ID: 977169543

View in Genome Browser
Species Human (GRCh38)
Location 4:93743752-93743774
Sequence TCCCATTAGGCCCCACCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977169543 Original CRISPR TCCCATTAGGCCCCACCTAA TGG Intronic
900416304 1:2536436-2536458 TCCCCTTTGTCCCCACCTCAGGG - Intergenic
900512809 1:3068473-3068495 TCCCCTTCGCCCCCACCCAACGG - Intergenic
907617642 1:55940681-55940703 TTAGATTAGGGCCCACCTAATGG + Intergenic
909488981 1:76205569-76205591 TCCCCTTAGGCATCCCCTAAGGG + Intronic
918963678 1:191312119-191312141 TCCCACCAGGCCCCACCTCCAGG - Intergenic
923369781 1:233298353-233298375 TCACATTAGGTCACTCCTAATGG - Intergenic
1078083040 11:8217746-8217768 GCCCATTAGGCACCCCCTGAGGG - Intergenic
1081180704 11:39983350-39983372 TTCCACTAGGCCCCACCTCCAGG - Intergenic
1086725679 11:90180559-90180581 TTCTATTAGGTCACACCTAATGG - Intronic
1088294665 11:108278810-108278832 TCCCATTAGGCATAACCTAATGG + Intronic
1088523674 11:110728212-110728234 AGCCATTCTGCCCCACCTAAGGG - Intergenic
1113965779 13:114152880-114152902 TCCAATTAGGCCCAACCTGAGGG - Intergenic
1115344781 14:32330765-32330787 TCCCATTAGGCACCAGCCAGAGG + Intronic
1115450109 14:33538175-33538197 TCCCATTCAGCCCCACTTTAAGG + Intronic
1115853810 14:37608713-37608735 CACAATTAGGGCCCACCTAAAGG - Intronic
1117539062 14:56729111-56729133 TCCCATTTCCCACCACCTAAAGG - Intronic
1119550240 14:75504745-75504767 TCCCATTAGGCCCCACTTACTGG + Intergenic
1120743018 14:88128543-88128565 TCCCAGTAGGCTACAGCTAAAGG - Intergenic
1129200785 15:73997945-73997967 TCCCAAAAGCCCCCACCTACCGG - Intronic
1131395083 15:92079548-92079570 TCAGATTAGGGCCCATCTAAGGG + Intronic
1134121311 16:11586768-11586790 TCCCAGGAGGCCCCAGCCAAGGG + Intronic
1137822615 16:51460357-51460379 TCCAATTAGACACCACTTAATGG - Intergenic
1137848813 16:51717875-51717897 TCTCATTAGGGACCACCAAATGG + Intergenic
1140941640 16:79726648-79726670 TCCCTTTGGGCTCCACCAAAGGG - Intergenic
1148914368 17:50962034-50962056 TGCCATTTGGCACCAGCTAAAGG - Intergenic
1149622984 17:58060115-58060137 GCCTCTTAGGCCCCACCTATTGG - Intergenic
1154171737 18:12057286-12057308 TTCCACTGGGCCCCACCTGAAGG - Intergenic
1158014137 18:52764409-52764431 TCCCATTAGGCCCCACCTTGTGG - Intronic
929762096 2:44815117-44815139 TACCAGGAGGCCCCTCCTAATGG - Intergenic
930304187 2:49657561-49657583 TCCTATCAGGCCCTACCTCAGGG + Intergenic
933998779 2:87689159-87689181 TCCCACTAGGGCCCACCTCCAGG + Intergenic
936295071 2:111261719-111261741 TCCCACTAGGGCCCACCTCCAGG - Intergenic
936662449 2:114557351-114557373 TTCCAATATGCCCCACCTATAGG - Intronic
1172602033 20:36190629-36190651 TCCCCTGAGCCCCCACCCAAGGG + Exonic
1173850681 20:46216041-46216063 TCACATTAGGCCCCGCCACAGGG - Intronic
1175567381 20:59991187-59991209 TCCCTTTAGGCACCACCAACAGG + Intronic
1175645888 20:60671358-60671380 GTCCATTTTGCCCCACCTAAGGG + Intergenic
1177849487 21:26329623-26329645 TTGGATTAGGTCCCACCTAATGG + Intergenic
1177991373 21:28039558-28039580 TCCCAGTTGGCCCCCCCTAAGGG - Intergenic
949995397 3:9612569-9612591 TCCCACCAGGCCCCACCTCCAGG - Intergenic
951925589 3:27905784-27905806 TCCCATTGGTCCCCAGCTGAGGG - Intergenic
952568926 3:34690290-34690312 TTGAATTAGGACCCACCTAATGG - Intergenic
955167809 3:56531670-56531692 TTAGATTAGGGCCCACCTAATGG + Intergenic
956554619 3:70505005-70505027 AACCAGTAGGCCCCACCTCATGG + Intergenic
958563830 3:95781787-95781809 CCCCATTGGGCACTACCTAATGG + Intergenic
