ID: 977169546

View in Genome Browser
Species Human (GRCh38)
Location 4:93743754-93743776
Sequence TCCCATTAGGTGGGGCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977169546_977169552 5 Left 977169546 4:93743754-93743776 CCATTAGGCCCCACCTAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 977169552 4:93743782-93743804 GTTTCAGCATGAGATTTGGAAGG 0: 5
1: 146
2: 1384
3: 2719
4: 5925
977169546_977169551 1 Left 977169546 4:93743754-93743776 CCATTAGGCCCCACCTAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 977169551 4:93743778-93743800 TCAAGTTTCAGCATGAGATTTGG No data
977169546_977169553 6 Left 977169546 4:93743754-93743776 CCATTAGGCCCCACCTAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 977169553 4:93743783-93743805 TTTCAGCATGAGATTTGGAAGGG 0: 15
1: 206
2: 1349
3: 2636
4: 5923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977169546 Original CRISPR TCCCATTAGGTGGGGCCTAA TGG (reversed) Intronic
905914885 1:41677945-41677967 ACCCATTAGCTGGGGCCTCCAGG - Intronic
1064962724 10:20983722-20983744 TCTCATTAGTTTGTGCCTAATGG - Intronic
1066660762 10:37736782-37736804 CCTCATAAGGTGGGGCCTCATGG - Intergenic
1070467047 10:76733923-76733945 GCCCATTAGCTGTGCCCTAATGG + Intergenic
1073333064 10:102683787-102683809 TCCCATCAGGTGGAGATTAAAGG - Intronic
1077544836 11:3164876-3164898 CCCCACTTGGTGGGGCTTAAAGG - Intronic
1078730481 11:13969628-13969650 TCCCATTAGGATGGGACTACAGG + Intronic
1084040082 11:66537470-66537492 TCCCAAAAGGTGGGGCCAAAAGG - Intronic
1088294668 11:108278812-108278834 CCCCATTAGGTTATGCCTAATGG - Intronic
1091819079 12:3461001-3461023 TTCCAGTAGGTGTGGCCTGAGGG + Intronic
1092531246 12:9347455-9347477 TTCCAGTAGGTGTGGCCTGAGGG - Intergenic
1092806295 12:12226086-12226108 TCCCCTTAGGTGGGACAGAATGG - Intronic
1094423615 12:30297202-30297224 TTCCAGCAGGTGTGGCCTAAGGG - Intergenic
1101858257 12:108462466-108462488 TCCCATGAGCTGGGGCAGAAAGG - Intergenic
1104095521 12:125553553-125553575 TCACATTGGGTGGGGTCTGACGG + Intronic
1114690059 14:24573229-24573251 TGGCATTAGGTGGGGCCTTTGGG + Intergenic
1114764613 14:25356676-25356698 CCCCATTAGGTGGGACAAAATGG - Intergenic
1114844285 14:26302240-26302262 TACCATCAGGTGGGACCGAAGGG - Intergenic
1119550242 14:75504747-75504769 GGCCAGTAAGTGGGGCCTAATGG - Intergenic
1120948000 14:90015975-90015997 TCCAATTAGGTGGGCCCCAAGGG + Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122274561 14:100585107-100585129 TCCCAGGAGGTGGGGTCCAAGGG - Intronic
1122946797 14:105014968-105014990 CCCCATAATGTGGGGCCTACAGG + Intronic
1131779742 15:95843481-95843503 TCCCTTTAGTTGGGGAGTAAGGG - Intergenic
1131919578 15:97309627-97309649 CCCTCTTAGGTGGGGCCAAATGG + Intergenic
1138477395 16:57279904-57279926 TCCCAGGAGGTGGGGCAAAATGG + Intronic
1138952265 16:61927677-61927699 CCCCATCAGGTGGCACCTAATGG + Intronic
1139218233 16:65150804-65150826 TCCCATCAGGTAGAGCCTGAAGG - Intergenic
1151387026 17:73761219-73761241 TACCATTGGATGGGGCCTGAAGG + Intergenic
1158014135 18:52764407-52764429 ATCCACAAGGTGGGGCCTAATGG + Intronic
929762094 2:44815115-44815137 CCCCATTAGGAGGGGCCTCCTGG + Intergenic
932588124 2:73044911-73044933 TCCCCTCAGGTGGGGCCTTGAGG - Intronic
934120357 2:88832166-88832188 GCTCATTAGGTGTAGCCTAAGGG + Intergenic
938893467 2:135728087-135728109 CCCCACTAGGTAGGGCCTTATGG + Intergenic
944924436 2:204449787-204449809 TCCCAGTAGGTGGGTCCTGAGGG + Intergenic
948042294 2:234912015-234912037 TTCCTTTAGGTGGGGCCACAAGG - Intergenic
948387173 2:237588143-237588165 TGCTAGGAGGTGGGGCCTAATGG + Intronic
1169908840 20:10630526-10630548 TCCCAGTAGGAGGAGCCTAGAGG + Intronic
1169928512 20:10807770-10807792 TCCCATTAGGTGTGGCCAATGGG - Intergenic
1169928623 20:10808459-10808481 TCCCATTAGGTGTGGCCAATGGG + Intergenic
