ID: 977145946

View in Genome Browser
Species Human (GRCh38)
Location 4:93440026-93440048
Sequence CACAAGGAGGCCATTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977145946_977145953 8 Left 977145946 4:93440026-93440048 CCAGAGGAAATGGCCTCCTTGTG 0: 1
1: 0
2: 2
3: 8
4: 158
Right 977145953 4:93440057-93440079 GCCCACCACCCACTGGGATCAGG No data
977145946_977145957 14 Left 977145946 4:93440026-93440048 CCAGAGGAAATGGCCTCCTTGTG 0: 1
1: 0
2: 2
3: 8
4: 158
Right 977145957 4:93440063-93440085 CACCCACTGGGATCAGGAGAAGG 0: 1
1: 0
2: 4
3: 28
4: 232
977145946_977145952 2 Left 977145946 4:93440026-93440048 CCAGAGGAAATGGCCTCCTTGTG 0: 1
1: 0
2: 2
3: 8
4: 158
Right 977145952 4:93440051-93440073 GGGAGAGCCCACCACCCACTGGG No data
977145946_977145951 1 Left 977145946 4:93440026-93440048 CCAGAGGAAATGGCCTCCTTGTG 0: 1
1: 0
2: 2
3: 8
4: 158
Right 977145951 4:93440050-93440072 AGGGAGAGCCCACCACCCACTGG 0: 1
1: 0
2: 1
3: 20
4: 201
977145946_977145960 27 Left 977145946 4:93440026-93440048 CCAGAGGAAATGGCCTCCTTGTG 0: 1
1: 0
2: 2
3: 8
4: 158
Right 977145960 4:93440076-93440098 CAGGAGAAGGTCCTGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977145946 Original CRISPR CACAAGGAGGCCATTTCCTC TGG (reversed) Intronic
900940072 1:5793035-5793057 CACTCTGAGGCCATTTCCTTTGG - Intergenic
901390692 1:8943971-8943993 TACAAGGTGGCCCTTTCCGCAGG + Intergenic
902940769 1:19799262-19799284 TACAAGGAGGCCATGTCTTCTGG - Intronic
907815062 1:57910632-57910654 CACAAGGCTGTCATTTCCACTGG + Intronic
911773975 1:101784542-101784564 CTCATGGAGCCCATTTTCTCAGG + Intergenic
912730958 1:112103173-112103195 CACAGGGAGGCAATTTACTGTGG + Intergenic
913688727 1:121258144-121258166 CACAAGGAGGCAATTTCAGAAGG - Intronic
914148873 1:145022132-145022154 CACAAGGAGGCAATTTCAGAAGG + Intronic
915477191 1:156160231-156160253 CACAGGATGGCCATTTCCTGTGG + Intronic
916976432 1:170085076-170085098 CCCAAGGAGCCCATATCCACTGG + Intronic
916989358 1:170225878-170225900 AACAAGCAGGCCTTTTCCTTTGG + Intergenic
917218438 1:172702254-172702276 CACAAGGAGGTCAGTTTGTCTGG + Intergenic
918316203 1:183324674-183324696 CAAAAGGATGCCACCTCCTCTGG + Intronic
920476050 1:206276644-206276666 CACAAGGAGGCAATTTCAGAAGG - Intronic
923834112 1:237591050-237591072 CACTAGGAGACCCTTTACTCTGG - Intronic
1063401748 10:5752764-5752786 CACAAGGAGGCTGTTCCCTGTGG - Intronic
1067561045 10:47304841-47304863 TACAAGGAGGCAGTTTCCACAGG - Intronic
1067708382 10:48627893-48627915 CACAAAGATGCCCCTTCCTCTGG - Intronic
1067797728 10:49332936-49332958 CACATGGATGCCATTTCCCTGGG + Intergenic
1070794850 10:79210526-79210548 CCCAAGGAGGTCAACTCCTCAGG - Intronic
