116787734-116787756 CTTTTTCCAAAAACTTCAGAAGG + Intergenic
1074863038 10:117527427-117527449 CTTTCCCAAGAAACTCCTGTGGG - Intergenic
1075487569 10:122838085-122838107 CTTTCCCCAGTAAGTACATAAGG + Intronic
1077467541 11:2740670-2740692 CTCTCCCTAGAGCCTCCAGAAGG - Intronic
1077546295 11:3171619-3171641 CCTCCCCCAGAGCCTCCAGAAGG - Intergenic
1077594557 11:3520598-3520620 CTTACCCTAGAAACTCCTGGAGG + Intergenic
1078098670 11:8315894-8315916 CTCTGCCCAGAAACTCCAGTGGG + Intergenic
1079359085 11:19755549-19755571 CCTTCCCCAGAGGCTCTAGAAGG - Intronic
1079540282 11:21564876-21564898 CTATTCCCAGAAACTGAAGATGG + Intronic
1080704756 11:34679885-34679907 CTTTCCCCAGAAACCTCCCATGG - Intergenic
1081659526 11:44879527-44879549 CTTCCCCCAGATATTCCACATGG - Intronic
1081788501 11:45766094-45766116 TCTCCCCCAGAAGCTCCAGAAGG + Intergenic
1082266782 11:50127701-50127723 TTTTCCCAAGAAATGCCAGAAGG - Intergenic
1082287499 11:50333577-50333599 CTTCCCCCCGAAACTTCAGTTGG + Intergenic
1082289307 11:50350867-50350889 TTTTCCCAAGAAATGCCAGAAGG + Intergenic
1083093877 11:60229461-60229483 CGTTCGCCTGAGACTCCAGAAGG + Intronic
1083419240 11:62544169-62544191 CTTTCCCCAGGACTTCCTGAGGG + Intronic
1084580967 11:70023049-70023071 CTCTCCCTGGAACCTCCAGAAGG + Intergenic
1084678226 11:70649288-70649310 CTCTCCCCAGGATCTTCAGATGG - Intronic
1085221178 11:74874824-74874846 ACTTCCCTAGAAAATCCAGATGG + Intronic
1085638629 11:78177309-78177331 TTCTCCTCAGACACTCCAGATGG - Intronic
1086934370 11:92728711-92728733 TCTTCCCCAGAACCTCCAGAGGG - Intronic
1087026555 11:93655460-93655482 CCTTCCCTAGAATCTTCAGAGGG + Intergenic
1087928303 11:103946374-103946396 ACTTCCCCAGATACTCCAAAAGG + Intronic
1088068682 11:105754202-105754224 CTGTCCCTAGAAATTCCAGGGGG + Intronic
1088532640 11:110827450-110827472 TTCTCCCCAGAACCTCCGGAGGG + Intergenic
1088567970 11:111193289-111193311 ATTTCCTCAAAAACTCTAGAAGG - Intergenic
1088576734 11:111279450-111279472 TTCTCCCCAGAGGCTCCAGAGGG - Intronic
1091073450 11:132591184-132591206 ATTTCCACAGCAACTCCAAAGGG - Intronic
1093655251 12:21687442-21687464 CTTCCCCCAGGAACTGCAGAGGG - Intronic
1093786630 12:23199298-23199320 TTTTCCCCTAAACCTCCAGAAGG + Intergenic
1094110651 12:26858771-26858793 TTCTCCCCAGAGCCTCCAGAGGG + Intergenic
1095062116 12:37709271-37709293 CTTTTCACAGAAACTGTAGAGGG - Intergenic
1095676286 12:44922676-44922698 CTTCCCCCAGAGACCTCAGAGGG + Intergenic
1096055928 12:48651865-48651887 CATTCCCCAGAAAGTGCTGACGG + Intergenic
1096561350 12:52438052-52438074 CTTTCCATATAAACTCCAGGAGG - Intergenic
1096759533 12:53829029-53829051 TTTTCCCCAGAGAAACCAGAGGG + Intergenic
1097610573 12:61814911-61814933 TTTTCCCTAGAGCCTCCAGAAGG + Intronic
1098816024 12:75163281-75163303 CCTTGGCCAAAAACTCCAGAGGG + Intronic
1098822438 12:75249957-75249979 TTTTCCCTAGAACCTTCAGAAGG - Intergenic
1099585219 12:84506040-84506062 CTAAACCCAGAAACACCAGAAGG - Intergenic
1099771347 12:87062030-87062052 CTTTCCCTAGCACCTTCAGAGGG + Intergenic
1099968349 12:89474917-89474939 TTTTTCCCACAAACTCCACAAGG - Intronic
1100046773 12:90391992-90392014 TCTCCCCCAGAAACTCCACAGGG - Intergenic
1101281945 12:103266867-103266889 TTTTCCCCAGATACCCTAGAAGG - Intronic
1101305172 12:103520914-103520936 CCTTCCCCCAAAACTCCAGAAGG + Intergenic
1101328115 12:103734804-103734826 TCTCCCTCAGAAACTCCAGAAGG - Intronic
1101560633 12:105854368-105854390 CTCACCTCAGAATCTCCAGAGGG + Intergenic
1101998468 12:109541740-109541762 TTCTCCCCAGAGCCTCCAGAGGG - Intergenic
1103007771 12:117435678-117435700 CCTTCCCACCAAACTCCAGAGGG - Intronic
1103414357 12:120733993-120734015 ATTTCCCCAGAGCCTGCAGAGGG - Intronic
1104011094 12:124930727-124930749 TCTTCCCCAGAGCCTCCAGAAGG - Intergenic
1104119618 12:125786880-125786902 CCTTCCCTGGAAACTTCAGAGGG + Intergenic
1104400624 12:128473010-128473032 CCTTCCCTAGATCCTCCAGAAGG - Intronic
