ID: 977176766

View in Genome Browser
Species Human (GRCh38)
Location 4:93828626-93828648
Sequence CGCCTGCCCGCGCCCTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977176766 Original CRISPR CGCCTGCCCGCGCCCTCCAT TGG Intergenic
900418871 1:2547037-2547059 AGACTGGCCGCTCCCTCCATGGG - Intergenic
900830260 1:4960482-4960504 CTCCAGCCCACGCCCTCCAAAGG + Intergenic
901413835 1:9103777-9103799 CTCCTGGCCTCTCCCTCCATGGG - Exonic
902520217 1:17011642-17011664 CGCCTCCCCTCTCCCTCCAAGGG + Intronic
902541881 1:17161675-17161697 GGCCTGCCCGCACCCACCCTAGG + Intergenic
903845926 1:26280000-26280022 CGCCTGCCCGCGCCGCCCATTGG + Exonic
905802034 1:40850545-40850567 CCCCTGACCACGCCCTCCTTTGG + Intergenic
915365823 1:155315156-155315178 CGCCTGCCAGAGCCCAGCATGGG - Intronic
916079628 1:161224304-161224326 TTCCTGCCAGAGCCCTCCATTGG - Intergenic
920302296 1:204996555-204996577 TGCCTGCCCTCGCCCTCCTCCGG - Intronic
924083442 1:240423246-240423268 CTCCTTCCCCCACCCTCCATAGG - Intronic
1062857264 10:785481-785503 CGCCTGCCAACGCCCTGCCTTGG - Intergenic
1066649409 10:37640440-37640462 TGCCTGGCCGCCCCCTCCCTGGG - Intergenic
1067135914 10:43606896-43606918 CGCCCGCCCGTTCCCTCCACAGG - Intronic
1069818389 10:71212845-71212867 CGCCAGCCCGTGCCTTCCGTGGG - Exonic
1069956805 10:72057031-72057053 CCCCTGCCCACCCCCTCCCTGGG - Intergenic
1072591383 10:96831949-96831971 CGGCTGCCCCCGCCCTCCCCGGG - Intergenic
1072966916 10:99981766-99981788 CTCCTGCCAGTGCCATCCATTGG - Intronic
1073062217 10:100739690-100739712 CGCCTGCCCCCACCCTCCGCAGG + Intronic
1076977909 11:189488-189510 CGCCTCCCCCCGCCCCCCAGGGG - Intronic
1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG + Exonic
1077253812 11:1571957-1571979 CGCTCGGCCGCGCCGTCCATGGG + Intergenic
1079708652 11:23653275-23653297 AGCCTCCCCGCCCCCGCCATGGG - Intergenic
1080791432 11:35525635-35525657 CGCCTGCCCCCGGCCTCCCTGGG - Intronic
1081678119 11:44982849-44982871 CTCCTGCCGGGGCCTTCCATTGG - Intergenic
1082912294 11:58390658-58390680 AGCCTGCCCCGCCCCTCCATGGG - Intergenic
1084417700 11:69042980-69043002 CTCCTGCCTGCCCCATCCATGGG - Intergenic
1097194967 12:57238153-57238175 CTCCCGCCCGCGCCCTCCACAGG - Intronic
1104669021 12:130667719-130667741 CTCCAGCCCCCGCCCTCCCTGGG - Intronic
1104691530 12:130829824-130829846 CTCCTCCCCACCCCCTCCATGGG - Intronic
1105944171 13:25175646-25175668 GGCCTGTCCTTGCCCTCCATGGG + Intergenic
1106600527 13:31183140-31183162 AGCCTCCCCGCCCGCTCCATGGG - Intergenic
1114516156 14:23301584-23301606 CGCCTGCCCGCGCCGCCGATTGG - Exonic
1116657981 14:47675015-47675037 CCCCTGCCCGCGCCCGCCGCCGG - Intergenic
1119616188 14:76100628-76100650 AGCCTGCCCGCACCCTCCCTGGG + Intergenic
