ID: 977152783

View in Genome Browser
Species Human (GRCh38)
Location 4:93533962-93533984
Sequence AGCCAGAAAGATAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 391}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977152783_977152788 8 Left 977152783 4:93533962-93533984 CCCACCTCATTATCTTTCTGGCT 0: 1
1: 0
2: 3
3: 32
4: 391
Right 977152788 4:93533993-93534015 CTGGTTTCTTTGCTGTTTCTTGG 0: 1
1: 0
2: 2
3: 59
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977152783 Original CRISPR AGCCAGAAAGATAATGAGGT GGG (reversed) Intronic
902836251 1:19048630-19048652 AGGCAGGAGGATCATGAGGTCGG + Intergenic
904594308 1:31633361-31633383 AGCCAGGAAGTTACTGAGGCTGG - Intronic
904596613 1:31650298-31650320 AGACAGAAGGATAATGGGGTTGG + Intergenic
904778575 1:32927164-32927186 AGCCAGAGAAATAGAGAGGTGGG + Intergenic
905234420 1:36536112-36536134 AGGCAGAAAGAACAGGAGGTGGG + Intergenic
905655222 1:39682465-39682487 AGCCAGAGAGGTCATCAGGTTGG + Exonic
905659100 1:39707193-39707215 AGCAAGGTAGTTAATGAGGTTGG + Intronic
905976751 1:42181083-42181105 AGACATAAAGGTAATGGGGTTGG - Intronic
906615382 1:47229851-47229873 GGTCAGAGAGAGAATGAGGTGGG - Intronic
908393695 1:63706041-63706063 AGTCATAAAGAGAATGAAGTTGG + Intergenic
908754271 1:67453837-67453859 ATCCAGAAAGACAAAGAGGCAGG - Intergenic
909731971 1:78903190-78903212 AGGCTGAAAGATAAAGAGGGTGG - Intronic
909755879 1:79224737-79224759 ATTCAGAAAAATAATAAGGTTGG + Intergenic
911940073 1:104034620-104034642 AGCCAGAAAGTTAATGAATGTGG - Intergenic
913089552 1:115467129-115467151 AGAAAGAAAGAAAAGGAGGTGGG + Intergenic
914746516 1:150505384-150505406 AGGCAGAAAGATTGTGGGGTTGG + Intronic
915422825 1:155798647-155798669 AGGCAGGCAGATCATGAGGTCGG - Intronic
916439285 1:164807026-164807048 AGGCAGGCAGATCATGAGGTCGG + Intronic
916481453 1:165218361-165218383 AGCCAGAAAGATTCTGAAGATGG + Intronic
916722828 1:167497778-167497800 AGCCAGAAAGATATTGTAGGTGG - Intronic
917873867 1:179267421-179267443 AGGCAGACCGATCATGAGGTCGG + Intergenic
918815777 1:189179969-189179991 AAACAGAAAGCTAATGAGTTGGG - Intergenic
920510475 1:206547890-206547912 AGGCAGAAAGAAAATGATATCGG - Intronic
921973759 1:221178811-221178833 AGCCAGAAAGGTAATGTTATGGG - Intergenic
923274472 1:232384508-232384530 AGACAGAAAGACAGAGAGGTGGG - Intergenic
924830842 1:247593029-247593051 AGTCAGGCAGATCATGAGGTCGG - Intergenic
1063742101 10:8835099-8835121 AGCTAGAGAGATCATGGGGTGGG - Intergenic
1064138498 10:12770856-12770878 AGCAAGAAAAAAGATGAGGTTGG + Intronic
1064286303 10:13994405-13994427 AGGCAGGCAGATCATGAGGTCGG - Intronic
1064539441 10:16390486-16390508 ATCAAGAAAGAAAATGTGGTCGG - Intergenic
1064945274 10:20780390-20780412 AATCAGAAAGATACTGAGCTTGG + Exonic
1065264123 10:23957308-23957330 ATCCATAAAGACTATGAGGTAGG - Intronic
1065469627 10:26064349-26064371 AGCAAGGAAGCCAATGAGGTTGG + Intronic
1067658284 10:48213939-48213961 AGCCAGGAAGAAAATGAACTCGG + Intronic
1072147815 10:92658249-92658271 AGCCAGAAAAAAAATTAGCTGGG - Intergenic
1072343085 10:94474862-94474884 AGCGAGAAAGATATTGAGAAAGG + Intronic
1072360097 10:94651210-94651232 ACCAAGGAAGATAATGAAGTTGG + Intergenic
1073055641 10:100699199-100699221 GGCTGGAAAGATAATGAGGTGGG - Intergenic
1073805263 10:107090786-107090808 AGCCAGTAAGATTCTGAGCTGGG + Intronic
1074702045 10:116100978-116101000 TACCAGGAAGATAATGAGGCTGG + Intronic
1076292135 10:129353720-129353742 AGCCAGAGAGCTAAAGAGGGAGG + Intergenic
1077798248 11:5513592-5513614 AGGCAGAAAGAGAAAAAGGTGGG + Intronic
1078049871 11:7954399-7954421 AGGCAGGCAGATCATGAGGTCGG + Intergenic
1078294089 11:10048062-10048084 ACACATAAAGATAATGATGTCGG - Intronic
1078921733 11:15837068-15837090 AGCCAGAAAGCCAATGTGGCTGG + Intergenic
