ID: 977155696 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:93570196-93570218 |
| Sequence | CAGTAGCCAGTGGTGGAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977155692_977155696 | -2 | Left | 977155692 | 4:93570175-93570197 | CCACAGTCACACAAGGTCACTCA | 0: 1 1: 0 2: 0 3: 17 4: 212 |
||
| Right | 977155696 | 4:93570196-93570218 | CAGTAGCCAGTGGTGGAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977155696 | Original CRISPR | CAGTAGCCAGTGGTGGAGCT GGG | Intronic | ||
| No off target data available for this crispr | |||||