1104724176 12:131065974-131065996 GTGTCCCCAGAAACTCCACAGGG - Intronic
1106223266 13:27765387-27765409 TTTTCCCCAGAGCCTCCAGGAGG - Intergenic
1107047177 13:36006008-36006030 CTTTCCCCCGACCCTCCAGCAGG - Intronic
1108229150 13:48319134-48319156 CATTCCCCACAAGCTCCCGAAGG - Intronic
1109629342 13:65024170-65024192 CTTTCAGCAGAAACTCTACAAGG - Intergenic
1109724037 13:66316002-66316024 CTTTCCTCAGAATTTCTAGAAGG - Intronic
1111234684 13:85393398-85393420 CTTTCCACTCAAAATCCAGAGGG - Intergenic
1111342700 13:86909192-86909214 TTATCCTGAGAAACTCCAGAGGG + Intergenic
1111394293 13:87644570-87644592 CTTTCTCCAAAAAGTCCACAGGG + Intergenic
1111516095 13:89333786-89333808 CTTTCCCCAGAAATCAGAGATGG + Intergenic
1112408697 13:99143537-99143559 TTTCCCCCAGAGCCTCCAGAAGG + Intergenic
1112582201 13:100686203-100686225 TGTCCCTCAGAAACTCCAGAAGG - Intergenic
1113437175 13:110302212-110302234 CTGTACCCAGAAACATCAGAGGG + Intronic
1115246259 14:31299068-31299090 CTTGCTCCAGAAACTCAAGCTGG + Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117222632 14:53621066-53621088 ATTTCCCTAGAAACCCCAGTGGG - Intergenic
1118314341 14:64716588-64716610 CTTTTCCCAGAATCCACAGAGGG + Intronic
1118511348 14:66477631-66477653 ATTTGCCCAGAAACCCCAGAAGG + Intergenic
1119113174 14:71994777-71994799 CCTTCCCCAGAGCCTTCAGAGGG + Intronic
1119630548 14:76228211-76228233 CTTTACCCTGAAACCCCAGAAGG + Intronic
1119693771 14:76696684-76696706 TTCTCCCCAGAAACTCAAAATGG + Intergenic
1120058274 14:79951022-79951044 CTTTCAACAGGAACTGCAGAGGG + Intergenic
1120378683 14:83744882-83744904 CTTTCACCTGAGACTGCAGAGGG - Intergenic
1120688783 14:87569187-87569209 TTTTCCCTAGAGCCTCCAGAAGG + Intergenic
1121799177 14:96759121-96759143 GTTTCCCCTGAACCTGCAGAGGG + Intergenic
1122553868 14:102565841-102565863 ATTTCCCCAGAAACTAGAGGAGG - Intergenic
1122929638 14:104927402-104927424 CTGTCCCCAGCACCTCCAGCAGG - Intronic
1127506828 15:59606008-59606030 CTTTCCCTAGAAAATGCAGGAGG + Intronic
1127706522 15:61552613-61552635 CTGTCCTCAAGAACTCCAGAGGG + Intergenic
1127720688 15:61695804-61695826 CTGTCCCTAGAAACTTCAGAGGG + Intergenic
1128530059 15:68438847-68438869 CTTTCTCCAAATACACCAGAGGG - Intergenic
1130655571 15:85789917-85789939 ATTTTCCCAGTAACTCCAAAGGG - Intronic
1130664650 15:85859644-85859666 CTTTCCCCATAACCTCCTTAGGG + Intergenic
1130885946 15:88092694-88092716 CTCTACCCAGAGCCTCCAGAGGG - Intronic
1131186994 15:90283151-90283173 GTATCCCCAGCAACTACAGATGG + Intronic
1131478716 15:92763758-92763780 CTGAACCCAGCAACTCCAGAAGG + Intronic
1131683397 15:94747306-94747328 GATTCCTCAGAAACTGCAGAGGG - Intergenic
1131730857 15:95279412-95279434 ATTTCCCCACAAACACCAAAGGG + Intergenic
1132802077 16:1759417-1759439 CATGCCCCAGAAACCCCAAAAGG - Intronic
1133921784 16:10160000-10160022 TCTTCCCCAGAGTCTCCAGAGGG + Intronic
1136173964 16:28505092-28505114 TTTTCCCCAGAGAATGCAGAGGG + Intronic
1136412813 16:30086683-30086705 CTCTCCCCAGACACACCAGGTGG - Exonic
1136639847 16:31554363-31554385 ATTTCCCCAGGGACTCCAGTAGG + Intergenic
1136664922 16:31802148-31802170 ATTTCCCCAGGGACTCCAGTAGG - Intergenic
1137713163 16:50581198-50581220 TTTTCCCCAGAATCTCCAGTGGG - Intronic
1138247068 16:55475646-55475668 CTTCCCCCAGAGGCTTCAGAGGG - Intronic
1138739934 16:59296291-59296313 CTTTCCCCAAAAATTACAGGGGG - Intergenic
1139210610 16:65073217-65073239 CTCTCCCCCAAAAATCCAGAAGG + Intronic
1140910538 16:79447559-79447581 CTTTGCCCAGATCCACCAGAGGG - Intergenic
1140980494 16:80104361-80104383 TCTTCCCCAGAACCTTCAGATGG - Intergenic
1141228058 16:82138140-82138162 CTTTCCCCAGAAAGCCCACTTGG + Intergenic
1141423947 16:83933681-83933703 CCTTCCCTGGAAGCTCCAGAGGG - Intronic
1141452140 16:84111656-84111678 CTCTCCACAGAGCCTCCAGACGG + Intronic
1141941319 16:87278030-87278052 CGTTCCCCAGAAACTCCAGAGGG + Intronic