1070985601 10:80687089-80687111 CACAAAGAGGCCATTGTGTCAGG - Intergenic
1072238333 10:93472347-93472369 GAACAGTAGGCCATTTCCTCAGG + Intronic
1072930787 10:99659886-99659908 GACAAGGAGGCCACCTTCTCAGG + Exonic
1073589086 10:104739046-104739068 CACAAGGAAGCCATTGGCTATGG + Intronic
1074810702 10:117102446-117102468 CACTGGCAGCCCATTTCCTCAGG - Intronic
1076390625 10:130098716-130098738 GGCAAGGAGGCCATTTTCTGTGG - Intergenic
1076468927 10:130705100-130705122 AACAAGGATGGCATTTGCTCCGG - Intergenic
1076624015 10:131810685-131810707 CACCAAGGGGCCAATTCCTCAGG + Intergenic
1077995061 11:7445847-7445869 CACAAAGAGGAGACTTCCTCAGG - Intronic
1079773590 11:24496365-24496387 CTGAAGGAGTCCTTTTCCTCAGG - Intergenic
1080697935 11:34619402-34619424 CTCCAGCAGGCCATTCCCTCAGG + Intergenic
1085387507 11:76165381-76165403 CACAAGGAGGACATGTGCACGGG + Intergenic
1087574609 11:99975058-99975080 CACAAGTCGGCCATTGCCGCAGG + Intronic
1087773564 11:102237263-102237285 CAAAAGGAGGCCATTTGCTGAGG + Intergenic
1090592845 11:128290933-128290955 CACATGGAGACCATTACCACTGG + Intergenic
1093084077 12:14847526-14847548 CCCAAGAAGGCCATTTATTCTGG + Intronic
1096676175 12:53227361-53227383 CACAGAGAGGCCATCTCCTTGGG + Exonic
1099028186 12:77491949-77491971 CACAAGGAAGTCAGTTGCTCAGG - Intergenic
1103210699 12:119164277-119164299 CACACTGAGGACATTTCCACAGG - Intergenic
1104354319 12:128071752-128071774 CATATGGAGGCCACTGCCTCTGG + Intergenic
1106125272 13:26895880-26895902 CACAAGCAGGCCTCTTTCTCAGG + Intergenic
1109410804 13:61965481-61965503 CACAATTAGGCCATTTTCTATGG + Intergenic
1110726472 13:78830753-78830775 CACAGGGAATCCATTTCCACTGG + Intergenic
1111803949 13:93015299-93015321 CTCAAGGCAGCCATTTCCACAGG - Intergenic
1112896455 13:104305732-104305754 CACAAGAAGCCCATTTGCACAGG + Intergenic
1113447177 13:110378463-110378485 CAGAACCAGGCCCTTTCCTCCGG + Intronic
1113875988 13:113594671-113594693 CACAAGGATTCCATGTCCACTGG - Intronic
1118635400 14:67744105-67744127 CAGGAAAAGGCCATTTCCTCTGG + Intronic
1119516349 14:75251592-75251614 AAAATGGAGGCCCTTTCCTCAGG - Intronic
1120749121 14:88181368-88181390 CCCAAAGCAGCCATTTCCTCAGG + Intronic
1125589529 15:40845654-40845676 CACAGGGAGGCCTTTGGCTCTGG + Intronic
1128190393 15:65688668-65688690 CACAAAGAGGCCTCTTTCTCAGG + Intronic
1132348273 15:101121553-101121575 TACAGGCATGCCATTTCCTCGGG + Intergenic
1132993820 16:2812329-2812351 CACAGTGAGCCCATTTCCTGTGG - Intergenic
1139442823 16:66977375-66977397 TACAAAGAGGCCTCTTCCTCTGG + Intergenic
1141277545 16:82602237-82602259 CACTGGGAGGCCATGTCCACAGG + Intergenic
1143039772 17:4025348-4025370 CATAAGCAGGCCATCTCCACAGG + Intronic
