ID: 977167833

View in Genome Browser
Species Human (GRCh38)
Location 4:93723479-93723501
Sequence TTAGCTACACACAACCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977167831_977167833 13 Left 977167831 4:93723443-93723465 CCAGGAGATTAGGGTATGGACCA 0: 1
1: 0
2: 1
3: 12
4: 76
Right 977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG No data
977167829_977167833 18 Left 977167829 4:93723438-93723460 CCAGACCAGGAGATTAGGGTATG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG No data
977167828_977167833 19 Left 977167828 4:93723437-93723459 CCCAGACCAGGAGATTAGGGTAT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG No data
977167832_977167833 -7 Left 977167832 4:93723463-93723485 CCAATCAGAATTGATGTTAGCTA 0: 1
1: 0
2: 2
3: 10
4: 138
Right 977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977167833 Original CRISPR TTAGCTACACACAACCAGCT TGG Intronic
No off target data available for this crispr