ID: 977156802

View in Genome Browser
Species Human (GRCh38)
Location 4:93584056-93584078
Sequence TTTCATTTGTGATCTAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977156802 Original CRISPR TTTCATTTGTGATCTAAGAC CGG (reversed) Intronic
901063065 1:6482343-6482365 TTTCATTTATGAATTAAGGCAGG + Intronic
903118952 1:21201388-21201410 TTTCAGTTCTGATCTGAGGCAGG + Intergenic
904082107 1:27878849-27878871 TATGATGTGTGATCTAGGACTGG - Intronic
905079894 1:35308853-35308875 TTTCTTTTGTTTTCTGAGACAGG - Intronic
905596166 1:39209337-39209359 TTTAATGTGTGATCTAAGGTAGG + Intronic
905973326 1:42156951-42156973 TTTCATTTTTTTTCTGAGACAGG - Intergenic
908557192 1:65267284-65267306 ACTCATTTGTGACCTAGGACAGG + Intronic
912934579 1:113992134-113992156 TTTTATTTTTTATTTAAGACTGG + Intergenic
913481704 1:119294939-119294961 TTTGATGTGTGGTCTGAGACAGG + Intergenic
917640275 1:176976842-176976864 GTTCATTTGTGAGCAAAGATGGG - Intronic
918096547 1:181341015-181341037 TTACCTGTGTGATCTCAGACGGG - Intergenic
918544053 1:185662195-185662217 TTTCATTTTTGCTCTAAAAAGGG - Intergenic
919621895 1:199872583-199872605 TTTCATTTTTCATCTATTACAGG - Intergenic
923486407 1:234435755-234435777 TTTCCTCTGTGAACTAAGACAGG + Intronic
1063784294 10:9363029-9363051 TTTCTTTTTTGTTGTAAGACTGG - Intergenic
1064964256 10:20999591-20999613 TTTCTTTTGTGAGGTGAGACAGG - Intronic
1065274182 10:24068724-24068746 TCTCATTAGTGTTTTAAGACAGG + Intronic
1065759184 10:28966044-28966066 TGTCAATTCTGATCTAAGCCAGG - Intergenic
1066576248 10:36828313-36828335 TCTCCTTTGTGATCTAAACCTGG + Intergenic
1067669957 10:48310429-48310451 TTCCATTTGTTTTCTAAGTCTGG - Intronic
1068072149 10:52208229-52208251 TTTCATTTGTAACATAAGAAAGG - Intronic
1068079484 10:52301841-52301863 TTTCCTTTGTGATCAGAGATTGG - Intergenic
1069838104 10:71321916-71321938 TTTCATTTGTGAGGAAAGAGAGG - Intronic
1070316230 10:75315352-75315374 TTTCATTTTTGTTTTGAGACAGG - Intergenic
1070406590 10:76103119-76103141 TTTCATTATTGAAGTAAGACAGG + Intronic
1070410592 10:76136034-76136056 TGTCATGTCTGATCTAAGAGTGG + Intronic
1071081346 10:81815700-81815722 TGTCATTTGTGATGTTTGACAGG - Intergenic
1071259249 10:83905078-83905100 TTTCATTAGTGGACTAAGTCAGG - Intergenic
1072590251 10:96822484-96822506 GTTCATCTGTGGTCTAAGATAGG + Intergenic
1073518766 10:104104891-104104913 TCTTCTTTGTGAACTAAGACAGG + Intergenic
1074007370 10:109441360-109441382 AGTCATTTGTGATCAAAGAATGG + Intergenic
1075511423 10:123075468-123075490 TTTCATTTTTGTTTTGAGACAGG + Intergenic
1077801234 11:5539848-5539870 TTTCATTCATGGTCTAAGAATGG + Intronic
1078082078 11:8211424-8211446 TTTCATGTGTCATCCAAGGCAGG + Intergenic
1078821275 11:14885009-14885031 TTTCCTTTGTGATGTAATATAGG + Intronic
1079765805 11:24390914-24390936 TGTCATTTGTGAACAAAGGCTGG + Intergenic
1080587983 11:33698619-33698641 CTCCATTTGTGATCCAAGATGGG + Intronic
1085331102 11:75651945-75651967 TTTCAGCTGTGAGCTAAGAAAGG + Intronic
