ID: 977170376

View in Genome Browser
Species Human (GRCh38)
Location 4:93753905-93753927
Sequence GTCATGGATCACTTAGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 3, 2: 61, 3: 216, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977170373_977170376 8 Left 977170373 4:93753874-93753896 CCATAAGGAATTTGGAATCAATT 0: 1
1: 0
2: 4
3: 32
4: 390
Right 977170376 4:93753905-93753927 GTCATGGATCACTTAGTGATGGG 0: 1
1: 3
2: 61
3: 216
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977170376 Original CRISPR GTCATGGATCACTTAGTGAT GGG Intronic