ID: 977170376 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:93753905-93753927 |
| Sequence | GTCATGGATCACTTAGTGAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 855 | |||
| Summary | {0: 1, 1: 3, 2: 61, 3: 216, 4: 574} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977170373_977170376 | 8 | Left | 977170373 | 4:93753874-93753896 | CCATAAGGAATTTGGAATCAATT | 0: 1 1: 0 2: 4 3: 32 4: 390 |
||
| Right | 977170376 | 4:93753905-93753927 | GTCATGGATCACTTAGTGATGGG | 0: 1 1: 3 2: 61 3: 216 4: 574 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977170376 | Original CRISPR | GTCATGGATCACTTAGTGAT GGG | Intronic | ||