1148026626 17:44593361-44593383 CAATCCCCAGAAACTCCAAAGGG - Intergenic
1149333296 17:55608565-55608587 TCTTCCCTAGAAACTTCAGAAGG - Intergenic
1149420527 17:56506500-56506522 CTCCCCCTAGAACCTCCAGAGGG + Intronic
1151291223 17:73151446-73151468 CTTTCTCAAGAAACTCCTGGAGG + Intergenic
1152012262 17:77725836-77725858 CTTGCCCTAGGACCTCCAGAGGG - Intergenic
1152086538 17:78222970-78222992 CTTTCTCCTGAAACTCCTGGAGG - Intronic
1153496495 18:5704934-5704956 CTTTCCCCTAACTCTCCAGAGGG - Intergenic
1154156377 18:11947620-11947642 CTTACCCCAGACACACCCGAAGG + Intergenic
1155291899 18:24350853-24350875 CTTTCTCAAGAAGCTCCTGAAGG + Intronic
1155498353 18:26464225-26464247 TTGTCCCCAGAGCCTCCAGAAGG - Intronic
1155927652 18:31674024-31674046 TTTTCCCCAGAGCCTCCAGAGGG + Intronic
1156277339 18:35596193-35596215 TTTTCCCCAGAGACCCCAAATGG + Intronic
1158222782 18:55167346-55167368 TCTTCCCCAGAGCCTCCAGAAGG - Intergenic
1158319668 18:56248986-56249008 CTGGCCTCAGAAACCCCAGAGGG + Intergenic
1158334674 18:56402895-56402917 CCTTCCCCAGAGCCTTCAGAGGG + Intergenic
1159141388 18:64399486-64399508 CTGTCCCAAGAAACTCCAGATGG - Intergenic
1159200951 18:65183337-65183359 TCTTCCCTAGAATCTCCAGAAGG + Intergenic
1159373935 18:67566684-67566706 CCTTCCCTAGAGCCTCCAGAAGG + Intergenic
1159978023 18:74740141-74740163 CATTCCCGAGAACCTCCAGAGGG - Intronic
1161071892 19:2266597-2266619 GGTTCCCCAGAAACTCCCCAGGG - Intronic
1161466140 19:4431673-4431695 CATTCACCAGAAAATTCAGAGGG + Intronic
1161777746 19:6273023-6273045 TTTTCCCAGGGAACTCCAGAGGG - Intronic
1162501568 19:11056989-11057011 CTTTCCCAGAAAATTCCAGAGGG - Intronic
1162567093 19:11450636-11450658 CTTGCCCCAGAACCTCAAGAAGG + Exonic
1163216897 19:15885753-15885775 CTTTCCCCAGACAGTCAGGATGG + Intronic
1163249561 19:16118418-16118440 CTTTCTCCAGAAGCTCCTGGAGG + Intronic
1163410038 19:17148460-17148482 CTTTCCCTAGAGACTCCAGAAGG - Intronic
1165554466 19:36617978-36618000 CTTTCCATCGAGACTCCAGAAGG - Intronic
1166007349 19:39916586-39916608 CTTTCCCCAGAAAGCCCACTGGG + Intronic
1166612586 19:44212426-44212448 CGTTTCCCAGAACTTCCAGAAGG - Intronic
1167180737 19:47901528-47901550 CCTTCCCCAGAGCCTCCAGAGGG + Intergenic
1167877649 19:52427663-52427685 CATTCCCCATTCACTCCAGAGGG - Intergenic
1168096688 19:54119836-54119858 CTTTCCCCAGAAACCTCCTATGG - Intronic
1168646896 19:58065151-58065173 CCTTCCCTAGAGCCTCCAGAAGG - Intronic
1202646335 1_KI270706v1_random:145344-145366 TTCTCTCCAGAACCTCCAGAAGG - Intergenic
926218998 2:10922773-10922795 CTTTCCTCAGAAAGTGCAGTGGG - Intergenic
926942334 2:18151704-18151726 CCTTCCCCAGCACCTTCAGAGGG + Intronic
927096562 2:19751625-19751647 ACACCCCCAGAAACTCCAGAGGG + Intergenic
927412351 2:22841655-22841677 CTTACCACAAAGACTCCAGAAGG + Intergenic
927479705 2:23442566-23442588 CCTTCCCCGGAGCCTCCAGAAGG + Intronic
928527941 2:32161602-32161624 CTATCCCCAGAAAGTCCTGCTGG - Intergenic
928942644 2:36742174-36742196 TTTTCCTCAATAACTCCAGAAGG - Intronic
929267934 2:39940045-39940067 CTGTGCCCAGAAAAACCAGAAGG - Intergenic
930035719 2:47083937-47083959 CTTTCCCCAGAAAATCATGTAGG + Intronic
930508436 2:52314158-52314180 CCTCCCCCAGAAACTGGAGATGG - Intergenic
930768960 2:55112864-55112886 GTTGCTCCAGAAACTCCAGCTGG - Intergenic
930800365 2:55437596-55437618 TTTCCCTCAGAACCTCCAGAAGG + Intergenic
932106348 2:68946391-68946413 CTTTGATCAGAGACTCCAGAGGG + Exonic
932602215 2:73135562-73135584 TTCTCCCCAGAGCCTCCAGAAGG - Intronic
932860975 2:75290924-75290946 TTTTCCCTAGAGCCTCCAGAGGG - Intergenic
932895466 2:75635342-75635364 CATTGCCCAGAAACTACAAATGG - Intergenic
933424434 2:82091713-82091735 CTTTCCCCAGATATTCAAAAAGG - Intergenic
934032848 2:88064099-88064121 CTTACCCTAGAACCTCCAGAGGG - Intergenic
934576509 2:95405122-95405144 CTTCCTCCAGAAACTAGAGAAGG + Intronic
934768310 2:96892858-96892880 ATTTCCCCAGAAACTGGAGCTGG - Intronic
