ID: 977155696

View in Genome Browser
Species Human (GRCh38)
Location 4:93570196-93570218
Sequence CAGTAGCCAGTGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977155692_977155696 -2 Left 977155692 4:93570175-93570197 CCACAGTCACACAAGGTCACTCA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977155696 Original CRISPR CAGTAGCCAGTGGTGGAGCT GGG Intronic
No off target data available for this crispr