1079031784 11:16991649-16991671 GGCCAGAGAGGTAATGGGGTTGG + Intronic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1080286296 11:30617587-30617609 AGCAAGAGAAATAATGAAGTGGG + Intergenic
1083047462 11:59749624-59749646 TGCCAGAAAGATAAGGAGAAGGG + Intronic
1085557945 11:77442487-77442509 AGCCAGGAAGAAACTGAGGCTGG + Intronic
1085843217 11:80037557-80037579 AGGAAGAAAGAGAATGGGGTAGG - Intergenic
1085919511 11:80935355-80935377 AGCAGAAAAGATAATTAGGTGGG + Intergenic
1087043291 11:93822309-93822331 AGGCAGGCAGATGATGAGGTCGG - Intronic
1087939637 11:104079615-104079637 AGGCAGGTGGATAATGAGGTCGG - Intronic
1088448965 11:109962362-109962384 ATCAAGAAATATAATGAAGTTGG + Intergenic
1089248319 11:117138356-117138378 AGCCAGAAAGCCAAGGAGGAAGG + Intergenic
1089753430 11:120668205-120668227 AGACAGACAGAGAAAGAGGTAGG + Intronic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1089777861 11:120851357-120851379 AGTCAGCCAGATAAAGAGGTGGG - Intronic
1089831751 11:121335156-121335178 AGCAAGACAGAGAAAGAGGTAGG - Intergenic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1093373309 12:18390509-18390531 AGCCAGAAAAAAAAGGAGGCTGG + Intronic
1094202080 12:27804740-27804762 AGCCAGAAATATAGTAAGATCGG - Intergenic
1094230781 12:28100466-28100488 ACTCAGAAAGATAAACAGGTGGG + Intergenic
1095382057 12:41606778-41606800 AGGCAGAAAGAGAAGGAGGGAGG - Intergenic
1095580499 12:43791766-43791788 GGCCAGAAAGAAAATGATGGAGG + Intergenic
1096519227 12:52174751-52174773 GGCCAGAAAGACAATGAAGAAGG - Intronic
1096933456 12:55242090-55242112 AGCCAGAAGGGTGATGAAGTGGG - Intergenic
1099056052 12:77842285-77842307 AGCTAGAAAGATCCTAAGGTGGG - Intronic
1100770886 12:97921799-97921821 AGCCAGAGAGATAAAGAGGTGGG - Intergenic
1101824396 12:108209436-108209458 AGCAAGAAAGAGAGTGGGGTAGG + Intronic
1101933220 12:109032808-109032830 AGACAGATGGATAATGTGGTGGG - Intronic
1102274876 12:111574085-111574107 AGGCAGACAGATCATGAGGTCGG + Intronic
1104363249 12:128153547-128153569 GATCAGGAAGATAATGAGGTTGG + Intergenic
1105051507 12:133056481-133056503 AGGCAGGCAGATCATGAGGTTGG - Intronic
1105685851 13:22781064-22781086 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1105836135 13:24213493-24213515 AGGCAGATGGATCATGAGGTCGG - Intronic
1105945306 13:25184588-25184610 AGGCAGAAAGGGCATGAGGTGGG - Intergenic
1106835173 13:33626465-33626487 AGAGAGATAGATAATAAGGTAGG - Intergenic
1106968539 13:35105205-35105227 GGACAGAAAGAAAATGAAGTTGG - Intronic
1107507108 13:41045832-41045854 AGTCAGAAAGTTAATAAGGAAGG - Intronic
1107782882 13:43923802-43923824 AGGGGGAAAGATAATGAGGGAGG - Intergenic
1107939906 13:45374363-45374385 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1108019670 13:46114043-46114065 AGAAGGAAAGAAAATGAGGTCGG - Intergenic
1108457052 13:50626802-50626824 ACCCCAAAAGACAATGAGGTGGG + Intronic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1109473017 13:62835470-62835492 AGCCAGAAAGGTAAGGAAGATGG - Intergenic
1109699394 13:66005958-66005980 AGCCAGAAACACAATGAGCCAGG + Intergenic
1109943633 13:69404512-69404534 AGCCAGAAAGAGGATGGAGTGGG - Intergenic
1110840742 13:80139883-80139905 AGCCAGAAATTTAAAAAGGTTGG + Intergenic
1110877934 13:80533860-80533882 ACCCAGAATTATGATGAGGTAGG + Intergenic
1111453284 13:88447063-88447085 ATGCAGACAGATCATGAGGTCGG - Intergenic
1111515909 13:89330612-89330634 AGCAAGAGAGAGAAGGAGGTGGG + Intergenic
1111548597 13:89778419-89778441 AGCCAGAGAAATAGTGATGTGGG + Intergenic
1112806419 13:103167930-103167952 AGCAAGAGAGATAACGATGTTGG + Intergenic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113189358 13:107726291-107726313 AGCCAGAAACAAGATGAAGTGGG + Intronic
1114520365 14:23330454-23330476 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1115109444 14:29803863-29803885 AGCAAGAAAGATAAAGAGATTGG - Intronic
1115818161 14:37185461-37185483 AGGCAGGCAGATGATGAGGTCGG - Intergenic