1086245391 11:84745612-84745634 TTTTATTTTTAATCTAAGATGGG - Intronic
1086501000 11:87453598-87453620 TTTCTCTTGAGATCTCAGACAGG - Intergenic
1086657200 11:89373812-89373834 CTTCCTTTGTGATTTAAAACTGG - Intronic
1087169041 11:95031773-95031795 ATTCATTTGTGAACAAATACTGG - Intergenic
1091712393 12:2751287-2751309 TTTCATGTGTGTTTTAAGTCTGG - Intergenic
1091913664 12:4251874-4251896 ACTCATTAGAGATCTAAGACAGG + Intergenic
1093369081 12:18344362-18344384 TTTCCTTTTTGATGTGAGACGGG - Intronic
1095192069 12:39269719-39269741 TTTCATTTGGGCTATATGACTGG + Intergenic
1096939604 12:55327829-55327851 TTTCATTGGTGATCCATGGCTGG - Intergenic
1097146712 12:56945647-56945669 CTTCTTTTGTGATCTAACATGGG + Intergenic
1099573110 12:84350162-84350184 TTTCTTTTGCGGTCTAAGATGGG - Intergenic
1100119338 12:91350443-91350465 TTTCAGTTTTGTTCTAAGAGTGG - Intergenic
1100310897 12:93393685-93393707 TATCATTTATGATCTAGAACAGG - Intronic
1100706986 12:97211600-97211622 TTTCTGTTCTGATCTAAGAAGGG - Intergenic
1101736071 12:107464314-107464336 TTTCATTTTTGTTTTGAGACAGG + Intronic
1102093241 12:110211958-110211980 TTTCATTTGTATTTTAAGAATGG - Intronic
1102834778 12:116045313-116045335 TTTCATTTGTTGTCTCAGCCAGG - Intronic
1104509444 12:129363506-129363528 TTTCATTTGTCATATCAGATGGG - Intronic
1104509554 12:129364903-129364925 TTTCATTTGTCATGTCAGATGGG + Intronic
1106748592 13:32732111-32732133 TTAGATTTGTGATGTAAAACAGG - Exonic
1107421453 13:40251076-40251098 TTTCAACTGTGATCTAATAAAGG + Intergenic
1109036631 13:57270572-57270594 TTTCATTTTTGTTTTGAGACAGG - Intergenic
1109805333 13:67432695-67432717 TTTTGTGTGTGATGTAAGACAGG + Intergenic
1112067121 13:95804762-95804784 TTTCATATGTCATGTAAGATAGG - Intronic
1112639357 13:101255451-101255473 TTGCTTTTGTGATCTAGCACAGG - Intronic
1114011249 14:18371178-18371200 TTTTGTTTGTGATGCAAGACAGG - Intergenic
1114891379 14:26928371-26928393 TATCCTTTGAGATCTAATACAGG + Intergenic
1119258641 14:73222529-73222551 GATCATTTGTGATCTAACCCTGG + Exonic
1120225431 14:81786194-81786216 TTTCATCTGACATCTAAGTCAGG + Intergenic
1202889926 14_KI270722v1_random:146720-146742 TTCCATTTGTGTTCTTACACTGG - Intergenic
1124180803 15:27471678-27471700 TCTCATATGTGATATAAGAATGG + Intronic
1126499798 15:49332872-49332894 TTGCATTTGTGCTCTGTGACTGG + Intronic
1127003507 15:54538721-54538743 TATCCTTTGTGAACTAACACGGG + Intronic
1127324031 15:57876744-57876766 TATTCTTTGTGATCTAAGAAAGG + Intergenic
1129769535 15:78194264-78194286 TTTCATTTGTGATCACATTCAGG - Intronic
1132009853 15:98266425-98266447 TTTCGTCTGCTATCTAAGACTGG - Intergenic
1135283911 16:21176635-21176657 TTTCATTTGTTTTTTGAGACAGG - Intronic
1137527647 16:49250172-49250194 TTTCATTTGTGCTCTAGGCTGGG + Intergenic
1140230662 16:73114769-73114791 TTGCCCTTGTGATCAAAGACAGG - Intergenic
1142298019 16:89239847-89239869 TTTCATTTCTGAATTAAGAATGG - Intergenic
