ID: 977172974

View in Genome Browser
Species Human (GRCh38)
Location 4:93785645-93785667
Sequence AATGGCTTCTTAGTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977172974_977172975 -7 Left 977172974 4:93785645-93785667 CCAGGCATCACTAAGAAGCCATT No data
Right 977172975 4:93785661-93785683 AGCCATTGAAGACTTTAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977172974 Original CRISPR AATGGCTTCTTAGTGATGCC TGG (reversed) Intergenic