1115937474 14:38569824-38569846 AGCATGAAGGATAAGGAGGTAGG + Intergenic
1115979999 14:39040611-39040633 AGACAGAAAGGTAAGGAGATAGG - Intronic
1116275443 14:42826499-42826521 AGGCAGGCAGATCATGAGGTTGG - Intergenic
1117151988 14:52899003-52899025 AGCCAGACAGAAAATGACCTAGG - Intronic
1117633729 14:57721365-57721387 AGCAAGGAACATAATGAAGTTGG + Intronic
1118901180 14:69987237-69987259 AGCCTGAAAGAATATGAGGGAGG + Intronic
1118932688 14:70256991-70257013 AGCCAGGAGGATTATGAGGTGGG + Intergenic
1119558290 14:75569971-75569993 AGCCACAAAGCCAATGAGGCTGG - Intergenic
1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG + Intergenic
1120297698 14:82664572-82664594 AGCCAGAGAGCTGATGATGTAGG + Intergenic
1122587775 14:102821811-102821833 AGGCAGGCAGATCATGAGGTCGG + Intronic
1123484445 15:20675313-20675335 GGACAGAAAGAAAATGAAGTTGG + Intergenic
1123537170 15:21244280-21244302 GGACAGAAAGAAAATGAAGTTGG + Intergenic
1124856793 15:33396928-33396950 TACCAGAAAAATAAAGAGGTTGG - Intronic
1126122763 15:45268284-45268306 AGCCAAAAAGGCAATCAGGTTGG - Exonic
1126598874 15:50408553-50408575 AGGCAGACGGATCATGAGGTCGG + Intergenic
1129889512 15:79062505-79062527 AGACAGAAAGTAGATGAGGTTGG - Intronic
1131251503 15:90833709-90833731 AGCCAGGCAGATCACGAGGTCGG - Intergenic
1131567374 15:93498602-93498624 GGCCAGAAAGACAAAGAGGCAGG - Intergenic
1131586477 15:93700802-93700824 AGCTTGAAAGATGATGAGCTAGG + Intergenic
1132087750 15:98921973-98921995 AGAAAGCAAGATAATGAGGAAGG + Intronic
1133012465 16:2921831-2921853 AGACAGGCAGATCATGAGGTCGG + Intronic
1133122516 16:3618977-3618999 AGTCAGGAAGATAAGGAAGTTGG - Intronic
1133377175 16:5296904-5296926 AGGCAGGAGGATCATGAGGTAGG - Intergenic
1134331497 16:13255259-13255281 AGACAGAAAGAGAATGAGAGAGG - Intergenic
1134822556 16:17258414-17258436 AACCAGGAAGAAAATGAGGAAGG + Intronic
1135186575 16:20321022-20321044 AGAGAGAGAGATAATGTGGTTGG - Intronic
1136646392 16:31621597-31621619 GGGCAGAAAGAGAAAGAGGTTGG + Intergenic
1137711974 16:50572867-50572889 AGCCAACAGGATCATGAGGTCGG + Intronic
1138221413 16:55254886-55254908 AGTAAGAAATATAATGAGATAGG - Intergenic
1138242594 16:55439822-55439844 AGGCAGAAAGACAGTGAGGCAGG + Intronic
1138567473 16:57844200-57844222 AGACAGGAGGATCATGAGGTCGG + Intronic
1140307092 16:73813214-73813236 AGAGAGAAAGAGAAAGAGGTAGG - Intergenic
1140639618 16:76957055-76957077 ATTCACCAAGATAATGAGGTGGG + Intergenic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1141301593 16:82821186-82821208 AACCAGAAAAATAATGATGTGGG - Intronic
1141753808 16:85977964-85977986 ATGCAGAAAGATACTCAGGTGGG - Intergenic
1143625105 17:8105183-8105205 AGCCAGGAAGGAAATGAAGTGGG - Intronic
1144445821 17:15327285-15327307 AGGCAGGCAGATCATGAGGTTGG + Intronic
1145202092 17:20955069-20955091 ATGCAGAAAGATAATGAAATCGG - Intergenic
1145922608 17:28621743-28621765 AGCCAGAAAAACAATGAGAAAGG + Intronic
1146319112 17:31832736-31832758 AGACAGGCAGATCATGAGGTCGG - Intergenic
1146456278 17:33012245-33012267 AGACAGACAGATAGGGAGGTTGG + Intergenic
1146876692 17:36419246-36419268 AGACAGAAAGAATATGAGGCAGG - Intronic
1146876859 17:36420750-36420772 AGGCAGGCAGATCATGAGGTCGG - Intronic
1146973274 17:37090023-37090045 AGTCAGAATGACAATGAGTTTGG + Intronic
1147062524 17:37892107-37892129 AGGCAGGCAGATCATGAGGTCGG + Intergenic
1147062692 17:37893615-37893637 AGACAGAAAGAATATGAGGCAGG + Intergenic
1147379114 17:40042442-40042464 AGACAGATGGATTATGAGGTCGG + Intronic
1147417494 17:40303938-40303960 AGCCTCAAACACAATGAGGTGGG - Exonic
1149237021 17:54604126-54604148 AATCAGAAAGCTAATGTGGTAGG - Intergenic
1150038248 17:61827894-61827916 AACAAAACAGATAATGAGGTTGG + Intronic
1150624489 17:66833071-66833093 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1151292590 17:73161324-73161346 AGCCAGAAAAATAGAGGGGTTGG - Intergenic