1170282893 20:14670988-14671010 TGCCATTAGGTGGGGCTTCCAGG - Intronic
1173556855 20:43972582-43972604 TCCTATGAGGAGGGGCCTACAGG + Intronic
1177991370 21:28039556-28039578 TCCCCTTAGGGGGGGCCAACTGG + Intergenic
1178931129 21:36820177-36820199 TCCCATGAGTTGGGGACTAGGGG + Intronic
1185356111 22:50371893-50371915 TCCCATTCTGTGGGGATTAAAGG + Intronic
950681073 3:14585489-14585511 TCCCAGAAGTGGGGGCCTAATGG - Intergenic
953356092 3:42257383-42257405 TCTCCTTAGCTGGGGCATAAGGG + Intergenic
954554878 3:51509884-51509906 TACCCTGAGGTGGGGCCTAGAGG + Intergenic
955090181 3:55742934-55742956 TCACATGAGGTGGGGCCCACAGG + Intronic
956554621 3:70505007-70505029 ACCCATGAGGTGGGGCCTACTGG - Intergenic
958690560 3:97460562-97460584 TCCCACTAGTTGGGTCCTGAAGG - Intronic
960784648 3:121358597-121358619 TCCCAGGAGGTGGGGCCTGGTGG - Intronic
963349207 3:144132037-144132059 CCCCACCAGGTGGGGCCTAGTGG - Intergenic
963841091 3:150107209-150107231 TGCCATTTGGTGGGGCCCCAGGG - Intergenic
970034779 4:11720841-11720863 TCCTATTAGGTGGGATCTCATGG - Intergenic
970815586 4:20152240-20152262 TCCCAGCAGCTGGAGCCTAAGGG - Intergenic
977169546 4:93743754-93743776 TCCCATTAGGTGGGGCCTAATGG - Intronic
984788186 4:183588857-183588879 TCCCAATGGGTGGGGCTTATAGG - Intergenic
989089437 5:37714644-37714666 TCCCATGAGGTGGGACCTCTGGG + Intronic
1003817006 6:9852104-9852126 TGCCATTAAGTGGGGCCTGTAGG - Intronic
1004800901 6:19146075-19146097 TCACATTATGTGGGGACTCAAGG + Intergenic
1010275369 6:73962689-73962711 TCCCATTGGGTAGAGCTTAAAGG + Intergenic
1011468868 6:87688006-87688028 TGCCAATAGCTGGGGACTAAAGG - Intronic
1011824622 6:91291524-91291546 TCCTTTTAAGTGTGGCCTAAAGG - Intergenic
1012201439 6:96411269-96411291 TCACATTGGGTGGGGCCTGGTGG - Intergenic
1013651699 6:112201506-112201528 TCCCATTCAGTGGGTCCTGAAGG - Intronic
1015329082 6:131956058-131956080 TACCATTAGGTGGAGCCTAGGGG + Intergenic
1019935974 7:4258284-4258306 TCACACTGGGTGGGGCCTAGGGG - Intronic
1021846646 7:24769536-24769558 CCCCATTATGTGGGGCAGAATGG - Intergenic
1028146900 7:87329046-87329068 TCCCACTAGGTGGTGCCGTAGGG + Intergenic
1029086000 7:98012218-98012240 TCTCATCTGGTGGGGCCTACAGG + Intergenic
1031954711 7:127930397-127930419 TCCATTTAGTTGGGGCCTGAGGG - Intronic
1033109094 7:138559109-138559131 TCTCAATAGGTGGGGACTTAGGG + Intronic
1037287186 8:17313911-17313933 TCCCATTGGGTGGGGGTTATTGG - Intronic
1038228723 8:25681086-25681108 TCAGATTAGGTGGGGCTTGATGG + Intergenic
1038284833 8:26197497-26197519 GGCCATTAGGTGGGCCCTAATGG - Intergenic
1041339406 8:56826459-56826481 TCCCCTTAGGTGAGGCAGAAAGG - Intergenic
1044008968 8:86968053-86968075 TCCCCTTAGGTGGGACAGAATGG + Intronic
1045052917 8:98343107-98343129 TCCCAGTAGCTGGGACTTAAAGG - Intergenic
1048252989 8:132882807-132882829 TCACATTTTGTGGGGCCTAGAGG - Exonic
1049507675 8:143012331-143012353 TCCCATTTGGTGAGCCCTGAAGG - Intergenic
1051981369 9:23023592-23023614 TCCAATTAGATGAGGCCAAAAGG - Intergenic
1055856587 9:80695597-80695619 TCTCATTAGGTTGGTCCTGATGG + Intergenic
1057304600 9:93904865-93904887 TCCCAGCAGGTGGGGGCTCAGGG - Intergenic
1059046710 9:110876969-110876991 GCCCATTAGGTGAGGTGTAATGG - Intronic
1187342435 X:18433102-18433124 TCCCAGGAGGTTGGGCCTACAGG - Intronic
1188743161 X:33810690-33810712 GGCCATGAGGTGGTGCCTAAAGG + Intergenic
1188782726 X:34305686-34305708 TCCCATTAGGTTTGACCAAAGGG + Intergenic
1189202129 X:39205469-39205491 TGCCATAAGGTGGGGACTTAAGG - Intergenic
1191004330 X:55694934-55694956 TCCCTTTAGGTGGGGCAAGATGG + Intergenic
1191586520 X:62833285-62833307 CCCAATTAGGTGGGACCTAATGG - Intergenic
1196965150 X:121047526-121047548 CCCCGTTAGGTGGCGCCCAAGGG + Intergenic
1198052117 X:132959801-132959823 TCACATTTGGAGTGGCCTAAAGG - Intronic
1201303642 Y:12532141-12532163 TCCCATGAGGCAGGACCTAAAGG - Intergenic