1143367626 17:6418590-6418612 CTCAAGGAAACCCTTTCCTCAGG - Intronic
1144120058 17:12143819-12143841 CAAAAGGAGGTCATTTTCCCTGG - Exonic
1145848078 17:28061640-28061662 CACAAAGAGGTCATTTTGTCTGG + Intronic
1147919029 17:43905428-43905450 CACAAGGAGACCAAGTGCTCTGG + Intronic
1148562236 17:48612861-48612883 CACAAGGAGGCTTTTTACACGGG + Exonic
1151319673 17:73344969-73344991 CATAAGGAGACCACTTCCCCTGG - Intronic
1156065851 18:33141647-33141669 CACAAAGAGGAAAGTTCCTCTGG + Intronic
1156620131 18:38841785-38841807 CACATAGTGGCCTTTTCCTCTGG - Intergenic
1159158813 18:64618214-64618236 CAGAGGGAGGCCATTACCTGGGG - Intergenic
1159793673 18:72816338-72816360 CATAAGTAGTCCAGTTCCTCAGG - Intronic
1161171954 19:2816520-2816542 CACAGGGAGCCCAGTTCCCCAGG - Intergenic
1161986654 19:7658804-7658826 AACAAAGAGGCCATTTCCCTTGG + Intergenic
1163056200 19:14720237-14720259 CAAGGGCAGGCCATTTCCTCCGG + Exonic
925641537 2:5990069-5990091 GGCAAGGATGCCATTTCCCCTGG - Intergenic
925654348 2:6129374-6129396 TACCATGAGGCCATTTCCACAGG + Intergenic
926481991 2:13410879-13410901 CACATTGAGGTTATTTCCTCCGG - Intergenic
926490580 2:13521919-13521941 CACAATGAGGCCATTTCACTGGG - Intergenic
927946278 2:27137120-27137142 CCCAAAGAGGCCAGTTTCTCTGG - Exonic
928167638 2:28982323-28982345 CAGAGGGCTGCCATTTCCTCAGG + Intronic
928685671 2:33746671-33746693 CAGAAGGAGGCACTTTCCCCTGG + Intergenic
931091566 2:58892242-58892264 CACAAGTAGACCACTTGCTCAGG - Intergenic
931623622 2:64235520-64235542 CAAATGGAGGCTCTTTCCTCTGG - Intergenic
934776998 2:96945676-96945698 CAGAAGGAAGTCATTTCCTCAGG - Intronic
936383634 2:112010061-112010083 CACAAGGAGATCATTACCTTTGG - Exonic
937756286 2:125542679-125542701 CACCAGAAGGACATTTACTCAGG + Intergenic
937982798 2:127624975-127624997 CCCAAGGAGCCCCTTCCCTCTGG - Intronic
943175957 2:184474617-184474639 CTCAAGGTGTCCATTTGCTCAGG - Intergenic
943541462 2:189220098-189220120 CACAAGAAGGACATGACCTCAGG + Intergenic
945320126 2:208411422-208411444 CACCAGGAAGCCCATTCCTCAGG - Intronic
945542415 2:211105266-211105288 GAGAAGGGTGCCATTTCCTCTGG - Intergenic
946884359 2:224208323-224208345 CACAAGGAGGCCAATGCTGCTGG + Intergenic
947391293 2:229642310-229642332 GAGAAGGAGTGCATTTCCTCAGG - Intronic
948854935 2:240725629-240725651 CACATGGAGACCAGTCCCTCAGG - Intronic
948989956 2:241548651-241548673 CAAAAGGAGGTCTTTTCCCCAGG - Intergenic
1169003334 20:2184547-2184569 CACCAGGGGCCCATTTCCTTTGG + Intergenic
1169973521 20:11297199-11297221 TACCAGGAGGCCTTTTCATCAGG - Intergenic
1170099651 20:12684879-12684901 CAAAAGTAAGTCATTTCCTCAGG - Intergenic
1175300970 20:57942417-57942439 CACAAGGAAGCCCCTTCCCCAGG - Intergenic