1154020860 18:10663023-10663045 AGCCAGGAAGAACATGAGGCAGG + Intergenic
1154312313 18:13276871-13276893 AACCAGAAAGGTACTGTGGTGGG - Intronic
1155550604 18:26961150-26961172 AACCAGAAAGGAAATGATGTAGG - Intronic
1155769184 18:29674686-29674708 AGGCAAAAAGAAAATGAGATTGG - Intergenic
1156196806 18:34783545-34783567 AGCCAGAAAGACGTTGAGATTGG + Intronic
1156340150 18:36203346-36203368 AGAGAGCAAGAGAATGAGGTGGG + Intronic
1156558888 18:38098982-38099004 AGCCTGAAGGATAAAGGGGTAGG - Intergenic
1156572629 18:38276019-38276041 AGGCAGAAAGAAAATAAGATTGG - Intergenic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1157419249 18:47531622-47531644 AGCCAGAAAGAGAAGGAAGATGG + Intergenic
1157859230 18:51125765-51125787 AGCTAGAAAGAGAATGGAGTGGG + Intergenic
1158086490 18:53657471-53657493 AGCCAGGAAGCTATTGAGATGGG + Intergenic
1159174634 18:64816526-64816548 AGCTAGAAACAAAATGAAGTTGG + Intergenic
1164067838 19:21736016-21736038 AGGCTGACAGATCATGAGGTCGG - Intronic
1164402586 19:27911868-27911890 AGCCAGAAAGAGAAAGAGCTGGG + Intergenic
1164714858 19:30384087-30384109 AGAAAGAAAGAGAAAGAGGTGGG - Intronic
1167011058 19:46808087-46808109 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1167402221 19:49280354-49280376 AGGCAGGAGGATCATGAGGTAGG + Intergenic
1168548102 19:57270605-57270627 AGGCAGGCAGATCATGAGGTCGG - Intergenic
924975249 2:167428-167450 AGACAGAGTGAAAATGAGGTTGG - Intergenic
925221821 2:2147990-2148012 AGCCAGATAGAGAATGCTGTTGG + Intronic
925593844 2:5536161-5536183 AGCCAGTAAGAAAAGAAGGTGGG - Intergenic
925940401 2:8811716-8811738 AGAAAAAAAGATAATTAGGTAGG + Intronic
927966350 2:27272046-27272068 ATCCAAAGAGATAATTAGGTAGG + Intronic
927975643 2:27336188-27336210 AGCAAGAAAGCTGGTGAGGTGGG - Exonic
928627489 2:33155296-33155318 AGGCAGGCAGATCATGAGGTCGG - Intronic
929745142 2:44649375-44649397 AGTCAGAAAGAGAAGGAAGTTGG + Intronic
930518916 2:52438369-52438391 AGGCAGGCAGATCATGAGGTCGG - Intergenic
931087514 2:58849622-58849644 TGGAAGAAAGCTAATGAGGTAGG - Intergenic
932996831 2:76865072-76865094 ACCCAGACAGAAATTGAGGTGGG - Intronic
933109568 2:78379938-78379960 AGACAGAGAGATAAAGAGGTAGG + Intergenic
933400328 2:81788481-81788503 AAACAGAAAGATACTGAGGCTGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934565948 2:95341243-95341265 AGCAAGAAAGAGAGTGAGGGGGG - Intronic
934625595 2:95847727-95847749 AGACAGAAATGGAATGAGGTGGG + Intronic
934925950 2:98381834-98381856 AGACAGAAAGATAAGGAGGCAGG + Intronic
935275186 2:101470306-101470328 AGCAAGAAAGATGCTGATGTTGG + Intronic
937002808 2:118483688-118483710 ATCCAGAAAGAAAAAGAGCTAGG - Intergenic
938847748 2:135228604-135228626 AGCAATAAAGATAAAGTGGTTGG + Intronic
940039447 2:149344886-149344908 AGTCAGAAAGAGAAAGAGGCAGG + Intronic
940120776 2:150262510-150262532 AGGCAGAAAGAAAATGATATAGG + Intergenic
941171992 2:162149574-162149596 AGCCAGACTGATAGTGAGGGGGG - Intronic
941703886 2:168636786-168636808 ACACAGAAGGAAAATGAGGTAGG - Intronic
942106941 2:172642619-172642641 AGCCAGCGAGAGAATGAGCTGGG + Intergenic
942609619 2:177729452-177729474 AGCAAGAAAGAGAAAGATGTGGG - Intronic
942700096 2:178697838-178697860 ATCAGGAAAGATACTGAGGTGGG + Intronic
942806672 2:179938894-179938916 AGGCAGGCAGATCATGAGGTCGG + Intergenic
942859763 2:180595579-180595601 AGCCAATAAGAAAATGAGGCTGG - Intergenic
943318234 2:186414659-186414681 ACCCAGAAACATAATGAAGTTGG - Intergenic
943774935 2:191755058-191755080 AGCAAGAAAGATGAAGAGGTTGG - Intergenic
944295146 2:198053248-198053270 AGCCATGCAGATAATGAAGTGGG - Intronic
945692660 2:213058872-213058894 GGCCTGAAAGATAGTGAGCTTGG - Intronic
945811616 2:214556316-214556338 AGCCAGAAAAACAATCAGTTTGG - Intronic
946216141 2:218185247-218185269 ATCCAGAGGGGTAATGAGGTGGG - Intergenic
