ID: 977172044

View in Genome Browser
Species Human (GRCh38)
Location 4:93775082-93775104
Sequence TCCAGCGTTTAACACACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977172043_977172044 5 Left 977172043 4:93775054-93775076 CCTGCATTTGAACAATAATTTTA No data
Right 977172044 4:93775082-93775104 TCCAGCGTTTAACACACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977172044 Original CRISPR TCCAGCGTTTAACACACCTA AGG Intergenic