ID: 977148693

View in Genome Browser
Species Human (GRCh38)
Location 4:93480890-93480912
Sequence CTGTAGAGATTCAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977148693_977148704 28 Left 977148693 4:93480890-93480912 CCCACCTCCCTGAATCTCTACAG 0: 1
1: 0
2: 1
3: 18
4: 226
Right 977148704 4:93480941-93480963 TTTCAAATTTCATGCATTTTTGG 0: 1
1: 0
2: 5
3: 70
4: 701
977148693_977148702 1 Left 977148693 4:93480890-93480912 CCCACCTCCCTGAATCTCTACAG 0: 1
1: 0
2: 1
3: 18
4: 226
Right 977148702 4:93480914-93480936 AGGCCAGGGAGGTTGTATATAGG 0: 1
1: 0
2: 1
3: 9
4: 145
977148693_977148701 -10 Left 977148693 4:93480890-93480912 CCCACCTCCCTGAATCTCTACAG 0: 1
1: 0
2: 1
3: 18
4: 226
Right 977148701 4:93480903-93480925 ATCTCTACAGTAGGCCAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977148693 Original CRISPR CTGTAGAGATTCAGGGAGGT GGG (reversed) Intronic
900534257 1:3169292-3169314 CCCTAGGGATTCAGGGTGGTGGG - Intronic
900775598 1:4582557-4582579 CTGTTAAGATTCACAGAGGTAGG + Intergenic
900958257 1:5901902-5901924 TTGAAGTGATTCAGGAAGGTTGG + Intronic
902602527 1:17550030-17550052 CTGTAGAGAGCCAGGGTGGAGGG + Intronic
903685202 1:25126526-25126548 ATGTAGAGATTCAGGGATTCAGG + Intergenic
903685921 1:25131947-25131969 CTGTAGAGTTTTGGGGAGATGGG - Intergenic
906580127 1:46929311-46929333 GGGTGGAGATTCAGGGATGTTGG + Exonic
906603601 1:47149582-47149604 GGGTGGAGATTCAGGGATGTTGG - Exonic
910448129 1:87319512-87319534 CTCTATAGATTCTGGGAGGGAGG + Intergenic
915063644 1:153207084-153207106 CTGTACAGACTCAGGCTGGTGGG - Intergenic
920219555 1:204386798-204386820 CTGTAGGGTTTCAGGATGGTCGG - Intergenic
920296630 1:204961437-204961459 CGGGAGAGGTTCAGTGAGGTGGG - Intronic
921433838 1:215092824-215092846 CTGAGGAGTTTCAGGGAGGTGGG - Intronic
1065798368 10:29328270-29328292 CTGTAGACATTCAGGAAGCTTGG + Intergenic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1072037244 10:91574796-91574818 CTGTAGAGCTCCAGGGAGCTTGG + Intergenic
1073100050 10:101001750-101001772 CTGTAGGGTTTCAGAGAGGTTGG + Exonic
1075074782 10:119343455-119343477 ATGCAGAGACTCAGAGAGGTTGG + Intronic
1076186852 10:128457128-128457150 CTGCAGAGATTTGGGGAGTTTGG - Intergenic
1078414806 11:11156416-11156438 CTGCAGAGATGCACTGAGGTAGG - Intergenic
1078650123 11:13183157-13183179 CTGTGGAGATTCAGTGAGGCTGG + Intergenic
1078666358 11:13328938-13328960 CTGTAGGGATTGAAGGAGATTGG + Intronic
1078820523 11:14876212-14876234 TTGTCAAGATTCAGGAAGGTTGG + Intergenic
1083433954 11:62630132-62630154 CGAGAGAGATTCAGGGAGGCAGG + Intronic
1083934363 11:65862617-65862639 CTGTTGAGATTGGGGGGGGTGGG + Intronic
1084620317 11:70265492-70265514 CTGTAGACACTCAGAGAGTTTGG - Intergenic
1086437801 11:86799732-86799754 TTGGAGTGATTCAGGGAAGTAGG + Intronic
1088350029 11:108875819-108875841 CTGGAGATACTCAGTGAGGTTGG + Intronic