947862074 2:233367572-233367594 ATCCAGAAAGATTATTAGGTTGG - Intronic
1170124799 20:12950672-12950694 AGCCAGAAAGATCAGGAGTAGGG - Intergenic
1170202835 20:13763089-13763111 AGGCAGGCAGATCATGAGGTCGG - Intronic
1171363170 20:24604784-24604806 TGCCAGAAAGAATTTGAGGTGGG - Intronic
1172713271 20:36943847-36943869 AGGCAGGCAGATCATGAGGTCGG + Intronic
1174003168 20:47389633-47389655 AGGCAGATAGATCATGAGGTTGG - Intergenic
1174183246 20:48688086-48688108 AGCCAAAAAAAAAATGGGGTGGG + Intronic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1177190060 21:17840873-17840895 AACCATAAAGATAATGAGTGAGG + Intergenic
1177246101 21:18526156-18526178 AGAGAGAGAGATAAAGAGGTGGG - Intergenic
1177393717 21:20507723-20507745 AGGCAGAAAGCTTATGTGGTAGG + Intergenic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1179403307 21:41104374-41104396 AGCAGGAAAGCTAATGAGGAGGG - Intergenic
1182759669 22:32712023-32712045 AGCCAGAAAGACCAAGATGTAGG - Intronic
1183368208 22:37418280-37418302 AGACAGAAGGATGATGAGGCAGG + Intronic
1183625801 22:39000789-39000811 AGGCAGGCAGATCATGAGGTTGG - Intergenic
1183631656 22:39036783-39036805 AGGCAGATGGATCATGAGGTCGG + Intergenic
1184593111 22:45498952-45498974 AGCCAGACAGTGAATGAGGAGGG + Intergenic
950039371 3:9910067-9910089 GGATAGAAAGATAATGAGGTTGG + Intronic
950190235 3:10971560-10971582 AGCCAGAAAGTAAAGGAGTTGGG + Intergenic
950840465 3:15963835-15963857 TGACAGTAAGATAATGAGGTGGG + Intergenic
950897478 3:16466724-16466746 AGCAAGAACTATACTGAGGTAGG + Intronic
950945188 3:16938413-16938435 GGACAGAAAGAAAATGAGGATGG - Intronic
951219154 3:20051288-20051310 AGGTAGAATGATAAGGAGGTGGG + Intronic
951265074 3:20555452-20555474 AGGTAGATAGATAATTAGGTAGG + Intergenic
951599907 3:24362261-24362283 AGTCAGAGAGATAATGAGTAGGG - Intronic
951916295 3:27804331-27804353 AGCTAGAAAGATACAGAGCTGGG + Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
953066619 3:39478565-39478587 AGACAGAAAGAAACAGAGGTAGG - Intronic
953111213 3:39941044-39941066 AGCCAGACAGTAAATGATGTGGG - Intronic
954738960 3:52731585-52731607 AGCCACATACATAATGAAGTTGG + Intronic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955646813 3:61148375-61148397 AGCCAGAAAAATAGGGAGCTAGG - Intronic
955728522 3:61959005-61959027 AGACAGAAAGATAGTGAGTGCGG - Intronic
956128178 3:66030664-66030686 AGCCTGTAAGATGATCAGGTGGG + Intronic
957199006 3:77108077-77108099 AGCAAGAAGGAAAATGAGGTAGG - Intronic
959369376 3:105504463-105504485 AGCCAGAAGGAGGATGAAGTGGG + Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
961133224 3:124488067-124488089 AGCTATAAAGAAAGTGAGGTGGG - Intronic
961376745 3:126472140-126472162 AGCCATACAGGTAATGAGCTAGG - Exonic
963123489 3:141795150-141795172 AGCCAGACAGGTAAAGAGGAAGG + Intronic
963127415 3:141828070-141828092 AGCCCGAAAGATGGGGAGGTGGG - Intergenic
963867243 3:150375859-150375881 AGACAGAAAGCTAATGAAATGGG + Intergenic
964305465 3:155334824-155334846 AACCAGAAACCTAATGAAGTTGG - Intergenic
964806205 3:160612319-160612341 AGCAAGGAAGAAAATAAGGTAGG - Intergenic
965050327 3:163638615-163638637 ACCAAGAAACATAATGAAGTTGG - Intergenic
965212878 3:165817521-165817543 AGCAAGAAAGATAGTGCGGCTGG - Intronic
966653389 3:182326212-182326234 AGGCAGGCAGATCATGAGGTCGG + Intergenic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
967675588 3:192295135-192295157 AGCCAGAGAGAGTAGGAGGTGGG - Intronic
968344283 3:197987568-197987590 AGCCAGAAAAAAAATGACTTAGG + Intronic
968720674 4:2201035-2201057 AGGCAGGCAGATCATGAGGTCGG + Intronic
969141027 4:5072017-5072039 ATCCAGAAAGATGAGGAGTTGGG - Intronic
969236436 4:5868529-5868551 AGGCAGGCAGATCATGAGGTCGG - Intronic
970282170 4:14469293-14469315 AGGCAGAAAGAAAAGTAGGTGGG + Intergenic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