1142603710 17:1070281-1070303 TCTCAGCTGTGATCTCAGACAGG + Intronic
1143692610 17:8582434-8582456 TTTCACTGCTGGTCTAAGACAGG + Intronic
1146479795 17:33195988-33196010 TTACCTTTGTGAGGTAAGACAGG - Intronic
1146682392 17:34817497-34817519 TTTCTTTTGTTTTCTGAGACAGG - Intergenic
1147556427 17:41482130-41482152 TTTCAGCTGTGATCTGGGACAGG - Intergenic
1148308300 17:46611694-46611716 TTTCATATGTGATGTGAGGCAGG - Intronic
1150972704 17:70047511-70047533 TTTCTTTTTTAATATAAGACAGG - Intergenic
1153171017 18:2315846-2315868 TTTCTTCTGTGATCTAAAAAAGG + Intergenic
1153578372 18:6545873-6545895 TCTCATTTGTGAACTCTGACGGG + Intronic
1154266402 18:12883205-12883227 TTTCATGTGTGCTCCCAGACGGG - Intronic
1154499340 18:14987373-14987395 TTTGATTTCTGAACTAACACCGG - Intergenic
1155834482 18:30562304-30562326 TTTAATTTATGATGTGAGACAGG + Intergenic
1157292762 18:46421858-46421880 TTTCATTAGAGATCAAAGCCTGG + Intronic
1158584363 18:58718325-58718347 TTTCATCTGTGCTTTATGACAGG + Intronic
1160545973 18:79655698-79655720 TTTCATATATGATGTAAGGCAGG - Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163719683 19:18893218-18893240 TTTCTTTTTTGATACAAGACAGG + Intronic
1165566409 19:36732473-36732495 TTTTATTTGTGATCTAAGATAGG + Intronic
1166901714 19:46068947-46068969 TTTCATTTGTGATTAGGGACAGG + Intronic
1168032801 19:53694570-53694592 TTTGTTTTTTTATCTAAGACTGG + Intergenic
1168037265 19:53730010-53730032 TTTGTTTTGTTTTCTAAGACAGG + Intergenic
1168038943 19:53742682-53742704 TTTTTTTTGTTTTCTAAGACAGG + Intergenic
1168040768 19:53756911-53756933 TTTTGTTTTTTATCTAAGACAGG + Intergenic
1168167847 19:54565072-54565094 TATCATTTGTTATCTAAGTAGGG + Intergenic
1202665340 1_KI270708v1_random:113552-113574 TTCCATTTGTGTTCTTACACTGG - Intergenic
928166652 2:28977124-28977146 TGTCATTTGTGATCAGACACTGG - Intronic
928434977 2:31249059-31249081 CTTCATGTGTGATCAAAGCCTGG - Intronic
929078558 2:38098786-38098808 TTTCCTTTCTGATCTGAGAAAGG + Intronic
930710292 2:54544421-54544443 TCTCATTTGTGATGTCAGAGTGG + Intronic
931707398 2:64958483-64958505 TTTAATTTTTGTTTTAAGACAGG - Intergenic
931905754 2:66841720-66841742 TTAGTTTTGTGATTTAAGACTGG + Intergenic
933823511 2:86137271-86137293 TTTCATTTGTCATGCAAGTCAGG + Intronic
934153152 2:89169207-89169229 TTTCATTTGGGATCAAGGAAGGG + Intergenic
934214087 2:90012724-90012746 TTTCATTTGGGATCAAGGAAGGG - Intergenic
934509272 2:94924270-94924292 TTGTATTTGTATTCTAAGACAGG + Intergenic
935006438 2:99083020-99083042 TTTTATTTGTGCTCTAATATAGG - Intronic
935691590 2:105736821-105736843 TTTGCTTTGTGACCTTAGACAGG + Intergenic
936601340 2:113898343-113898365 TTTCATTTGTAAATGAAGACTGG - Intronic
937483193 2:122285023-122285045 TTTCATTTGTTTTCTAATAGAGG + Intergenic
938498549 2:131817741-131817763 TTTGATTTCTGAACTAACACTGG - Intergenic
939767935 2:146276686-146276708 TTTGATTTATGATCTAAAATAGG + Intergenic
940250442 2:151669791-151669813 TTTGATTCGTGTTTTAAGACAGG + Intronic