937166548 2:119823936-119823958 CTTTCCACAGAGTCTCCACATGG - Intronic
937237466 2:120439255-120439277 CTTTCTCAAGAAACTACTGAAGG - Intergenic
937868162 2:126769275-126769297 CTTTCCCCAGAACCACCGGTAGG - Intergenic
940227870 2:151419151-151419173 CCTTCAGCAGATACTCCAGAAGG - Intronic
940757117 2:157696023-157696045 TTTCCCCTAGAACCTCCAGATGG + Intergenic
941195787 2:162449712-162449734 TTTCCCTCAGAACCTCCAGAAGG + Intronic
941396880 2:164984138-164984160 TTCTCCCCCGAACCTCCAGAGGG - Intergenic
942351898 2:175061450-175061472 TCTTCCCCAGAGCCTCCAGAAGG + Intergenic
944466698 2:200008532-200008554 TCTTCCCCAGAGCCTCCAGAAGG + Intronic
944698664 2:202226295-202226317 CTTTCCCTAGACACTCCATTTGG + Intronic
944976964 2:205064916-205064938 CTTCCCTCAGAAACACCAAATGG + Intronic
944988928 2:205212074-205212096 CTGTACCCAGAAAGGCCAGAGGG + Intronic
945121651 2:206463394-206463416 TCTTCCCTAGAACCTCCAGATGG + Intronic
945325538 2:208478349-208478371 CTCCCCCCAGCACCTCCAGAAGG - Intronic
945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG + Intronic
945865405 2:215169049-215169071 CTTTCCCAGGAAACTACTGAAGG + Intergenic
946387785 2:219395734-219395756 CCTTCCCTAGCATCTCCAGAGGG + Intronic
946655592 2:221942869-221942891 CTTTCCCCAGAAACACATCAGGG - Intergenic
946815181 2:223569841-223569863 CTTTCCTCAAAAACTCCACCAGG + Intergenic
946895287 2:224318081-224318103 CTCTCCCCCCAAAATCCAGATGG - Intergenic
946948588 2:224848126-224848148 CCTTCCCTAGAACCTCCTGAAGG + Intronic
947989810 2:234477746-234477768 TCTCCCCCAGAACCTCCAGAAGG + Intergenic
1169414559 20:5404917-5404939 ATTTGCCCTGAAACCCCAGAGGG - Intergenic
1169861317 20:10155760-10155782 CCTTCCCCAGTTTCTCCAGATGG - Intergenic
1170283658 20:14680389-14680411 TTTTCCGCTGAAACTCCAGAAGG + Intronic
1170393454 20:15901282-15901304 GATTCCCAAGAAACTACAGAAGG + Intronic
1170402416 20:16002650-16002672 TTTTCCCCAGAGCCTCAAGAAGG + Intronic
1170706055 20:18745637-18745659 CTTGCCCCCCAACCTCCAGATGG - Intronic
1170871841 20:20213121-20213143 CTTCCCTCAGACCCTCCAGAAGG + Intronic
1171162829 20:22943889-22943911 CTTTCTCCAGAGAATCCAGGTGG + Intergenic
1171395433 20:24829870-24829892 TTCTCCCCAGAGCCTCCAGAAGG + Intergenic
1172361514 20:34316056-34316078 CTCTCCTCAGAGCCTCCAGAAGG + Intergenic
1172588027 20:36098434-36098456 ATTGCCCCAGAGCCTCCAGAAGG - Intronic
1174384402 20:50178550-50178572 TCTTCCCCAGAGCCTCCAGAGGG + Intergenic
1174911802 20:54615926-54615948 TCTCCCCCAGAACCTCCAGAAGG + Intronic
1175231212 20:57474554-57474576 TCTTCCCCATAACCTCCAGAAGG + Intergenic
1176605537 21:8827414-8827436 TTCTCTCCAGAACCTCCAGAAGG + Intergenic
1178812272 21:35895231-35895253 CTACCCCCAGAAGCTCCAAATGG + Intronic
1178818734 21:35955519-35955541 CCTCCACCTGAAACTCCAGAGGG + Intronic
1178942240 21:36915691-36915713 CTTTTCCCTGAAACTCCATCTGG + Intronic
1179085224 21:38210506-38210528 CTTTTCCTAGAGACTTCAGAGGG - Intronic
1179297905 21:40079636-40079658 TTTGTCCCAGGAACTCCAGAAGG - Intronic
1179469121 21:41598759-41598781 CCTTCCCCAGAGCATCCAGAGGG + Intergenic
1179485238 21:41705813-41705835 CCTTCCCCAGAGCCTTCAGACGG + Intergenic
1179899860 21:44384897-44384919 CTTTCCCCAACAATTCAAGAAGG + Intronic
1180347834 22:11719019-11719041 TTCTCTCCAGAACCTCCAGAAGG + Intergenic
1180355612 22:11837124-11837146 TTCTCTCCAGAACCTCCAGAAGG + Intergenic
1180382641 22:12155200-12155222 TTCTCTCCAGAACCTCCAGAAGG - Intergenic
1181627991 22:24134292-24134314 GTTTCCCCAGAACCTCCAGTGGG + Exonic
1181988486 22:26818723-26818745 TCTACCCCAGAACCTCCAGAAGG + Intergenic
1182062950 22:27410868-27410890 CTATCCCCAGAAGCCCCAGATGG - Intergenic
1182686318 22:32123430-32123452 ATTCCCCCAGAAACTCGAGCAGG - Intergenic
1182808403 22:33095252-33095274 CCTTCCCCAGAGCCTTCAGAGGG - Intergenic
1184228623 22:43145408-43145430 CTTTCCGGTGAAACCCCAGATGG - Intergenic