1088755687 11:112883369-112883391 CTGAAGAGATCCATGGAGTTAGG + Intergenic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1090541736 11:127713331-127713353 CTATAGACATCCAGGGAGGCTGG + Intergenic
1091046373 11:132329428-132329450 CTGTAGAAATGCTGGGAGGCTGG - Intronic
1091671309 12:2454061-2454083 CTGGAGGGCTCCAGGGAGGTGGG - Intronic
1091717071 12:2785524-2785546 ATGTAGAGATTCAGTCAGGCTGG - Intergenic
1091999942 12:5023825-5023847 TGGTAGAGATGCAGGAAGGTGGG - Intergenic
1093417206 12:18933584-18933606 TTGAAGAGATCCAGAGAGGTAGG - Intergenic
1095944690 12:47747167-47747189 CAGCTGAGATTCAGGGGGGTTGG - Intronic
1096501347 12:52065574-52065596 CTGTAAGAATTCAGGGAGGTAGG + Intergenic
1096994819 12:55831798-55831820 CTGAAGAGCTGCAGGGTGGTGGG + Intergenic
1097293921 12:57943060-57943082 TTGTAGAGACTCAGGGAGGTAGG + Intronic
1100387212 12:94114680-94114702 CTGTAAGCATGCAGGGAGGTGGG - Intergenic
1102768425 12:115452483-115452505 GTGGAGAGAATCAGAGAGGTGGG - Intergenic
1103864002 12:124037088-124037110 CTGTGGAGATTCAGGTGGGTGGG + Intronic
1104600633 12:130151006-130151028 ATGAAAAGATTCAGGGAGCTTGG + Intergenic
1104688541 12:130806736-130806758 TTTTAGAGTTTCAGGGAGATTGG - Intronic
1106466712 13:30020148-30020170 ATGTACAGATCCAGGGAGCTTGG + Intergenic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1108341267 13:49500349-49500371 CTGTACAGATTCAGAGAGGGAGG - Intronic
1109789505 13:67228908-67228930 CTGAAAAGACTGAGGGAGGTAGG - Intronic
1109881473 13:68483729-68483751 TTGTAGAGATTTAAGGAAGTTGG + Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1115817293 14:37177056-37177078 TTCTGGAGATTCAGGGACGTTGG - Intergenic
1117206438 14:53448551-53448573 CTGCAGAGTTGTAGGGAGGTGGG - Intergenic
1118818836 14:69331577-69331599 CTGTAGACATGAAAGGAGGTAGG + Intronic
1119347316 14:73936954-73936976 CTGTAGACTTTTAGGGATGTTGG - Intronic
1119391373 14:74293280-74293302 CTGGAGAGGTTCAGCCAGGTTGG + Intronic
1119930724 14:78543562-78543584 CTGTGGAGGTACAGGGAGGTTGG + Intronic
1120648002 14:87096686-87096708 CTTTACAGATTCAGGGATGGGGG + Intergenic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121967874 14:98327042-98327064 ATGCAGAGAATCAGGGATGTAGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1125067669 15:35509918-35509940 CTTTAAAGATTCAGGTAGCTGGG + Intronic
1125070510 15:35547938-35547960 CTGTAGAGACACATGGAAGTGGG + Intergenic
1126868024 15:52957386-52957408 CTGGAGGGAACCAGGGAGGTGGG + Intergenic
1126905666 15:53362237-53362259 GTGTAGAGACTCAGGGAGCCTGG + Intergenic
1127068586 15:55265794-55265816 CTGAAGGGATGCATGGAGGTAGG + Intronic
1129256195 15:74335441-74335463 CTCTATGGATTCAGGGGGGTAGG - Intronic
1131962568 15:97805049-97805071 CTGTAAGGATTCAGGGAAGCTGG - Intergenic
1132015315 15:98310401-98310423 CTTTAGATATACAGGTAGGTAGG + Intergenic
1132756402 16:1487489-1487511 CTCTGAAGCTTCAGGGAGGTCGG + Exonic