1122051965 14:99066710-99066732 CACCTGCCAGTGCCCTCCCTAGG + Intergenic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1126105680 15:45145453-45145475 CAGCTGCCAGAGCCCTCCATGGG + Intronic
1128413549 15:67423073-67423095 TGCCTTCCTGGGCCCTCCATTGG + Intronic
1128727524 15:69999030-69999052 CTCCTGCCAGCGCTCTCCATAGG + Intergenic
1130554158 15:84911125-84911147 CGCCTTCCCCCGCCCACCACTGG + Intronic
1132290979 15:100703854-100703876 CTTCTGCCCACGCCCTCCAGTGG + Intergenic
1132865527 16:2091174-2091196 CTCCTGACCGCGCCCCCCACAGG - Exonic
1137454725 16:48609732-48609754 CGCGCGCCCGCGGCCTCGATCGG - Intronic
1137660911 16:50205422-50205444 CTCCTGCCTGTGCCCTCCACTGG + Intronic
1139472072 16:67183752-67183774 CTCCTGGCCCCACCCTCCATTGG - Exonic
1140247868 16:73267650-73267672 TGCCTGCCAAAGCCCTCCATGGG + Intergenic
1141926482 16:87173603-87173625 TGTCGGCCCACGCCCTCCATGGG + Intronic
1142465331 17:133953-133975 CGCCTCCCCCCGCCCCCCAGGGG - Intergenic
1145252426 17:21303922-21303944 CACATCCCCGTGCCCTCCATGGG - Intronic
1146255290 17:31388792-31388814 CGCCTTCCCGCCCTATCCATGGG + Intergenic
1147684013 17:42276307-42276329 CGCCCGCTCGCTCCCTCCCTCGG + Exonic
1152085653 17:78216572-78216594 CACCTCCCCACGCCCTCCACAGG - Intronic
1152364044 17:79844891-79844913 CCCCTGCCCGGGCCCTGCCTGGG - Intergenic
1152687935 17:81703705-81703727 CTCCTCCCCGCGCCCCCGATGGG - Intronic
1152743410 17:82028503-82028525 GGCCTGCCCGTGCCCACCCTCGG - Exonic
1152933752 17:83124261-83124283 CGGCTGCCCGAGCCCTCCAGGGG - Intergenic
1155392345 18:25350374-25350396 CGCCCGCCCGCGTCCTGCTTGGG - Intronic
1158559270 18:58499793-58499815 AGGCTGCCAGGGCCCTCCATGGG - Intronic
1160189789 18:76706545-76706567 ACCCTGCCCCCGCCCTCCAGTGG + Intergenic
1160357226 18:78238789-78238811 CGGCTGCCCACGCCCTTCAGAGG - Intergenic
1161153657 19:2721597-2721619 CACCTGCGCGCGCCCTCCCTCGG + Intronic
1161895204 19:7074838-7074860 CTCCTGCCCGTGCCCTGCCTCGG - Intronic
1161895217 19:7074870-7074892 CTCCTGCCCGTGCCCTGCCTCGG - Intronic
1161895227 19:7074902-7074924 CTCCTGCCCGTGCCCTGCCTCGG - Intronic
1162442475 19:10701532-10701554 CGCCTGCCCGGGCCCTGGAGCGG - Exonic
1163480990 19:17556133-17556155 CCCCTGCCCGCTGCCCCCATCGG + Intronic
1163836200 19:19575839-19575861 CACCTGGCCGCGACCTCCATGGG - Intronic
1165702305 19:37947957-37947979 CGCCTGCCAGCAGCCTCCACTGG - Intronic
1165871281 19:38975417-38975439 CGCTTTCCCGGGCCCTCCCTCGG - Intronic
1165928791 19:39342961-39342983 CGCCTCCTCGAGCCCTTCATGGG + Intronic
1166861707 19:45815288-45815310 CCGCTCCCCGCGCCCTCCACGGG - Exonic
1167849410 19:52190359-52190381 CGCTGGCCCCCGCCCTCCACTGG - Intronic