941497110 2:166219445-166219467 TTTCATTAGTAAACTAAGGCAGG + Intronic
941516014 2:166479767-166479789 AGTCATTTGTAATCAAAGACAGG + Intronic
941863813 2:170312950-170312972 TTTCATTTGTGATATAATCATGG + Intronic
944365821 2:198918423-198918445 TTCACTTTATGATCTAAGACTGG + Intergenic
944381005 2:199110825-199110847 TTTGATTTGTCATCTAGGAAAGG - Intergenic
944917479 2:204375805-204375827 TTTCATTTGTAATTTTAGGCAGG - Intergenic
945161144 2:206892092-206892114 TTTCATTTCTTACCTAGGACTGG + Intergenic
945317425 2:208385032-208385054 TTTTATTTCTGTTCTAAGAAGGG - Intronic
946089198 2:217205936-217205958 TTTCATTTGGGATGTAAGAGGGG + Intergenic
946650371 2:221886742-221886764 TTTCATTTGTGAATTAGGACTGG + Intergenic
1171009966 20:21504124-21504146 TTTCATTTTTTTTCTGAGACAGG - Intergenic
1172562827 20:35904719-35904741 TTCCCTTTGTGATCTCAGGCAGG + Intronic
1175528741 20:59659208-59659230 TTTGATTTGTGATCAAAAAGAGG - Intronic
1176801062 21:13431482-13431504 TTTCTTTTTTTTTCTAAGACAGG - Intergenic
1176916868 21:14636160-14636182 TTTTATTTCTGCTCTCAGACTGG - Intronic
1177125406 21:17187266-17187288 TTGCTTTTGTGTTCTAAGTCAGG - Intergenic
1180332052 22:11490472-11490494 TTCCATTTGTGTTCTTACACTGG - Intergenic
1180435743 22:15301982-15302004 TTTTGTTTGTGATGCAAGACAGG - Intergenic
949285583 3:2399446-2399468 ATTCATTTGTGATTTCAGAATGG + Intronic
949307661 3:2661157-2661179 TTTCCTTTGTCATCTTAGTCTGG - Intronic
952786320 3:37159155-37159177 TTTCATATATGGTATAAGACAGG + Intronic
952911852 3:38196816-38196838 TTACATGTGAGATCTAAGACTGG - Intronic
955206431 3:56899882-56899904 TTTCATTTTTAATCCATGACTGG - Intronic
955526896 3:59830342-59830364 TTTCATTTGGGATAAAAGCCAGG + Intronic
958783552 3:98571805-98571827 TTTCCTCTTTGATCCAAGACTGG + Intronic
959370568 3:105520330-105520352 TATCATTTGTTATGTAAGATAGG - Intronic
960379067 3:116937940-116937962 TTTCATCTGTGATTTATGAATGG + Intronic
960781782 3:121327917-121327939 TTACTTTTGTGAGCTAAGACAGG + Intronic
965144300 3:164879558-164879580 TTTCATTTGTGACATAAGAATGG + Intergenic
965309176 3:167107722-167107744 TTGCATTTCTGGTCTAAGATGGG - Intergenic
966170071 3:177069914-177069936 TTTCAACTGTGATCTAAGCCAGG + Intronic
967294551 3:187952404-187952426 TCTCATTTCTACTCTAAGACTGG - Intergenic
967798364 3:193624751-193624773 TTTCATTTATTGTCTAATACTGG + Intronic
969077405 4:4590941-4590963 TTTCATTTGGGATTTGAGGCTGG - Intergenic
971726484 4:30319676-30319698 TTTCATTTGTGGTCTATAATAGG + Intergenic
971736315 4:30457245-30457267 TTTTATTTGTGCTTTAAAACTGG + Intergenic
972956391 4:44397240-44397262 TTTCACTTGTGATCTACAAAAGG - Intronic
975302893 4:72812159-72812181 TTTCATTTTTGTTTTGAGACAGG + Intergenic
976191071 4:82487441-82487463 TGTTTTTTGTGATTTAAGACAGG - Intronic
977156802 4:93584056-93584078 TTTCATTTGTGATCTAAGACCGG - Intronic
977850327 4:101819872-101819894 TATCATCTGTGAGCTAAGAATGG + Intronic
978245675 4:106569735-106569757 TGTCATTTGTGATGTAAAAGTGG - Intergenic
