ID: 977169545

View in Genome Browser
Species Human (GRCh38)
Location 4:93743753-93743775
Sequence CCCATTAGGCCCCACCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977169545 Original CRISPR CCCATTAGGCCCCACCTAAT GGG Intronic
902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG + Intronic
905516174 1:38563597-38563619 GCCATTAGTCCCCACCTATCTGG - Intergenic
909539037 1:76770472-76770494 CCCATTTGTCCCCACTTATTTGG + Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
922501345 1:226098974-226098996 CCCACCAGGCCCCACCTCATAGG - Intergenic
1070467048 10:76733924-76733946 ACCATTAGGGCACAGCTAATGGG - Intergenic
1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG + Intronic
1108380359 13:49848652-49848674 CCCATGTGGCCCCAGCTACTAGG + Intergenic
1113965777 13:114152879-114152901 CCAATTAGGCCCAACCTGAGGGG - Intergenic
1114764612 14:25356675-25356697 GCCATTTTGTCCCACCTAATGGG + Intergenic
1119384126 14:74246542-74246564 CCCATTACCCTCCACCCAATTGG + Intronic
1120948001 14:90015976-90015998 TCCCTTGGGGCCCACCTAATTGG - Intronic
1130905949 15:88241033-88241055 CCCAAGAGCCCCCACCTAGTAGG - Intronic
1131919579 15:97309628-97309650 GCCATTTGGCCCCACCTAAGAGG - Intergenic
1134388892 16:13800349-13800371 CCCCTGAGCCCCCACCTACTAGG + Intergenic
1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG + Exonic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1138952266 16:61927678-61927700 GCCATTAGGTGCCACCTGATGGG - Intronic
1142109027 16:88321415-88321437 CTCATAAGGCCTCACCTGATTGG + Intergenic
1142109064 16:88321663-88321685 CTCATAAGGCCTCACCTGATTGG + Intergenic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1146530952 17:33607347-33607369 CACATTAGGGACCACCTACTAGG + Intronic
1159758883 18:72399953-72399975 CCCAATAGGCCAGATCTAATTGG + Intergenic
1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG + Exonic
929762095 2:44815116-44815138 ACCAGGAGGCCCCTCCTAATGGG - Intergenic
933906147 2:86895223-86895245 CAAATTAGGACCCACCTAAATGG - Intergenic
935766991 2:106378401-106378423 CAAATTAGGACCCACCTAAATGG - Intergenic
935911767 2:107904397-107904419 CATATTAGGACCCACCTAAATGG - Intergenic
938893468 2:135728088-135728110 GCCATAAGGCCCTACCTAGTGGG - Intergenic
1170737827 20:19026555-19026577 CCCATTAGGCCTCAACTAGGAGG - Intergenic
1175394044 20:58646458-58646480 CCCAACAGGCCCCACCTAAATGG - Intergenic
1177991371 21:28039557-28039579 CCCAGTTGGCCCCCCCTAAGGGG - Intergenic
1179355947 21:40659730-40659752 CCCATTAGGCTGTACCTGATGGG + Intronic
1182890341 22:33812968-33812990 CCAATTTGGTACCACCTAATAGG - Intronic
950681072 3:14585488-14585510 CCCATTAGGCCCCCACTTCTGGG + Intergenic
952568925 3:34690289-34690311 TGAATTAGGACCCACCTAATGGG - Intergenic
955941696 3:64152164-64152186 CCCATTTTGCCCCACTTAAAAGG - Intronic
956554620 3:70505006-70505028 ACCAGTAGGCCCCACCTCATGGG + Intergenic
957923191 3:86773000-86773022 CCCAGTAGGCCCGAGCTACTAGG + Intergenic
960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG + Intronic
963337093 3:143987854-143987876 GCCATTAGCAACCACCTAATTGG + Intronic
963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG + Intergenic
968639593 4:1706158-1706180 ACCAGTAGGCCCCAGCTACTAGG + Intronic
969177778 4:5412358-5412380 CCCAGTGGGCCTCATCTAATGGG - Intronic
970034778 4:11720840-11720862 TCCATGAGATCCCACCTAATAGG + Intergenic
972278847 4:37584413-37584435 CCCATTAGGGCACACCACATGGG - Intronic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
980614078 4:135195202-135195224 CCCACCAGGCCCCACCTCCTGGG - Intergenic
987228001 5:15863645-15863667 CCCACTAGGCCCCACCTCCCAGG - Intronic
987451750 5:18093464-18093486 CCCATTAGATCCTTCCTAATAGG - Intergenic
988076689 5:26363180-26363202 CCATCTTGGCCCCACCTAATTGG + Intergenic
1000963920 5:167632161-167632183 CCCAGTAGGGCCCACCTGAGAGG + Intronic
1011340977 6:86313836-86313858 GCCATTAGGCCCTAAATAATTGG + Intergenic
1021846645 7:24769535-24769557 GCCATTCTGCCCCACATAATGGG + Intergenic
1033719382 7:144041477-144041499 CCCATCAGGCCACACCTCAAAGG - Intergenic
1039897923 8:41729514-41729536 CGCCTTAGTCCCCACCTACTTGG - Intronic
1043107969 8:76139006-76139028 CCTAATAGCACCCACCTAATTGG + Intergenic
1043968934 8:86508813-86508835 TCCATTAAGTCCCACCCAATCGG - Intronic
1048343082 8:133555646-133555668 CCATTTAGGACCCACCTGATTGG + Intronic
1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG + Intergenic
1055501665 9:76907501-76907523 CCCATTAAGCCACACCTATTAGG - Intergenic
1059046709 9:110876968-110876990 CCCATTACACCTCACCTAATGGG + Intronic
1060200002 9:121646673-121646695 CACACTAGGCCCCACACAATGGG - Intronic
1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG + Intergenic
1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG + Intergenic
1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG + Intergenic
1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG + Intergenic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1192868653 X:75163807-75163829 CTCATCAGGCCTCACCTAATAGG - Intergenic
1196965151 X:121047527-121047549 CCCCTTGGGCGCCACCTAACGGG - Intergenic
1200039754 X:153356293-153356315 ACCATTTGGCCCCTCCTATTTGG - Intronic