1184337264 22:43861393-43861415 CTTTCCCTAAAAACCTCAGATGG + Intronic
1185172248 22:49301037-49301059 GTGTCCACAGAAACCCCAGAAGG + Intergenic
1185176303 22:49328921-49328943 ATCTCCCCAGAGCCTCCAGAGGG + Intergenic
949469452 3:4379467-4379489 CTTCCCTTAGAGACTCCAGATGG + Intronic
950601464 3:14039267-14039289 CTTTCCCCAGTAACTAGAGTTGG + Intronic
952177225 3:30878078-30878100 CTCTCACCCCAAACTCCAGAGGG - Intronic
952308209 3:32163938-32163960 CTTTCCCTTGAACCTCAAGATGG + Intronic
952532958 3:34280782-34280804 CTTTCCCCTGCCACACCAGAGGG - Intergenic
953438453 3:42898052-42898074 CTTGACCCAGACACCCCAGAAGG + Intronic
954924298 3:54218752-54218774 TTTTCCCTAGAGCCTCCAGAAGG - Intronic
956502820 3:69905224-69905246 CTCTCCCAAGAAACTACAAAAGG - Intronic
956686336 3:71831963-71831985 ATTTCCCTAGATATTCCAGAGGG + Intergenic
956908639 3:73793864-73793886 TTTTCCCAAGAAATGCCAGAAGG - Intergenic
959018491 3:101162919-101162941 CTTTTCCCAGGAAGTCAAGATGG - Intergenic
960245346 3:115394072-115394094 ATTTCCCCAGAAAGGACAGAGGG - Intergenic
960914770 3:122683963-122683985 GTTTCCACACAAACTCCTGAAGG - Intronic
961578243 3:127856086-127856108 CTATCTCAAGAAACTCCTGAAGG + Intergenic
962653449 3:137518743-137518765 CTTGCCCCAGAAGCTCCATCTGG + Intergenic
962852182 3:139316406-139316428 CTTTCCCCAAGTACTCCTGATGG - Intronic
962877259 3:139544705-139544727 ATTTCCCTAGAGCCTCCAGAGGG - Intergenic
962886550 3:139633088-139633110 CTGTCCCCAGGACCTCTAGAAGG + Intronic
964310295 3:155385151-155385173 CTGGCCTCTGAAACTCCAGAGGG - Intronic
967456098 3:189688379-189688401 CTTTCCCCAGGCACTAAAGAAGG - Intronic
967729042 3:192890116-192890138 ATTTTTCCAGAAACACCAGAAGG - Intronic
968472282 4:787656-787678 CCTCCCCCAGAGCCTCCAGAGGG + Intronic
968718753 4:2182498-2182520 TTTCCCTCAGAGACTCCAGAAGG + Intronic
968949213 4:3681763-3681785 CTTTCCACAGAAATCCCACATGG + Intergenic
969352579 4:6606308-6606330 CTTTCCCCAGTGGCTCCTGAGGG + Intronic
969452860 4:7284832-7284854 CTTCCCCCAGAGCCTTCAGAGGG - Intronic
969464532 4:7348184-7348206 ATTTCCCCAGGAATTCCAAAAGG - Intronic
970004761 4:11399906-11399928 CTTTCCGCAGAAGCTCCTGCTGG + Exonic
972361054 4:38325714-38325736 CTTGACCCAGAAAGTCCAGCTGG + Intergenic
972380478 4:38514850-38514872 CTTTCCCCAGAAGTGGCAGAGGG + Intergenic
972559662 4:40215541-40215563 CTATCCCAAGAAACTGGAGAGGG - Intronic
972990668 4:44819408-44819430 TTTTCCCCAGAGCCTTCAGAGGG - Intergenic
973372562 4:49263488-49263510 TTCTCTCCAGAACCTCCAGAAGG - Intergenic
973388430 4:49531571-49531593 TTCTCTCCAGAACCTCCAGAAGG + Intergenic
974197440 4:58593804-58593826 CCATCCCCAGGACCTCCAGAAGG - Intergenic
974213077 4:58808332-58808354 CATTTCCCAGGAACTCAAGAAGG + Intergenic
974473151 4:62345028-62345050 CTTTCCCCAGAGCTTCCAGAAGG - Intergenic
974881826 4:67768162-67768184 CTTTCCCCAACAACTCCCCAAGG + Intergenic
975517884 4:75267143-75267165 CCTCCCCCAGAGCCTCCAGAGGG + Intergenic
975885382 4:78958692-78958714 TTTTCCCCAGAGACTTCAGAGGG + Intergenic
976463344 4:85338645-85338667 CATTCAGCTGAAACTCCAGAAGG + Intergenic
976471845 4:85437681-85437703 GTTTCACCAGAGACTCCATAAGG - Intergenic
977144806 4:93425433-93425455 CTTTCCCCAGAAACTCCAGAAGG - Intronic
979920856 4:126494127-126494149 TTTTCCACTGAAACTCAAGAAGG + Intergenic
980595211 4:134946618-134946640 CTTTCTACAGAATCTCCAGGTGG + Intergenic
981271717 4:142853455-142853477 CTTTAGCCAGATTCTCCAGAAGG - Intergenic
982034654 4:151333854-151333876 CCTTCCCCAGAGACTTCAGAGGG - Intergenic
982513846 4:156319222-156319244 CTATGCCCAGATACTGCAGAGGG + Intergenic
983796654 4:171872610-171872632 CTTTCCCTAGCACCTCCAAAGGG - Intronic
985283761 4:188313121-188313143 CTTTCCCCACCAAATGCAGAGGG - Intergenic
987018421 5:13844914-13844936 CCTGCCCCAGAATCTCTAGAAGG + Exonic
987297875 5:16569974-16569996 CCTTCCTTAGAGACTCCAGAGGG + Intronic