1133873410 16:9710759-9710781 ATGGAGAGAGTCAGAGAGGTGGG + Intergenic
1134422784 16:14110394-14110416 CTGAAGGCAGTCAGGGAGGTAGG + Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1135955166 16:26950543-26950565 CTGAAGAAATTCAGTGTGGTTGG + Intergenic
1139261752 16:65600697-65600719 CTTGAGAGATGAAGGGAGGTAGG - Intergenic
1139336010 16:66231798-66231820 AAGTGGAGATTCAGGGGGGTTGG - Intergenic
1139647864 16:68344915-68344937 GTGTAGAGATGCAGGAAGGGAGG - Intronic
1141092685 16:81141144-81141166 CTGCACACATTCAGGGAGGCCGG - Intergenic
1141622538 16:85244240-85244262 CAGAAGAGAGTCAGAGAGGTGGG + Intergenic
1141709610 16:85690166-85690188 CTATGGGGCTTCAGGGAGGTTGG - Intronic
1142577844 17:921287-921309 CTGTGGTGAGTCAGGGAGCTTGG - Intronic
1143205911 17:5139168-5139190 CTCCAGAGATGCAGGCAGGTGGG + Intronic
1143693585 17:8591892-8591914 TTGGAGAGAATCTGGGAGGTTGG - Intronic
1145086237 17:19943493-19943515 CTGTAGAGGTTCTTGGAGGGTGG + Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147537109 17:41328163-41328185 CTCTAGAGACCCAGGCAGGTGGG + Intergenic
1148026372 17:44591713-44591735 GGGTAGAGATTCAGGCAGGAAGG - Intergenic
1148235919 17:45969026-45969048 CTCTAGAGAGTCAGGCAGATGGG - Intronic
1151740439 17:75978747-75978769 CTATTGTGATTCAGGGAGGGTGG - Intronic
1155642195 18:28031556-28031578 CTGTAGAGACCCAGTGAGCTAGG - Intronic
1155654841 18:28180298-28180320 CTGTAGAACTCCAGGGATGTAGG + Intergenic
1157321641 18:46639400-46639422 CTCTAGGGGTTCAAGGAGGTGGG - Intronic
1159227703 18:65561573-65561595 GTGCAGAAATTCAGGGATGTTGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159911742 18:74152293-74152315 CGGAAGGGATTCAGGGAGTTTGG - Intronic
1160614147 18:80110951-80110973 CTGAAGAGATTCTGGGATTTGGG + Intronic
1161956241 19:7497041-7497063 GTGCAGTGATTCAGGGAAGTGGG + Intronic
1163284726 19:16339213-16339235 TTGTACAGATGCAGGGAGGGAGG - Intergenic
1163397090 19:17070012-17070034 CTGTGGGGATTCAGGCAGGGAGG - Intronic
1163610486 19:18298724-18298746 CTTAAGTGGTTCAGGGAGGTTGG + Intergenic
1167136621 19:47620091-47620113 CTTTTGAGATGCAGGGATGTTGG + Intronic
1167137768 19:47627674-47627696 CTTTAGAGATTTTTGGAGGTTGG + Intronic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1168381280 19:55925920-55925942 CTGTGGAGCTTCAGAGAGCTGGG - Intronic
925251429 2:2442178-2442200 GTGGGGAGACTCAGGGAGGTGGG + Intergenic
925826136 2:7850140-7850162 GAGAAGAGATTCAGGGAGCTTGG - Intergenic
926046561 2:9714256-9714278 TTGTAGAGATTCGGGGTGGGGGG - Intergenic
930220022 2:48736659-48736681 CTGGAGAGCTTCAGTCAGGTGGG + Intronic
932161520 2:69464745-69464767 GTGTAGAGATACAGGCAGATGGG - Intronic
932422528 2:71609779-71609801 GTGAAGTGATTCATGGAGGTGGG + Intronic
933492446 2:83004035-83004057 TTCTAGAGATTCAGAGAGATGGG - Intergenic
937710562 2:124976014-124976036 TAGTAGAGATTCAGGGAGATGGG - Intergenic