1176659689 21:9622760-9622782 CACCAGGAGCCCATTTCCTCCGG - Intergenic
1177281324 21:18986532-18986554 CACAGGGAGTCCATCTCATCCGG + Intergenic
1178230252 21:30775546-30775568 TCAAAGGAGGCCATTTCATCTGG + Intergenic
1179548366 21:42126842-42126864 CACTTGGAGGCCATTTATTCAGG - Intronic
1180028385 21:45182300-45182322 CTCAAGGAAGTCATTTCCTCTGG - Intronic
1182948869 22:34352422-34352444 TACAGTGAGGCCATTTCCTGGGG + Intergenic
1183025851 22:35065595-35065617 CACAAGGAGCCAATTTGCACAGG - Intergenic
1184260650 22:43313762-43313784 CACAGGCAGGCCATCTCCACAGG + Intronic
950463345 3:13138656-13138678 CACAATAGGGCCATTTCCTGTGG - Intergenic
950851327 3:16064629-16064651 GGCAAGGGGGCCATTTCATCAGG - Intergenic
951018652 3:17757778-17757800 CACAAAGAAGCCATGTCCTTGGG - Intronic
953899818 3:46833756-46833778 AAGAAGGAGGCCATGTCCCCCGG + Intronic
957013199 3:75031528-75031550 CACAAAGATGTCACTTCCTCTGG - Intergenic
958472862 3:94543333-94543355 CAAATGGAGGACATTGCCTCAGG - Intergenic
959340069 3:105117999-105118021 CACACGGCAGCCATTTCTTCAGG - Intergenic
961575574 3:127833334-127833356 AACAAGCAGGCCATTTACTGGGG - Intergenic
965127358 3:164648329-164648351 GATAAGGAGGCCGTTTCCTCTGG + Intergenic
971084599 4:23257704-23257726 CACAAGGTGGCCTTTTTCTCCGG - Intergenic
972591931 4:40496133-40496155 CACAAGGAGGCAACTTGCACAGG + Intronic
976271057 4:83230737-83230759 CACAGAGAGGCCTTTTTCTCTGG + Intergenic
977006954 4:91579436-91579458 CACATAGATGCCATTTCCTATGG - Intronic
977145946 4:93440026-93440048 CACAAGGAGGCCATTTCCTCTGG - Intronic
982529454 4:156521010-156521032 CACAAAGTAGCCATTTGCTCTGG - Intergenic
991154455 5:63415122-63415144 CACAGGGAGTCCATCTTCTCTGG - Intergenic
992014617 5:72563350-72563372 CACACTGAGCCCACTTCCTCTGG + Intergenic
996628581 5:125600418-125600440 CAGAAGAAGGTCATTTCCTTGGG - Intergenic
997868506 5:137486324-137486346 CACAAGAAGGACAATGCCTCTGG + Intronic
998822174 5:146067020-146067042 CTCAATGGGACCATTTCCTCAGG - Intronic
999474184 5:151883216-151883238 CTCCAGGAGACCATCTCCTCTGG + Intronic
1000980513 5:167811971-167811993 CACAAGGACGTCATTTCAGCTGG + Intronic
1002653745 5:180724801-180724823 CCAAAGGAGGCCATTGTCTCAGG - Intergenic
1002853050 6:1013292-1013314 CACGAGGAGGCCATGTCTTCTGG + Intergenic
1007076341 6:39069207-39069229 CAAAAAGATGGCATTTCCTCTGG + Intronic
1007360768 6:41353610-41353632 CTTGGGGAGGCCATTTCCTCAGG - Intergenic
1007546401 6:42698024-42698046 CACCAGGAGGGCATATCCTAGGG + Exonic
1008613851 6:53207564-53207586 CACCAAGTGGCCATTTCCTGAGG + Intergenic
1010038280 6:71351810-71351832 CACAGGTAGCCCATTTCCTCAGG + Intergenic