980348232 4:131652459-131652481 TGTCATTGGTGACCTAAGAAAGG - Intergenic
981506974 4:145512943-145512965 TTTCATTTTTGCCCTTAGACTGG + Intronic
983469936 4:168143698-168143720 TCTCATTTTTCATCTAAAACAGG + Intronic
985975140 5:3413896-3413918 TTGCATTTGAGATCTAGGAGTGG - Intergenic
987813783 5:22874058-22874080 TTTCATTTGTGTTCTGAGAAGGG + Intergenic
990256146 5:53972186-53972208 TTACATTTATGATCCAAGAGGGG - Intronic
990496469 5:56353318-56353340 TTTCATGTGTAATTTAAAACTGG + Intergenic
990644123 5:57824346-57824368 TTTCATCTATGACCGAAGACAGG - Intergenic
990680903 5:58243017-58243039 TTTCATTTGTGGTCTATTAAAGG - Intergenic
991270204 5:64769984-64770006 TTTCATATGTGATATAAGCTAGG - Intronic
992699413 5:79326471-79326493 CTTCATTTGTGAACCAAGAGGGG + Exonic
993477348 5:88381439-88381461 TTTCATTTTTGTTTTCAGACAGG - Intergenic
994625742 5:102216229-102216251 TTTGAATTCTGATATAAGACGGG - Intergenic
994856215 5:105123130-105123152 TTTCACTTGTAATTTTAGACTGG - Intergenic
995042353 5:107603284-107603306 TTTCCTTTCTAAGCTAAGACTGG - Intronic
995122229 5:108548293-108548315 TTTCATTTTTGTTCTAATAAAGG + Intergenic
995431010 5:112077412-112077434 TTTCACTTCTAATCTAAGAATGG - Intergenic
996077987 5:119219928-119219950 TTTCATTTGTGATCTTTTTCTGG + Intronic
996408424 5:123129830-123129852 TTCCACTTAGGATCTAAGACAGG + Intronic
996421423 5:123267191-123267213 TTTCATTAATGCACTAAGACAGG + Intergenic
996540180 5:124623393-124623415 GTTCATTTGTTTTCTTAGACAGG + Intergenic
996789267 5:127275190-127275212 TTTCCTTTTTGATATAAGACAGG - Intergenic
999695125 5:154182011-154182033 CTTCCTGTGTGATCTCAGACAGG - Intronic
999789022 5:154920619-154920641 TTTGATTTGTGATCTACCAGTGG - Intronic
1000156074 5:158553030-158553052 ATTCAATGGTGATGTAAGACTGG + Intergenic
1000389162 5:160705219-160705241 TATCCTTTGTTTTCTAAGACAGG + Intronic
1003624942 6:7732862-7732884 GTTCATTTTTGATATAAGATGGG - Intronic
1005769255 6:29049955-29049977 TTTCATTTGTTATCAAAAAATGG + Intergenic
1007232972 6:40362661-40362683 TTTCCTTTGTGATCTAATATAGG - Intergenic
1007556401 6:42770232-42770254 TTTCTTTTGTTTTTTAAGACAGG + Intronic
1009051846 6:58284652-58284674 TTTCATTTCTGATTTTAGATGGG - Intergenic
1010923710 6:81717306-81717328 TCTCACTTGCAATCTAAGACAGG + Intronic
1010972386 6:82276687-82276709 TTTCAGATGGGATGTAAGACTGG - Intergenic
1011773381 6:90700491-90700513 TTTCATTTTTCATCTATGGCAGG + Intergenic
1013454546 6:110318337-110318359 TTTTATTTCTGAGCTAAGAAAGG - Intronic
1013809799 6:114031934-114031956 TTTTATTTTTTATCTGAGACAGG + Intergenic
1013844359 6:114431736-114431758 CATCATGTGTGGTCTAAGACTGG - Intergenic
1016022480 6:139250571-139250593 TTTCATTTGTATTCTCAGCCCGG + Intronic
1016720646 6:147293327-147293349 TTTCTTTTGTCACCTAAGATGGG + Intronic
1016912927 6:149216629-149216651 TTTCTTTTGTTTTTTAAGACAGG - Intergenic
1017518228 6:155177454-155177476 TTTCATTCCTGATCTGAGAAGGG + Intronic