938265313 2:129923835-129923857 CTGGGGAGATTGAGGCAGGTAGG - Intergenic
940409736 2:153347323-153347345 GTGTGGAGATTGTGGGAGGTAGG + Intergenic
942082679 2:172416225-172416247 CTGTAGAGTTTCTGGTAGGCAGG - Intergenic
944652679 2:201847457-201847479 CTGGAGAAAATCTGGGAGGTAGG + Exonic
946078630 2:217097183-217097205 CTGCAGTGATTGAGGGAGTTTGG + Intergenic
946236548 2:218327752-218327774 CAGTAGAGATGTAGGGAGGAAGG - Intronic
946429044 2:219614917-219614939 GAGTAGAGATTCATGGAGCTTGG + Intronic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
1168972503 20:1940237-1940259 CTGTGTGGATTCAAGGAGGTTGG + Intronic
1169602216 20:7274579-7274601 AGGGAGAGATTCTGGGAGGTAGG + Intergenic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1170743605 20:19079096-19079118 CAGTAGAGAATTAGGAAGGTGGG + Intergenic
1173309211 20:41881786-41881808 ATGTAGGGATTCAGGGATGGAGG - Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173656950 20:44705986-44706008 CTGAAGAGAGGCAGGGAGGGAGG - Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1174515678 20:51090652-51090674 CAATTGAGATTCAGGGAGGGAGG + Intergenic
1175112406 20:56657920-56657942 CGGTAGTGATCCAAGGAGGTTGG + Intergenic
1176110278 20:63407754-63407776 CTGGAGAGGTACAGGGAGGGGGG + Intronic
1176963367 21:15184968-15184990 CTGTAGAGATCCAGTAAGGTGGG + Intergenic
1178404883 21:32315920-32315942 CGTTAGAGCTCCAGGGAGGTGGG - Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1180209374 21:46285724-46285746 CTGTAGAGATTGGAGGAAGTCGG - Intronic
1181273416 22:21673929-21673951 CTGTAGTGATGTAGGGAGGTGGG + Intronic
1181978909 22:26752378-26752400 CTGCTGAGATGCAGGAAGGTGGG + Intergenic
1183383909 22:37504144-37504166 CAGTAGACACCCAGGGAGGTGGG - Intronic
951825905 3:26868020-26868042 CACTAGAGATTCAGGAGGGTGGG - Intergenic
952307117 3:32156111-32156133 CTGGAGAGATGCTGGGGGGTCGG - Intronic
953009488 3:39011147-39011169 CTGTAAACCATCAGGGAGGTCGG - Intergenic
953020847 3:39112154-39112176 CTGTAGGGGTACAGGGAGGGAGG + Intronic
953035085 3:39204052-39204074 CTGTAGAGATACCAGGAGGGAGG + Intergenic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
956517018 3:70060874-70060896 CTGTAGAGGGTCATGGATGTAGG + Intergenic
957299917 3:78378704-78378726 CTTAAGAGATTCAGGAATGTGGG - Intergenic
959566118 3:107834635-107834657 CAGGAGAGGTTCTGGGAGGTCGG + Intergenic
960049625 3:113227463-113227485 GTCCAGAGATTCAGGGAGATAGG + Intronic
960500872 3:118436956-118436978 CTGCCAAGATTCAGGGAGGGAGG + Intergenic
960588235 3:119341172-119341194 CAGCAGATAGTCAGGGAGGTAGG + Intronic
961066807 3:123883324-123883346 CTGTTGTGATTCAGGGAGCTGGG - Intronic
961157851 3:124695974-124695996 ATGTAGAGAAACAGGGTGGTAGG + Intronic
965057330 3:163738137-163738159 CTGCTGAGATTCAGGCAGGGAGG + Intergenic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