972127107 4:35782366-35782388 AGATAGATAGATAATTAGGTTGG + Intergenic
972949227 4:44298412-44298434 ATACAGAAAAATAAAGAGGTGGG - Intronic
973627528 4:52787806-52787828 AGGCAGGCAGATCATGAGGTCGG - Intergenic
974079752 4:57199859-57199881 AGCCAGAAAGAGAGAGAGGCAGG + Intergenic
974564417 4:63565312-63565334 ACCAAGGAATATAATGAGGTTGG + Intergenic
974608340 4:64183026-64183048 AGAGAGAAAGATACTGAGGAGGG + Intergenic
974713568 4:65635898-65635920 GGGCAGAAAGATAAAGAGGGAGG + Intronic
975278775 4:72535800-72535822 AGACAGCAAAAGAATGAGGTTGG + Intronic
975337693 4:73199320-73199342 AGCCAGAAAGACAAAGAGAAAGG + Intronic
975707255 4:77123261-77123283 GTCCAGAAAGGTAATGAGGATGG + Intergenic
975707526 4:77125978-77126000 AGGCAGAAAGGAACTGAGGTTGG - Intergenic
975857795 4:78642878-78642900 GGTTAGAAAGATAATGAGTTTGG - Intergenic
975961998 4:79920632-79920654 AGGCAGACAGATAATGTGGCAGG + Intronic
976866920 4:89739507-89739529 ATCAAGAAAGATAATGGGCTAGG + Intronic
977136530 4:93311525-93311547 AGCAAGAAAAAAAATGAGGCAGG + Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
977346064 4:95817737-95817759 AGAGAGAAAGTTAATGAGGGTGG - Intergenic
978391331 4:108228825-108228847 ACCAAGAAAGATAATTAGATTGG + Intergenic
978664973 4:111171849-111171871 AGTAACAAATATAATGAGGTTGG + Intergenic
979119382 4:116876473-116876495 AGTGAGAAAGAGAATGAGGGGGG - Intergenic
979333478 4:119442380-119442402 AGGCAGGCAGATTATGAGGTCGG + Intergenic
979779936 4:124637939-124637961 AGCGAGGAAGAGAATGAGGATGG + Intergenic
980907082 4:138958698-138958720 TGCCAGAAAGGAAATGGGGTTGG + Intergenic
981338805 4:143596540-143596562 AGAAAGAAAGATGATGAGTTTGG + Intronic
981715396 4:147746906-147746928 AACCAGAAAAAGAATGTGGTGGG - Intronic
981869321 4:149467807-149467829 AGGCAGAAGAATAATGAAGTTGG - Intergenic
982020485 4:151198586-151198608 AGCTAGAAATGTAATGATGTAGG - Intronic
982053179 4:151523949-151523971 AGCCAGAAAGACATTGCTGTTGG - Intronic
982108351 4:152030773-152030795 AGCCAGAGAGAAAAAGAGGGAGG - Intergenic
983028485 4:162768134-162768156 ATCCACAGAGATAATCAGGTTGG + Intergenic
983398703 4:167235210-167235232 AGACAGAAGCATAACGAGGTAGG + Intergenic
983732240 4:171010436-171010458 AGAGAGCAAGAGAATGAGGTGGG - Intergenic
984125490 4:175804356-175804378 TCCAAGAAAGATTATGAGGTGGG - Intronic
984371666 4:178874555-178874577 AGGCGGAAGGATCATGAGGTCGG - Intergenic
984865678 4:184278242-184278264 AGCAAGAGAGAGAATGAGTTTGG - Intergenic
985006579 4:185540488-185540510 AGGAAGAAAGAAAAGGAGGTAGG - Intergenic
986112646 5:4735072-4735094 AGCCAGAAAGAAACTGGAGTAGG - Intergenic
986970372 5:13328161-13328183 AGCCAGAAAGATCATGATGAGGG - Intergenic
987278915 5:16392532-16392554 ATCCAGAAACAAAATGAGCTGGG + Intergenic
988588920 5:32532055-32532077 AGCCAGAAAGCAAATCATGTGGG - Intronic
989210360 5:38853111-38853133 AGCAAAAAAGATAAGGATGTAGG - Intronic
989691155 5:44145788-44145810 TGTCAGCAAGATAATGAAGTAGG - Intergenic
990023496 5:51158025-51158047 AACCAGGAAGACAATGAGGTAGG - Intergenic
990518658 5:56555738-56555760 AGGCAGACAGATCATGAGGTCGG + Intronic
990607102 5:57422359-57422381 AGTCAGAATGAAAATGAGCTGGG + Intergenic
992906393 5:81350172-81350194 AGCCAGATAGACAAAGAGATGGG - Intronic
993172732 5:84439981-84440003 TGCCAGTAAGATATTGAGGAGGG - Intergenic
993669556 5:90743699-90743721 AGGCAGGAAGATCACGAGGTCGG - Intronic
993812610 5:92501001-92501023 AGGCAGAGAGAGAATGATGTGGG + Intergenic
995600091 5:113786444-113786466 AGGCAGGCAGATCATGAGGTCGG - Intergenic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
995880834 5:116843039-116843061 AGCCAGAAATAAATAGAGGTAGG - Intergenic
996909358 5:128637438-128637460 AGACAGAAAGAGAAAGAGGGAGG + Intronic
997113205 5:131097859-131097881 AGGGAGAAAGATGATGTGGTAGG - Intergenic
998413338 5:141927757-141927779 AGGCAAAAAGATAATGGGGTAGG - Intronic