960784645 3:121358595-121358617 TCCCACCAGGCCCCACCTCCTGG + Intronic
960946375 3:122969590-122969612 TCCCATTCTGCTCCACCTCATGG + Intronic
963349204 3:144132035-144132057 TCCCACTAGGCCCCACCTGGTGG + Intergenic
966113833 3:176436811-176436833 TCCCTTTAGGTCCCTCCTACTGG + Intergenic
967841180 3:194005883-194005905 CCCCCTGAAGCCCCACCTAAGGG + Intergenic
968546637 4:1202322-1202344 TCCCATCAGTCCCCACCTCCCGG + Intronic
969177780 4:5412359-5412381 TCCCAGTGGGCCTCATCTAATGG - Intronic
970404873 4:15753518-15753540 TCTCCTTAGGGCTCACCTAATGG - Intergenic
971817996 4:31514584-31514606 TCCCATTAGGGCTCACTTAAAGG + Intergenic
972278849 4:37584414-37584436 TCCCATTAGGGCACACCACATGG - Intronic
972930124 4:44062334-44062356 TCCCACTAGGCCGCACCTAGTGG - Intergenic
973918181 4:55657618-55657640 TCCCATTAGTCCTCAGTTAAGGG + Intergenic
973949515 4:55997311-55997333 TACTTTTAGGGCCCACCTAAGGG + Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
975358942 4:73443559-73443581 TCCCATTAGCCCTCATCAAAGGG - Intronic
977169543 4:93743752-93743774 TCCCATTAGGCCCCACCTAATGG + Intronic
977789495 4:101082468-101082490 TCCCAGTAGGCTCCACTGAAAGG - Intronic
980614080 4:135195203-135195225 TCCCACCAGGCCCCACCTCCTGG - Intergenic
984959188 4:185078002-185078024 TACCAGTAGGCCTTACCTAAAGG - Intergenic
989020714 5:37003653-37003675 TCACATTAGTCCCTCCCTAATGG - Intronic
993452144 5:88085313-88085335 GCTCATTAGGTCCCTCCTAATGG + Intergenic
993739632 5:91522365-91522387 TCCTTTTAAGCCTCACCTAATGG + Intergenic
996442482 5:123507786-123507808 TCTCATCAGCCCCCACCTATAGG - Intergenic
998960525 5:147481620-147481642 TCCCATGAGGCCCCACCTTCAGG - Intronic
1004520811 6:16359205-16359227 CCCAATTAGGCCCCACCTTCAGG + Intronic
1006136629 6:31900000-31900022 TGCCATTAGGCGGCACCTCAAGG - Exonic
1008972389 6:57384627-57384649 TCCCATGATACCCCATCTAAAGG - Intronic
1011481847 6:87801994-87802016 TCCCAATTGGTCCCACCAAAAGG - Intergenic
1012001955 6:93664909-93664931 TCCCACTAGGCCCCACTTCCAGG + Intergenic
1018309893 6:162496968-162496990 TCCCATTGGATTCCACCTAAAGG - Intronic
1023203641 7:37724815-37724837 GCCCCATAGGCCCCACCTCAAGG - Intronic
1027491341 7:78831196-78831218 CCCTATTAGGCCCCATCCAATGG + Intronic
1031441840 7:121804077-121804099 TCCAATTAGGCTCCTTCTAATGG + Intergenic
1036610003 8:10341477-10341499 TTCCACTAGGCCCCACCTCCAGG + Intronic
1037363618 8:18099479-18099501 TTCCATTATGCCCCAGCTACTGG + Intergenic
1038284832 8:26197495-26197517 TTCCATTAGGGCCCACCTAATGG + Intergenic
1046212512 8:111096249-111096271 TCCGGTTCTGCCCCACCTAAAGG - Intergenic
1049178090 8:141206299-141206321 TCCCTTTAGTCCCCACCACAGGG + Intergenic
1050130472 9:2406812-2406834 TCCCATGAAGCCCCACCTTCAGG + Intergenic
1055545756 9:77371523-77371545 TCTAATTAGGCCCCACCTCCTGG + Intronic
1059046707 9:110876967-110876989 TCCCATTACACCTCACCTAATGG + Intronic
1060733527 9:126052261-126052283 TCCCTGTTGTCCCCACCTAACGG + Intergenic
1186840303 X:13478519-13478541 TCCCAGCAGGTCCCACCTTAAGG + Intergenic
1187633176 X:21197465-21197487 TCCCATAAAGCCCCACCTCCTGG + Intergenic
1189886005 X:45545709-45545731 TCCCACCAGGCCCCACCCATTGG + Intergenic
1190244753 X:48683852-48683874 TCCCATTGGGCCCCCACTCATGG - Exonic
1191897603 X:66009993-66010015 TCCTATAATGGCCCACCTAAAGG - Intergenic
1196965153 X:121047528-121047550 TCCCCTTGGGCGCCACCTAACGG - Intergenic
1201303642 Y:12532141-12532163 TCCCATGAGGCAGGACCTAAAGG - Intergenic