988977771 5:36531750-36531772 TTTTCCCCAGAGCCTCCACAAGG + Intergenic
989146664 5:38257464-38257486 CTTTCCCCAGGAACTGCCGAGGG + Intergenic
989277232 5:39603197-39603219 TTCTCCCCTGAACCTCCAGAAGG - Intergenic
989543292 5:42642797-42642819 ATTTCCTCAGAGCCTCCAGAAGG - Intronic
989650850 5:43688382-43688404 TTTGCCCTAGAATCTCCAGAAGG + Intronic
989944983 5:50212929-50212951 CTTTCTGCAGAAACTGCAGTTGG - Intergenic
989971919 5:50535344-50535366 CTTTCCCAAAACAGTCCAGAAGG + Intergenic
990669207 5:58108642-58108664 TTTTCCCTGGAAACTTCAGAAGG - Intergenic
990737334 5:58878572-58878594 CTCTCCCCAGAACTTCCAGAAGG + Intergenic
990831305 5:59961423-59961445 CATCCCCCAGAGCCTCCAGAGGG + Intronic
991701005 5:69316496-69316518 CTTCCCACTGAACCTCCAGAAGG + Intronic
992261162 5:74971637-74971659 CTTTCCCCTGAAGCTTCAGTGGG + Intergenic
992613396 5:78527030-78527052 CTATTCTGAGAAACTCCAGAAGG + Intronic
993527056 5:88977782-88977804 CATACCCCAGAAACCCCAGATGG - Intergenic
993769594 5:91909694-91909716 CTTTCCTCTGAAGATCCAGAAGG + Intergenic
994164685 5:96596389-96596411 CTCCCCTCAGAACCTCCAGAAGG + Intronic
994724368 5:103416815-103416837 CCTTCCCCAGAGCTTCCAGAAGG - Intergenic
994737349 5:103571696-103571718 GTTTTCCCAGAAGATCCAGATGG - Intergenic
995261932 5:110114186-110114208 CTCTCCTCAGAGCCTCCAGATGG - Intergenic
996303452 5:122017309-122017331 CTTTCTCTGGAAGCTCCAGAGGG + Intronic
996786438 5:127241685-127241707 CTTTCCACAGAAGCTCAAAAAGG - Intergenic
997209662 5:132069925-132069947 CTGTCCCTGGAAACTCCAGCAGG + Intergenic
997460775 5:134050894-134050916 TTATCCCCAGAAACTCCTGATGG - Intergenic
997857427 5:137384640-137384662 AATTCCCTAGAAACTTCAGAGGG - Intronic
998014999 5:138724893-138724915 ATCTCCCCAGAAAGCCCAGAAGG - Intronic
998035484 5:138911608-138911630 TTTTCACTAGAACCTCCAGAAGG + Intronic
999716677 5:154366672-154366694 CTTCTCCCAAAGACTCCAGAGGG - Intronic
1000134870 5:158337420-158337442 CTTTCCCCAGGAGCTGCACAGGG + Intergenic
1000703719 5:164485661-164485683 CTTTCTCCAGAAACTGTAGTTGG + Intergenic
1000986366 5:167865204-167865226 ATTTCCCCAGTAGCTCCTGAAGG + Intronic
1001137204 5:169112487-169112509 CTGACCCCAGAGCCTCCAGATGG - Intronic
1001169997 5:169410261-169410283 TTTTCCCTAGAAGCTTCAGAGGG + Intergenic
1001540027 5:172531422-172531444 CTTCCCCAAGAAACTCGAGAAGG - Intergenic
1001681417 5:173559991-173560013 CTTTCCCTAGAAGCCACAGATGG + Intergenic
1002443400 5:179275704-179275726 CCTCCCCCAGAGTCTCCAGAGGG + Intronic
1005462513 6:26082676-26082698 CCTTCCCCAGAGGCTACAGAGGG - Intergenic
1005587875 6:27294696-27294718 CTGTCCTGGGAAACTCCAGAGGG + Intronic
1005640508 6:27791988-27792010 CTATCCCGGGAAACTCCCGAGGG - Intergenic
1005708507 6:28481174-28481196 TCTTCCCTAGAACCTCCAGAAGG - Intergenic
1006591880 6:35164264-35164286 ATTTCCCCAAAGCCTCCAGATGG + Intergenic
1006823121 6:36914354-36914376 CTGTGCCCAGAAACACCTGAAGG + Exonic
1006944548 6:37776751-37776773 GTTCCCCCAGAGCCTCCAGAAGG - Intergenic
1007973479 6:46076579-46076601 TTCTCCCCAGAGCCTCCAGAAGG + Intronic
1009888244 6:69650628-69650650 TATTCCCTAGAAACTTCAGAGGG - Intergenic
1010606234 6:77892434-77892456 CTTACCCCTGGATCTCCAGATGG + Intronic
1013179586 6:107706892-107706914 TTCTCCCTAGAACCTCCAGAAGG + Intronic
1013271528 6:108550028-108550050 ATATCCCCAGAAACTCCAAGAGG + Intergenic
1014129752 6:117817276-117817298 TATCCCCCAGAAGCTCCAGAAGG + Intergenic
1015020650 6:128469916-128469938 CTTCCCCTACAGACTCCAGAAGG + Intronic
1015499857 6:133920837-133920859 CTTTCCCCTTAAACCCTAGAGGG - Intergenic
1015868102 6:137748154-137748176 TCTTCCCCAGAACCTCCAAATGG + Intergenic
1016167093 6:140959853-140959875 TTTTCCCTAGAACCTCCAGAAGG - Intergenic
1016470785 6:144372114-144372136 CTTTGCACAGAAATACCAGAAGG - Intronic
1016908610 6:149175579-149175601 TTTTCCCTAGAAACTGCACAAGG - Intergenic
1017188508 6:151626708-151626730 CTTTCCACAGAAATTCCCAAAGG + Intergenic