967751997 3:193125745-193125767 CTGTAGAGATGCAAGGGTGTAGG - Intergenic
971083968 4:23248586-23248608 CTGAAGAGATTCATGGAAGTTGG - Intergenic
971136845 4:23878136-23878158 CAGTTGAGACTCCGGGAGGTTGG + Intronic
972415195 4:38832649-38832671 GTGTGGAGATTCAGGGTTGTTGG - Intronic
975730135 4:77329824-77329846 CTGTACAGAGACAGGGAGGGGGG + Intronic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
984050662 4:174861002-174861024 AGGAAGAGATTAAGGGAGGTTGG + Intronic
985554296 5:548879-548901 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554304 5:548953-548975 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554312 5:549027-549049 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554320 5:549101-549123 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554328 5:549175-549197 CAGTAGAGTTTCAGGTAGATTGG - Intergenic
985554335 5:549249-549271 CAGTAGAGTTTCAGGTAGATTGG - Intergenic
986160398 5:5222409-5222431 TTGGACAGATTCAGGAAGGTGGG + Intronic
987342134 5:16948622-16948644 GTGTAGAGCTCCAGAGAGGTAGG + Intergenic
988463104 5:31459643-31459665 CTCTAGAGATTCAGAGACTTTGG - Intronic
988832059 5:34997576-34997598 CTGTAGAGATTGAGCCAGGAAGG - Intergenic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
994180961 5:96765531-96765553 CTGAGGGGATTCTGGGAGGTAGG + Intronic
995553132 5:113300095-113300117 ATGTAGAGATTCACTGAAGTCGG - Intronic
995750869 5:115452060-115452082 CTGTACAGACACAGAGAGGTGGG - Intergenic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
997635491 5:135400974-135400996 CTGTAGAGGGGCATGGAGGTGGG - Intergenic
1000334049 5:160228884-160228906 GTGTAGAGAAGCAGGAAGGTTGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1001084737 5:168692381-168692403 CTGTAGATAGACAGGTAGGTAGG - Intronic
1002052346 5:176578144-176578166 CTGCAGAGAGGCAGAGAGGTGGG - Intronic
1004317792 6:14605712-14605734 CTGTAGGGATTTAGGTATGTAGG - Intergenic
1004318150 6:14609749-14609771 CTCTGTAGAGTCAGGGAGGTGGG + Intergenic
1005891846 6:30146774-30146796 CTGTAGATATTCAGAGAGTGAGG + Intronic
1007607937 6:43129828-43129850 CGGTAAGGAGTCAGGGAGGTGGG + Exonic
1007959809 6:45948405-45948427 CTTTAGAGGTTGAGGGAAGTCGG - Intronic
1008612266 6:53195454-53195476 AGGTAGAGATTCAGGTATGTGGG - Intergenic
1010514848 6:76760722-76760744 ATGTAGAGATTTGGGGAGGGTGG - Intergenic
1011749964 6:90445616-90445638 GTGTAAGGATTCAGGGAGGTGGG - Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1014377804 6:120698532-120698554 CTATAGAGAATCAGGGATGAAGG - Intergenic
1015148213 6:130010976-130010998 CTGTGGAGTTTCAGGAAAGTTGG - Intergenic
1016741320 6:147532299-147532321 CTTTGGGGACTCAGGGAGGTGGG - Intronic
1017191926 6:151663261-151663283 CTATAGAGCTTCATGTAGGTTGG + Intronic
1019622452 7:1999255-1999277 CTGTAGAAATACTGGGGGGTGGG - Intronic
1021184081 7:17542615-17542637 CTGCAGGGATTAAGGAAGGTTGG + Intergenic
