ID: 977172161

View in Genome Browser
Species Human (GRCh38)
Location 4:93776554-93776576
Sequence CTGCATGTTGATATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977172161 Original CRISPR CTGCATGTTGATATGGAGCC AGG (reversed) Intergenic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
903385366 1:22922725-22922747 TTGCAGGTTGATCTGGAGCTAGG + Intergenic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906197481 1:43937818-43937840 CTCCATGTGGATAAGGAGGCAGG + Intergenic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
912956020 1:114154440-114154462 CCGCATGTTGCTATGGCGACGGG + Intergenic
913405421 1:118485732-118485754 CTGCATGGAGATAAGGAGGCAGG - Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
914974896 1:152352283-152352305 CTCCATGTTGAGATCCAGCCTGG + Exonic
917088689 1:171329670-171329692 TGTCATGTTGACATGGAGCCAGG - Intronic
920915923 1:210257930-210257952 CTGCAGCTTGAGAAGGAGCCAGG - Intergenic
921265962 1:213420831-213420853 CTGCATGTTCAGAGGGAGCGTGG - Intergenic
921958767 1:221012273-221012295 CTGCAGGATAAAATGGAGCCTGG - Intergenic
922668938 1:227494591-227494613 GTGCTTGTGGATGTGGAGCCGGG - Intergenic
922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG + Intergenic
922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG + Intronic
1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG + Intronic
1065446996 10:25813146-25813168 CAGAATGTTGATATTGGGCCGGG - Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG + Intergenic
1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG + Intronic
1078147588 11:8732193-8732215 CTGCATATGGATTTGGAGCTGGG - Intronic
1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG + Intergenic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1089584395 11:119501207-119501229 CTGCATTTTGATAGGAAGGCTGG - Intergenic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG + Intergenic
1095040572 12:37435902-37435924 TTGCATTTTGAAATGGACCCAGG - Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1102237747 12:111304846-111304868 CTGCCTGTTGATATGTTGGCTGG - Intronic
1103850312 12:123928640-123928662 CTGCATGCTGCTCTGGGGCCGGG + Exonic
1104959410 12:132481088-132481110 CTGCACTTTGCTATGGAGCCTGG - Intergenic
1106921998 13:34574043-34574065 CTGCCTGATGGTATGAAGCCAGG + Intergenic
1110710470 13:78645610-78645632 GTGCTTGTTTAAATGGAGCCTGG - Intronic
1116265105 14:42677901-42677923 CTGGATTTTGATATGAAGTCTGG + Intergenic
1120840369 14:89080233-89080255 CTGCATCTTGGTCTGGATCCTGG + Intergenic
1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG + Intronic
1121973225 14:98378546-98378568 CTACATGGTGAAAAGGAGCCAGG + Intergenic
1122641396 14:103161743-103161765 CTGCATGCTGACATGAAGACTGG - Intergenic
1125182086 15:36888748-36888770 CAGCAATTTGATAAGGAGCCTGG - Intergenic
1127650171 15:60999294-60999316 CCCCATGTTCAAATGGAGCCTGG - Intronic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1129779215 15:78258984-78259006 CTGGAGGTTGAGAAGGAGCCAGG - Intergenic
1130225183 15:82051850-82051872 TTGCCCGTTGATATGGAGCCGGG + Intergenic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1136032598 16:27514450-27514472 CTGCTTGTAGAAAGGGAGCCTGG - Intronic
1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG + Intergenic
1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG + Intronic
1146552914 17:33797569-33797591 ATGCATGTTGATGTGAAGCTTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1151459396 17:74245719-74245741 CTGCATTTTAATAGGAAGCCGGG + Intronic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG + Intergenic
1155076138 18:22357213-22357235 CCTCATGTTGATGGGGAGCCCGG - Intergenic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1161971326 19:7582524-7582546 CTGCATGCTGAGATGGGGACAGG - Intergenic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1165449470 19:35873836-35873858 CTGCATGTAGGCATGGGGCCAGG - Intronic
925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG + Intergenic
925315567 2:2920250-2920272 CTGCATGTTCATCTGGCACCGGG + Intergenic
925839431 2:7977876-7977898 CTGAATGTTATTATGGAGCATGG + Intergenic
935628074 2:105187513-105187535 CTGCAGGCTGAAATGAAGCCGGG + Intergenic
939094300 2:137816382-137816404 CTGCCTGTTGATCCTGAGCCTGG + Intergenic
940287437 2:152046693-152046715 CTGCCTGTTGAGCTGTAGCCAGG + Intronic
942075212 2:172351272-172351294 CTGCCTGTGGATAATGAGCCAGG + Intergenic
942148644 2:173052179-173052201 CAACATCTTGATTTGGAGCCTGG + Exonic
946089613 2:217209116-217209138 GTGCCTGTTGATAGGGAGCAGGG - Intergenic