1018144003 6:160865893-160865915 CATTCCCCAAAAACCCCACAAGG + Intergenic
1018883945 6:167916082-167916104 CTTTCCTCAGAGCCCCCAGAAGG - Intronic
1018994816 6:168702688-168702710 TTTTCCCCAGAACTTACAGATGG + Intergenic
1019401564 7:856971-856993 GCTTCCCCAGGAACTGCAGAGGG - Intronic
1020212095 7:6165146-6165168 CTGTCTCCAGAAACCCCAGAGGG - Intronic
1022737795 7:33092246-33092268 TCTTCCCCAGAGCCTCCAGATGG - Intergenic
1022911482 7:34903022-34903044 TTCTCCTCAGAACCTCCAGAAGG + Intergenic
1023421036 7:39979958-39979980 TTTTCCCAAGAGACTCCAGAAGG + Intronic
1023687294 7:42749623-42749645 GTTTTTCCAGAAACTCCAAAAGG + Intergenic
1024036226 7:45509695-45509717 CTTCCCCCAGCAAAGCCAGAAGG + Intergenic
1024098188 7:46003057-46003079 TTTTCCCTGGAAACTCCTGAAGG + Intergenic
1024632426 7:51260934-51260956 CTTTCCCCAAAACCTTCTGAGGG + Intronic
1024714802 7:52065773-52065795 CTTTCCCAAGGGTCTCCAGAAGG + Intergenic
1025518037 7:61680220-61680242 CTTTTTCTAGAATCTCCAGAGGG - Intergenic
1025534309 7:61929165-61929187 TTTTCCCCATAAACCCCAGTGGG - Intergenic
1025534439 7:61930538-61930560 TTTTCCCCAGAAGCCCCAGTTGG - Intergenic
1025542365 7:62108868-62108890 CTTTTTCTAGAATCTCCAGAGGG - Intergenic
1025925460 7:65956168-65956190 CTTTCTCCATAGACACCAGATGG - Intronic
1027200256 7:76059730-76059752 CGTTCCCCAGAAGCTCCTCAGGG + Intronic
1027566894 7:79806511-79806533 TCTTCCCTAGAACCTCCAGAGGG + Intergenic
1027820410 7:83035850-83035872 CTTTTCACAGTAACTCCACAAGG + Intronic
1027943639 7:84717759-84717781 TTTCCCCTAGAACCTCCAGAAGG + Intergenic
1028137346 7:87236063-87236085 CTTTGCCCAGATCCACCAGAGGG + Intergenic
1030173333 7:106626787-106626809 TCTTCCTCAGAACCTCCAGAAGG + Intergenic
1030607828 7:111657065-111657087 TTTAGCCCAGGAACTCCAGAAGG + Intergenic
1031132768 7:117851828-117851850 TTTTGTCAAGAAACTCCAGAAGG + Intronic
1031137472 7:117900778-117900800 CCTTCCCTAGAGCCTCCAGAAGG - Intergenic
1032672785 7:134100299-134100321 CCTTCCCCAGCACCTTCAGAGGG + Intergenic
1032876811 7:136046720-136046742 TCATCCCTAGAAACTCCAGAAGG - Intergenic
1033814675 7:145057433-145057455 CCTCCCCCAGAGCCTCCAGAAGG - Intergenic
1034095870 7:148407294-148407316 CCTACCCCAGAAAATCCTGAAGG + Intronic
1034570871 7:151955411-151955433 CTTTCTGCAGAAACTCCAGTTGG + Intergenic
1037535639 8:19821285-19821307 TCTTCCCCAGAACCTTCAGAGGG - Intronic
1037574057 8:20184428-20184450 CATCCCCCAGAATCTCCAGAAGG - Intergenic
1038634144 8:29271886-29271908 CTTTCCCCAGGAACACCTGAAGG - Intergenic
1038888165 8:31688935-31688957 TTGTCCCCTGAACCTCCAGAAGG - Intronic
1039702003 8:39971538-39971560 CTTTGCCCAGATTCTTCAGAGGG - Intronic
1040131817 8:43805878-43805900 CTTTTCCGAGAATCTCCAAAGGG + Intergenic
1040765518 8:50905286-50905308 TCTCCACCAGAAACTCCAGATGG - Intergenic
1040982956 8:53264268-53264290 CTTCCCTCAGAATCCCCAGAAGG + Intergenic
1042101608 8:65280688-65280710 TCTTCCCTAGAAACTTCAGATGG - Intergenic
1042509228 8:69593827-69593849 ATTTCCCCAGAATCTCCATAGGG + Intronic
1043565619 8:81544320-81544342 TTTCCCCTAGAAACTTCAGAGGG - Intergenic
1045347193 8:101303940-101303962 CTTATCCCAGAAATACCAGAAGG - Intergenic
1045504107 8:102766633-102766655 TTCTCCCCAGCACCTCCAGAAGG - Intergenic
1045771529 8:105746138-105746160 ATTTACCCAGACACTCCAAAGGG - Intronic
1045841114 8:106582599-106582621 CTTTGCTCAGAAACTCAATAAGG - Intronic
1046461924 8:114550033-114550055 TTTTCCTCAGGAACTCCACATGG + Intergenic
1046556273 8:115777051-115777073 TCTCCCCCAGAGACTCCAGAAGG - Intronic
1046857123 8:119045116-119045138 ATTTCCTCAGAAATTTCAGAAGG + Intronic
1047324718 8:123825260-123825282 CTCTCCCCAGAGCCTCCAGAAGG + Intergenic
1048429894 8:134360396-134360418 CTCTCACCAAAACCTCCAGAAGG + Intergenic
1048635961 8:136295573-136295595 TTTTCCCTAGAGACTTCAGAAGG + Intergenic
1048830401 8:138471255-138471277 CTTTCCCTAGGAACCCCACAAGG - Intronic