1010258946 6:73793311-73793333 CACTAGCATGACATTTCCTCAGG - Intronic
1015120309 6:129693588-129693610 CACAGGGAGGACATTTTCTATGG - Intronic
1015435297 6:133179401-133179423 CACAAGCAAGGCATTTACTCAGG - Intergenic
1016373718 6:143399382-143399404 CACACTGATGTCATTTCCTCAGG - Intergenic
1018548997 6:164971956-164971978 CAAATGGAGCCCATTTCTTCTGG - Intergenic
1018949097 6:168367193-168367215 CACAAGAAGGCTGTTTCCTGAGG + Intergenic
1019003582 6:168777576-168777598 CACCTGGAGGCCATTTCCCTAGG + Intergenic
1019563307 7:1668255-1668277 CATGATGAGTCCATTTCCTCGGG - Intergenic
1020148736 7:5665338-5665360 CCCAAAGAAGCCCTTTCCTCAGG - Intronic
1023213215 7:37831077-37831099 CACAGGGAGTCCATTTTGTCTGG - Intronic
1028090379 7:86693251-86693273 AATAAGGAGACCATTTCTTCAGG + Intronic
1029993579 7:104984459-104984481 CAGAAGGAGCCCCTTTCCTGAGG - Intergenic
1031756307 7:125647480-125647502 CACAAGGGGAACAGTTCCTCTGG + Intergenic
1033269610 7:139918816-139918838 CACCCGGAGGCCATTCTCTCAGG + Intronic
1034967944 7:155403145-155403167 AACAAAGAGGTCATTTCTTCTGG - Intergenic
1035076347 7:156180116-156180138 CCCAAGGTGGCCAGTTCCACAGG - Intergenic
1037729013 8:21507728-21507750 CACAGGGTGGGCATTTCCTGAGG - Intergenic
1038448411 8:27620705-27620727 GACAAGGAGGCCACTGGCTCTGG + Intergenic
1041415923 8:57608971-57608993 CACAAGGAGTGCAATTCCTGGGG + Intergenic
1045156690 8:99483010-99483032 CATAAAGACACCATTTCCTCTGG + Intronic
1045190324 8:99875645-99875667 CTCAAGGAAACCCTTTCCTCAGG - Exonic
1046383534 8:113480245-113480267 TTAAAGGAGGCCATTGCCTCTGG - Intergenic
1047710736 8:127549866-127549888 CTCAAAGACGTCATTTCCTCAGG - Intergenic
1049339746 8:142105705-142105727 GACAAGGTGGCCATTCCATCTGG + Intergenic
1051712393 9:19945374-19945396 CGAAAGGAGTCCATTTCCACAGG - Intergenic
1053455280 9:38228866-38228888 CCCAGGGAAGCCACTTCCTCTGG - Intergenic
1056220346 9:84445642-84445664 CTCAAGGAGGAAATTTCCCCAGG - Intergenic
1057497983 9:95575267-95575289 CACACGGAGGCCAGTCCCTGAGG + Intergenic
1058120892 9:101137496-101137518 GAAAAGGATGCCAGTTCCTCTGG + Intronic
1059417396 9:114170349-114170371 CAGCTGGAGGCCAATTCCTCCGG + Intronic
1060730172 9:126031873-126031895 CACAAGGAGGATTTTTCCCCCGG - Intergenic
1061238845 9:129357699-129357721 CCCCAGGAGGCCATGTCCCCAGG + Intergenic
1203637248 Un_KI270750v1:124603-124625 CACCAGGAGCCCATTTCCTCCGG - Intergenic
1185745136 X:2566653-2566675 CAGAAGGAAGCCATTTGCACTGG + Intergenic
1189904279 X:45742099-45742121 AACAAGGATGACTTTTCCTCTGG - Intergenic
1196542607 X:116926805-116926827 ATCAAGGATGCCATTTCTTCTGG + Intergenic
1198648867 X:138838795-138838817 CTCAGGGAGGCAAATTCCTCAGG - Intronic