1001115046 5:168932451-168932473 AGACAGAAAGACTAGGAGGTAGG + Intronic
1001868922 5:175133351-175133373 AGCCAGGAAGAAAATGAGGTGGG - Intergenic
1002112079 5:176923565-176923587 AGAAAGAAAGAAAATAAGGTCGG + Intronic
1003450124 6:6223040-6223062 AGCCAGAAACAGAATGAGAGTGG - Intronic
1004884487 6:20038225-20038247 AGACAAGAAGATTATGAGGTAGG + Intergenic
1005037170 6:21567508-21567530 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1005772396 6:29086931-29086953 GGCCAGGAAGATGATGAGGTGGG + Exonic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008766050 6:54916219-54916241 AGGCAGAAAGAGAAAGAGGGAGG - Intronic
1012452050 6:99362985-99363007 AACCAGAAGAATAATGAGATTGG + Intergenic
1012943151 6:105438497-105438519 AGGAAGGAAGATAATGAGGCTGG - Intergenic
1013215068 6:108019663-108019685 AGCAAGAAAGAGAAAGAGGCAGG + Intergenic
1013458862 6:110357268-110357290 AGCCAAGAAGTTAATGAGGTAGG + Intronic
1013744062 6:113323574-113323596 AGCCAAAAAAATAATAAGGAAGG - Intergenic
1014010415 6:116469252-116469274 AGTCAGAGAGATAAAGGGGTTGG + Intergenic
1014648202 6:124002474-124002496 ACTCAGAAAGAAAATGAAGTAGG - Intronic
1014872968 6:126619126-126619148 AGCCAAGAAGAGAATGAGGGTGG - Intergenic
1015405650 6:132834303-132834325 AGCCAGAAAGAGGATGAGGGAGG + Intergenic
1015879908 6:137861695-137861717 AGACAGAAAGATCAGGAAGTGGG + Intergenic
1016855126 6:148661045-148661067 TGCCAGTAAGATAATTAAGTAGG + Intergenic
1018787135 6:167116928-167116950 AGCCAGGAAGATAATGCTGCAGG + Intergenic
1019040407 6:169099421-169099443 ACCAAGGAAGATAATGAAGTTGG + Intergenic
1019158092 6:170052338-170052360 AGCCCCAAAGAGAATGGGGTGGG - Intergenic
1020049949 7:5074890-5074912 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1020172250 7:5854161-5854183 AGCATGTTAGATAATGAGGTTGG + Intergenic
1020464314 7:8459664-8459686 AGACTGAAAGAGACTGAGGTTGG + Intronic
1020947519 7:14631746-14631768 AGAAAGAATGATAATAAGGTTGG - Intronic
1022559233 7:31332243-31332265 AGCCAGAAAGAGAAGGAAATAGG + Intergenic
1023528414 7:41129271-41129293 AGAGAGAAAGAGAAAGAGGTTGG - Intergenic
1024070562 7:45781310-45781332 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1025145490 7:56497758-56497780 AGGCAGGCAGATCATGAGGTCGG + Intergenic
1025565865 7:62433255-62433277 AGCAAGGAAGAAAATGAGGGTGG + Intergenic
1026534381 7:71228075-71228097 AGCAAGGCAGATAATGAGGAGGG + Intronic
1028115293 7:86990276-86990298 AGGCAGGCAGATCATGAGGTCGG - Intronic
1028315508 7:89397095-89397117 AGCAAGAAAGTTAATGTGGCTGG + Intergenic
1028563521 7:92202604-92202626 TGCCAGAAAGATAATGGGTTAGG + Intronic
1029358653 7:100071951-100071973 AGCGAGAAATATAATGATTTTGG - Exonic
1030746559 7:113173033-113173055 AGCCAGAAGGGGAATGGGGTGGG - Intergenic
1030770045 7:113463415-113463437 AGCCAGTCAGTTAATGAGGTAGG - Intergenic
1031111670 7:117618078-117618100 AGGTAGAAAGAAAATGAAGTGGG - Intronic
1032047967 7:128625612-128625634 AGGCAGGCAGATCATGAGGTCGG - Intergenic
1032709803 7:134451653-134451675 TACCAGAATGAGAATGAGGTGGG - Exonic
1033020995 7:137724175-137724197 AGCCAGAAAGTGGGTGAGGTTGG + Intronic
1033075816 7:138249704-138249726 ACCAAGAAACATAATGAAGTTGG + Intergenic
1034058788 7:148067080-148067102 TGCCAGAAAAATAATTCGGTAGG - Intronic
1034095268 7:148401826-148401848 AGGCAGACAGATCATGAGGTCGG - Intronic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1035520006 8:267981-268003 ATCCAGAAATATAATGATTTAGG + Intergenic
1035699594 8:1627901-1627923 AGTCAGAAAGAATGTGAGGTCGG - Intronic
1035836676 8:2761824-2761846 TTCCAGAAAGATACTGAGATGGG + Intergenic
1036132233 8:6126335-6126357 AGACAGGAAGGTAAGGAGGTTGG - Intergenic
1038321545 8:26531789-26531811 AGGCAGAAAAAAAATGAAGTAGG + Intronic
1038415561 8:27392593-27392615 AGCCAGTCAGAAAATGAGCTGGG + Intronic