1022691168 7:32656627-32656649 TTTCATTTGTTTTCAAAAACTGG + Intergenic
1024516221 7:50260827-50260849 ATTCAATTGTGAACTAAGAATGG - Intergenic
1024639683 7:51318294-51318316 TTTATTTTGTGTTTTAAGACAGG - Intergenic
1025184901 7:56850138-56850160 TTTCATTTTCTTTCTAAGACAGG - Intergenic
1025687033 7:63726826-63726848 TTTCATTTTCTTTCTAAGACAGG + Intergenic
1026273854 7:68860050-68860072 TTTCATTTTTGTTTTGAGACAGG + Intergenic
1026599212 7:71761439-71761461 TTTCTTTTGTCATCTCTGACTGG + Intergenic
1027216792 7:76188945-76188967 TTTCATTTTTGTTTTGAGACAGG + Intergenic
1028724160 7:94068697-94068719 TTTTCTTTTTGTTCTAAGACTGG + Intergenic
1030096187 7:105902247-105902269 TTTCATTTAAGATTTAAGGCTGG - Intronic
1030224583 7:107135442-107135464 TGTCATCTGTGAACAAAGACAGG - Intronic
1031412757 7:121459372-121459394 GTTCATTAGTGATCCAAGAAGGG + Intergenic
1033276290 7:139974069-139974091 TTTAATTAGTAATTTAAGACTGG + Intronic
1033853057 7:145521455-145521477 TTTCATTTATGAGCAAGGACTGG + Intergenic
1035660265 8:1342360-1342382 TTTAATTTGTGATGTATGGCAGG + Intergenic
1037935913 8:22914978-22915000 TATAATTTCTCATCTAAGACAGG - Intronic
1043149287 8:76693631-76693653 TTTTATTTGTGAGCAAAGAAAGG + Intronic
1044072190 8:87776093-87776115 CTTCATCTGTGTTCTAACACAGG + Intergenic
1044388581 8:91620941-91620963 TTTCATCTCTGATTTGAGACAGG + Intergenic
1044535065 8:93348720-93348742 TCTCATCTGTCATCTACGACAGG - Intergenic
1046078647 8:109342876-109342898 TTTCATTTGTCTTCTGAGATGGG + Intronic
1047813917 8:128441860-128441882 TTTCATCTGTGATGAAAGAGAGG + Intergenic
1048246738 8:132811443-132811465 TTCCATTTGTGAGTTAAAACAGG + Intronic
1048553208 8:135453275-135453297 ATTCATTTGTCATGTAAGGCAGG - Intergenic
1049953462 9:669032-669054 TTTTTTTTGTGATCTAAGACAGG - Intronic
1051454190 9:17234630-17234652 TTCCATTTCTGATCTATCACTGG - Intronic
1054731693 9:68707090-68707112 TTTCATGTGTGATCTCTGAGCGG + Intronic
1055214837 9:73846601-73846623 TTTCATATGGGATAAAAGACTGG + Intergenic
1060676931 9:125523737-125523759 TTGCCTTTGTGATCTAACCCTGG + Intronic
1061328342 9:129877515-129877537 TTTCGTTTGTGTTCTGAGACAGG - Intronic
1062112008 9:134787046-134787068 TTTCATTTAGGATCTAACAGTGG + Intronic
1203487029 Un_GL000224v1:65960-65982 TTCCATTTGTGTTCTTACACTGG - Intergenic
1203499651 Un_KI270741v1:7860-7882 TTCCATTTGTGTTCTTACACTGG - Intergenic
1188838059 X:34983060-34983082 TTTCATATGTGGTGTAAGAAAGG - Intergenic
1189500763 X:41555083-41555105 TTTCATGTTTGAACTAACACAGG + Intronic
1192013361 X:67299658-67299680 TCTCATTTGTGATCCAGGAGTGG + Intergenic
1193285261 X:79706594-79706616 TTACATTTTTGATGAAAGACAGG - Intergenic
1194406443 X:93501968-93501990 TTTCATATATGATGTAAGAAAGG - Intergenic
1196623347 X:117849621-117849643 TTTCCTTGGTGAACTAAGAAAGG - Intergenic
1197724488 X:129767634-129767656 TATCATTTGTGCCCTATGACCGG + Exonic
1197922809 X:131613276-131613298 TCTCTTTTATGATCTAGGACAGG - Intergenic