ID: 977169545

View in Genome Browser
Species Human (GRCh38)
Location 4:93743753-93743775
Sequence CCCATTAGGCCCCACCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977169545 Original CRISPR CCCATTAGGCCCCACCTAAT GGG Intronic