1048887405 8:138919384-138919406 TCTTCCCCAGAGACTTCAGAAGG - Intergenic
1048949736 8:139486043-139486065 CTTTTTCCAGAATCCCCAGAAGG - Intergenic
1049402913 8:142438407-142438429 CCTTCCCCAGAGCCTCCAGAAGG - Intergenic
1049524070 8:143111936-143111958 CTTTCCCCATAAACGCCAAGTGG - Intergenic
1050654200 9:7807802-7807824 ATTTCCCAAGACCCTCCAGAGGG + Intronic
1051415375 9:16834074-16834096 CTGACCCCACAAACTCCAGTTGG + Intronic
1053290701 9:36878069-36878091 CTTTCCCCAGGGCCTCCAGAGGG + Intronic
1053405959 9:37876085-37876107 CTTTCCCCAGAAAACTGAGAGGG + Intronic
1055710836 9:79060384-79060406 TTCTCCCCAGAGCCTCCAGAAGG - Intergenic
1056198357 9:84250416-84250438 TTCTCCCCAGAGCCTCCAGAAGG + Intergenic
1056445008 9:86656939-86656961 CTTTCTCCAGGCACTCCACAGGG - Intergenic
1057029971 9:91768148-91768170 CTGTCCCCAGAGCCTTCAGAAGG + Intronic
1057230771 9:93320088-93320110 CACTCCCCAGATGCTCCAGACGG + Intronic
1057466820 9:95321717-95321739 CTTCCCCAAGTAACTCCAGTTGG - Intergenic
1057842729 9:98499524-98499546 CTTTCCCCAGAAAGTCCATTAGG - Intronic
1058256129 9:102766299-102766321 TTTCCCCCAGAGCCTCCAGAAGG + Intergenic
1058802026 9:108553614-108553636 CATTCCCCAGAATGGCCAGATGG + Intergenic
1059402573 9:114079513-114079535 TTTTCCCCAGAATCTTCAAAGGG + Intergenic
1059710101 9:116859887-116859909 CTTTCCTCAGATCCTCCAGGTGG + Intronic
1059722116 9:116969966-116969988 TGTTCCCCAGAGGCTCCAGAGGG - Intronic
1060466827 9:123914108-123914130 CTTTGCCAAGAAACACAAGAAGG + Intronic
1061325737 9:129863051-129863073 CTGGACCCAGAAACTCCTGAAGG - Intronic
1061595754 9:131628263-131628285 CACCCCCCACAAACTCCAGATGG - Intronic
1061748327 9:132756320-132756342 CTTTCCCCAGACACTGCAGAAGG - Intronic
1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG + Intronic
1062147535 9:134998080-134998102 CTCTCCCCAGAACGTGCAGAAGG + Intergenic
1062155239 9:135044604-135044626 TTTCCCCCAGAGCCTCCAGAAGG - Intergenic
1203552941 Un_KI270743v1:179509-179531 TTCTCTCCAGAACCTCCAGAAGG + Intergenic
1185484973 X:475271-475293 CCTCCCCTAGAACCTCCAGAAGG - Intergenic
1185665682 X:1763454-1763476 CCTCCCCTAGAGACTCCAGAGGG + Intergenic
1185670177 X:1802635-1802657 CCTCCCCTAGAACCTCCAGAGGG + Intergenic
1185875014 X:3694903-3694925 CCTCCCCCAGAGCCTCCAGAGGG + Intronic
1185934917 X:4245553-4245575 ATTTCCCCAAAAGCCCCAGATGG - Intergenic
1185945609 X:4372434-4372456 CCTTCCTCAGAACCTCCAGATGG - Intergenic
1186501613 X:10055343-10055365 TTCTCCCCAGAACCTCCAGAAGG + Intronic
1188503835 X:30859512-30859534 CGTTTCCCTGAAATTCCAGAGGG - Exonic
1188886707 X:35560377-35560399 CTTTCCCCAAAAGCTGCTGAGGG - Intergenic
1190517006 X:51234251-51234273 CTTTCCCTAGAGCCTCCAGAAGG + Intergenic
1193743199 X:85243743-85243765 CTTCCCACAGAAACTCCTCAGGG + Intergenic
1193888738 X:87017037-87017059 CTTTCCCCAGGAACTCTTCAGGG - Intergenic
1194261418 X:91700176-91700198 CTTTCCCCAGAAATTTCTGGGGG + Intergenic
1194774203 X:97943222-97943244 CTTACCACTGAAACTCCAGAAGG + Intergenic
1195791328 X:108591084-108591106 CTTTCTCCAGGAAATCCAGGAGG - Exonic
1195906969 X:109853629-109853651 CATTCACCAGAACCTGCAGAGGG - Intergenic
1195951287 X:110276588-110276610 CATTCCAGAGAGACTCCAGAAGG - Intronic
1197286668 X:124603113-124603135 TTCTCCCCAGAGTCTCCAGAGGG + Intronic
1198566759 X:137913378-137913400 CCTTACCCAGAAATCCCAGAGGG - Intergenic
1199764088 X:150928112-150928134 CCTTCCCTAGAAACTTTAGAGGG - Intergenic
1199921366 X:152407680-152407702 CTGTCCCCAAAAAATGCAGAGGG + Intronic
1200580068 Y:4938977-4938999 CTTTCCCCAGAAATTTCTGGGGG + Intergenic
1200773795 Y:7151607-7151629 CCTCCCCTAGAACCTCCAGAGGG - Intergenic
1201154210 Y:11115083-11115105 TTCTCTCCAGAACCTCCAGAAGG + Intergenic
1201292418 Y:12433756-12433778 CCTTCCCTAGAGACTTCAGAGGG - Intergenic
1201732742 Y:17222572-17222594 CCTTCCTCAGAACCTCCAGATGG - Intergenic