1021625035 7:22584688-22584710 CTGTGAAGATTCAGAGATGTGGG + Intronic
1022168007 7:27791679-27791701 CTGAAGAGATTCTGGGGGATGGG + Intronic
1022221496 7:28318541-28318563 CTATAGAGAATCAGTGATGTTGG - Intronic
1022833430 7:34091020-34091042 CTGTTGAGGTACTGGGAGGTAGG + Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1024894550 7:54242945-54242967 CTGTAGTGATTCACTGTGGTTGG - Intergenic
1035097950 7:156371333-156371355 TTGTACAAACTCAGGGAGGTGGG + Intergenic
1035750372 8:1991947-1991969 CGGTAGACACACAGGGAGGTAGG + Intronic
1037034008 8:14143779-14143801 CTGCAGAGATGTAGGGAGGGTGG - Intronic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1038697379 8:29818462-29818484 GTGGTGAGATGCAGGGAGGTGGG + Intergenic
1038855109 8:31322383-31322405 TGGTAGAGTTTCAGGGGGGTAGG + Intergenic
1041367771 8:57127164-57127186 CTTTAGGGACTCAGGGAGGAAGG - Intergenic
1044335481 8:90979277-90979299 CTGCAGAGATGAAGGGGGGTGGG + Intronic
1044685782 8:94823917-94823939 CTGAATAAATTCAGGGAGCTGGG + Intronic
1047886331 8:129253993-129254015 AAGGAGAGATTGAGGGAGGTAGG - Intergenic
1048933956 8:139340059-139340081 GTGCAGAGATTCCGGAAGGTGGG - Intergenic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1049642249 8:143720977-143720999 CTGCAGGGAGCCAGGGAGGTGGG - Intronic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1050106006 9:2167582-2167604 CTGAAGAGTGTCAGGGAGGCAGG - Intronic
1050110227 9:2207771-2207793 CTGTAGAAATTCTGCTAGGTTGG - Intergenic
1053721767 9:40953638-40953660 CTTTAGAAATTCATTGAGGTAGG + Intergenic
1054344193 9:63898351-63898373 CTTTAGAAATTCATTGAGGTAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1060529830 9:124341666-124341688 CTGTGGAGAGACAGGGAGGCAGG - Intronic
1060536134 9:124389596-124389618 CTGTGGAGAGACAGGGAGGCAGG + Intronic
1060972317 9:127745219-127745241 CTCTGGTGATGCAGGGAGGTGGG - Intronic
1061543822 9:131292218-131292240 CTGTTGGGATTTAGAGAGGTAGG + Intronic
1188852730 X:35151218-35151240 CTGTACAGATTCATATAGGTGGG - Intergenic
1188916178 X:35913838-35913860 CTTTGGAGATTCAGGGAGAAGGG - Intergenic
1189137280 X:38562306-38562328 GTGTAAGGATGCAGGGAGGTGGG - Intronic
1189728065 X:43988730-43988752 ATGTAGAGATTCAGTGACATAGG - Intergenic
1190759659 X:53428774-53428796 CTGAAGGAAGTCAGGGAGGTTGG - Intronic
1190876642 X:54464928-54464950 CTGTGGAGATTCTGTGATGTGGG + Intronic
1193037895 X:76973290-76973312 CTGTTGAGATGGATGGAGGTTGG - Intergenic
1194846111 X:98811473-98811495 CTTTGGGGACTCAGGGAGGTTGG - Intergenic
1195614491 X:106901812-106901834 CAGCAAAGATTCAGGGAGATCGG + Intronic
1196519544 X:116656883-116656905 GGGTAGATATTAAGGGAGGTGGG + Intergenic
1198262085 X:134973962-134973984 ATGTAGAGCTTTAGGTAGGTGGG + Intergenic
1198492178 X:137152764-137152786 CTGTAGGGACTCAGGGAGCTAGG + Intergenic
1199440296 X:147860194-147860216 AAGGAGTGATTCAGGGAGGTGGG - Intergenic