1040639203 8:49312889-49312911 CACCAGAAAGATAATGATGTAGG + Intergenic
1041379554 8:57239502-57239524 AGTCAGAAAGATGATGTGATTGG - Intergenic
1043561556 8:81499664-81499686 TGCCAGAGAGAGAATGAGGGTGG - Intergenic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1045371904 8:101532838-101532860 AGAGAGAAAGAGAAAGAGGTGGG + Intronic
1045719721 8:105094283-105094305 AGCCAGAAAGCCAATGACATGGG + Intronic
1046456296 8:114468047-114468069 AGAAAAAAAGAGAATGAGGTTGG + Intergenic
1046799506 8:118409791-118409813 AACCAGTAAGATAATGAAGCTGG + Intronic
1046868177 8:119174367-119174389 AGCCAGAAAGAGAGAGAGATTGG + Intronic
1048379044 8:133847661-133847683 AGCCAGAAAGGCAATGTGCTGGG - Intergenic
1048935895 8:139356678-139356700 AGACTGAAAAATAATGATGTAGG - Intergenic
1049033348 8:140053610-140053632 ATCCAGACAGAAAATGAGGAAGG - Intronic
1049447244 8:142636896-142636918 AGCCAGGAAGATGATGAGAAGGG - Intergenic
1049627461 8:143631940-143631962 AGAAAAAAAGAAAATGAGGTAGG - Intergenic
1050210708 9:3252585-3252607 AGCCAGGAGGCTAATGTGGTAGG + Intronic
1052847271 9:33348118-33348140 AGGCAGGTAGATTATGAGGTCGG + Intronic
1052993430 9:34536244-34536266 ACCCAGAAAGCTGATGAGGGAGG + Intergenic
1055269854 9:74545603-74545625 AGACAGAAAGATGAGAAGGTTGG + Intronic
1057447978 9:95131999-95132021 AGCCATAAAGATTTTTAGGTAGG + Intronic
1057559393 9:96115442-96115464 AGATAGAAAGATGAGGAGGTGGG - Intronic
1058350714 9:104018905-104018927 AGCCAGTAAGATGAAGAGGTGGG + Intergenic
1059152075 9:111957971-111957993 AGAAAGAAAGAAAATGATGTAGG + Intergenic
1059291679 9:113230876-113230898 ACCTAGAAAGAGAATGAGGGAGG - Intronic
1060565264 9:124585308-124585330 AGGCAGGCAGATCATGAGGTCGG + Intronic
1061113579 9:128593132-128593154 ATCCAGAAAGATGAGGTGGTGGG + Intronic
1061172329 9:128966739-128966761 ACCAAGAAAGATCATAAGGTAGG - Intronic
1061389894 9:130311663-130311685 ACCCAGAAAGATGACGAGCTGGG + Intronic
1061398635 9:130356611-130356633 TGCCTGAAAGATAAGGAGCTAGG - Intronic
1061733872 9:132638777-132638799 AGCAAGAAGGAAAATGGGGTGGG + Intronic
1062372000 9:136244955-136244977 AACCAGAAAGTTAATGATGAAGG + Intronic
1185481282 X:448289-448311 AACCAGAAAGAAAATTAGCTGGG - Intergenic
1185604598 X:1360826-1360848 AGCTAGAAAGATAAAGAGAGGGG - Intronic
1186321724 X:8434664-8434686 AGCCAGAAAAATAATGAAATGGG + Intergenic
1186838291 X:13459504-13459526 AGCATGGAAGGTAATGAGGTTGG + Intergenic
1187279727 X:17848732-17848754 AGACAGACAGATAATGAAGCTGG - Intronic
1187604490 X:20869054-20869076 ACCAAGAAATATAATGAAGTTGG + Intergenic
1188755546 X:33956664-33956686 AGCCTGAAAAATAATGTTGTAGG - Intergenic
1189737583 X:44087362-44087384 ACCCAGAGAGAGAATGAAGTAGG + Intergenic
1190528543 X:51352082-51352104 AGCAATAAAGATATTGGGGTGGG - Intergenic
1192625697 X:72725683-72725705 AGGCAGGCAGATCATGAGGTTGG - Intergenic
1194984565 X:100476596-100476618 AGCTAGAAAGATAATAATGAAGG + Intergenic
1195538678 X:106037847-106037869 AGCCAGAAAGATAAGGTGTAAGG + Intronic
1195803981 X:108742342-108742364 AGCAAGAGAGAAAAAGAGGTTGG - Intergenic
1195913329 X:109911560-109911582 AGGCAGAAAGATAAAGGGGGCGG + Intergenic
1196263488 X:113613764-113613786 AGGCAGAAAGAAAATGACATAGG - Intergenic
1196313026 X:114190506-114190528 AGAGAGAAAGAAAATGATGTAGG + Intergenic
1197190943 X:123647603-123647625 AGGCAGACAGATCATGAGGTCGG + Intronic
1197537236 X:127706257-127706279 AGCAAGAAATATAATGAAGTTGG + Intergenic
1197610718 X:128635352-128635374 AGGTAGATAGATAATGAGGAAGG + Intergenic
1198432294 X:136579506-136579528 AGACAGGTAGATTATGAGGTTGG - Intergenic
1199064448 X:143398397-143398419 AGCCAGAAGGATGATGATATTGG + Intergenic
1199190991 X:144970735-144970757 AGTCAGGCAGATCATGAGGTCGG + Intergenic
1199429737 X:147745717-147745739 AGTCAGAAAGAGGATGGGGTGGG - Intergenic
1201322600 Y:12716836-12716858 AGGCAGGCAGATCATGAGGTCGG - Intronic