946587329 2:221204634-221204656 CTGCCTGTTGATTTCTAGCCAGG - Intergenic
1170415511 20:16134636-16134658 CTGCATGTTGAACAGGAGCTAGG - Intergenic
1174726321 20:52866108-52866130 CTACATGTTGATACGGAGAGGGG + Intergenic
1178778437 21:35575428-35575450 CTGCATGTTGGAATAGAGGCCGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG + Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
955444128 3:58990938-58990960 TTGCATTCTGGTATGGAGCCAGG - Intronic
956432707 3:69203750-69203772 CTGAATTTTGATACTGAGCCAGG - Intronic
958728188 3:97931617-97931639 CTTAATGTTGAGATAGAGCCAGG - Intronic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
960827444 3:121805503-121805525 CTGCATGTGGTTATTGAACCTGG - Intronic
962852407 3:139317970-139317992 CTGCAGGATGATACAGAGCCAGG + Intronic
967499702 3:190183682-190183704 CTTCATGTTGAAATGAAGGCAGG - Intergenic
970287589 4:14535428-14535450 CTGAACTTTGATATGGAGGCAGG + Intergenic
970290835 4:14570490-14570512 ATGCATGTTTATATGGCACCAGG + Intergenic
972379920 4:38510127-38510149 CTGCAGGTTGACCTGGAGCCTGG + Intergenic
976624271 4:87162346-87162368 CTACATATTGATTTGAAGCCAGG - Exonic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
982010229 4:151099071-151099093 CTGCTTGTTGATGTGGATGCTGG - Intergenic
982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG + Intronic
982978057 4:162092220-162092242 CTGCATGTTTATATGTTTCCAGG + Intronic
987862508 5:23506317-23506339 CTGCAAGGAGATACGGAGCCTGG - Intergenic
987940433 5:24528666-24528688 ATGCATGTTGATACAGAGACAGG - Intronic
989812285 5:45693871-45693893 TTGCATGTTAATATTGAACCTGG + Intronic
989859740 5:46355069-46355091 CTGCAAGTGGATATGTAGACCGG - Intergenic
992003127 5:72454310-72454332 CTGCAAGGTGCTATGGAACCTGG - Intronic
995629451 5:114117572-114117594 CTGCATGCAGATATGGACCCAGG + Intergenic
1001726689 5:173908562-173908584 CTGCATGATGAGATGGGGTCAGG + Intronic
1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG + Intronic
1003732390 6:8839788-8839810 CTGAATGTTGATATTGACCATGG - Intergenic
1003957157 6:11174547-11174569 GTGCATGATGATGAGGAGCCCGG - Intergenic
1007400463 6:41599786-41599808 CTGGATGTGGGTGTGGAGCCGGG - Exonic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1017893792 6:158661305-158661327 CTGCCTGTTCATCTGGAACCTGG + Exonic
1021198487 7:17698908-17698930 ATGCAAGTTTATTTGGAGCCAGG - Intergenic
1021507892 7:21405369-21405391 CAGCATGTGGAAATGGACCCAGG - Intergenic
1021996914 7:26187875-26187897 CAGCATGTTAAGATGGAGGCAGG - Intergenic
1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG + Intergenic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1028011852 7:85655495-85655517 CTGCATTTTGTCATGGAGCTCGG - Intergenic
1029192859 7:98784148-98784170 GTGAATGTTGAAATGGAGACAGG - Intergenic
1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG + Intronic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1033834885 7:145298186-145298208 CTGGATGTTGTTTTGGAGCTTGG + Intergenic
1035544429 8:468613-468635 CTGCTTGTTGATGTGGACCCTGG - Intronic
1036789082 8:11705635-11705657 CTGGTTGTTGAAATTGAGCCTGG - Intronic
1037156804 8:15710622-15710644 CTGCATTTTAATAAGTAGCCTGG - Intronic
1039245922 8:35608096-35608118 ATTCATGTTGATTTGGAACCTGG - Intronic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1040016028 8:42700872-42700894 GTGGATGTTGATATGGAGGTGGG + Intronic
1042175006 8:66029919-66029941 CTTCCAGTTGATATGGGGCCTGG + Intronic
1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG + Intergenic
1047328991 8:123867870-123867892 CTGCATCTTGATCTGGATGCTGG - Intronic
1048304679 8:133275607-133275629 GTGAAGGGTGATATGGAGCCAGG - Intronic
1048820743 8:138378411-138378433 CTGCAAGTTGCTTTGGAGTCTGG + Intronic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1057826984 9:98378803-98378825 CTGCTTCTTGATATGGATCCTGG + Intronic
1058450445 9:105091430-105091452 CTGAACCTTGATCTGGAGCCCGG - Intergenic
1059632095 9:116135705-116135727 CTGCCTCTTGATATGATGCCAGG - Intergenic
1060060365 9:120454256-120454278 CTGGATGTAGAAATGGGGCCAGG - Intronic
1061531807 9:131219913-131219935 CTGCAGGATGATATGGGGCCTGG + Intronic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1189278805 X:39806460-39806482 CTGCATGCTGAGATGGAGAGGGG + Intergenic
1189327149 X:40119720-40119742 CTGCAGGTTGATCTGGAAGCTGG + Intronic
1190003681 X:46713641-46713663 CTGCATGTTGACATGAACCTAGG - Intronic
1196651548 X:118173276-118173298 CTGGATGTTGTTATGGAGGAGGG - Intergenic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1197717998 X:129723848-129723870 AGGCATGTTGATAGGGAACCTGG + Intergenic