929779779 2:44949965-44949987 CGCCTGCCCCCGCCCTCCCTCGG - Intergenic
931769766 2:65487425-65487447 CTCCTGCCCACGCCCTCACTGGG + Intergenic
934656223 2:96117922-96117944 CTCCTCCCTGCTCCCTCCATGGG + Intergenic
940674187 2:156708794-156708816 TGGCTGCCAGGGCCCTCCATGGG + Intergenic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
944444734 2:199777834-199777856 AGCCTGCACGCTCCCTCCTTTGG - Intronic
947741748 2:232487874-232487896 CGCCGGCGCGCCCCCTCCCTCGG - Intergenic
947984811 2:234438868-234438890 CGCCTGCCCCCGCCCCCCGCAGG - Intergenic
948688805 2:239689104-239689126 CTCATACCCGTGCCCTCCATGGG - Intergenic
948883883 2:240873568-240873590 TGCCTGCCCACCCACTCCATGGG + Intronic
948910070 2:240998499-240998521 CGCGCGCCCGCGCCCTCCCACGG + Intergenic
1169207630 20:3749139-3749161 CTCCTGCCCAGGACCTCCATGGG - Intronic
1170598836 20:17825393-17825415 CTCCTGCCCGGGCCCCCCATTGG + Intergenic
1174364618 20:50048956-50048978 CCCCTCCCCGCCCCCTCCAGAGG + Intergenic
1175248894 20:57597205-57597227 CCCCCGCCCGCGCCCTCCGCAGG - Intergenic
1175911761 20:62408405-62408427 CGCCTGCCTGCTCCCTCCTGTGG + Intergenic
1176550731 21:8219711-8219733 CGCGCGCCCGCGACCTCCACCGG + Intergenic
1176577573 21:8446981-8447003 CGCGCGCCCGCGACCTCCACCGG + Intergenic
1179822044 21:43942710-43942732 CGCCTGCCCGCGGTCACCCTAGG + Intronic
1180832698 22:18913974-18913996 CCCCTGCCCTCGCCCTCTGTGGG + Intronic
1181060766 22:20281088-20281110 CGCCGGCCCACGGCCTCCAGCGG + Intronic
1181067164 22:20312420-20312442 CCCCTGCCCTCGCCCTCTGTGGG - Intergenic
1182428699 22:30288146-30288168 CGCCAGCCTGGGCCCTCCCTGGG - Intronic
1182736661 22:32535883-32535905 GGCCTGACCCCGCCCTCCACTGG - Intronic
1183294106 22:37019691-37019713 CTGCTGCCCGCGCCTTCCACTGG - Intronic
1183956008 22:41381357-41381379 GCCCCGCCCCCGCCCTCCATTGG + Intronic
1203255632 22_KI270733v1_random:136054-136076 CGCGCGCCCGCGACCTCCACCGG + Intergenic
1203282783 22_KI270734v1_random:139279-139301 CCCCTGCCCTCGCCCTCTGTGGG + Intergenic
950223833 3:11217283-11217305 CGCCTGCCTCAGCCCTCCAAAGG - Intronic
950412429 3:12847828-12847850 CGCCTACCCACCCCCACCATAGG - Intronic
955106664 3:55905463-55905485 CTCCCGCCCCCTCCCTCCATAGG + Intronic
959343557 3:105162659-105162681 AGCCTGCCCCTTCCCTCCATGGG + Intergenic
959704419 3:109326405-109326427 CTCCTGCCCGCCCCCGCCGTTGG - Exonic
961684513 3:128620388-128620410 CCCCTGCCCGCATCCTCCAGGGG - Exonic
963605470 3:147409228-147409250 CGCCTCGGCGCGCCCTCCGTTGG + Intronic
965558296 3:170038732-170038754 CCCCCGCCCGCGCCCGCCACTGG + Intronic
968574598 4:1359748-1359770 CGCCTGCCTGCCTCCTCCACCGG + Intronic
969676564 4:8617657-8617679 CCCCTGCCCGGGCCCTGCACGGG - Intronic
976199058 4:82561691-82561713 CGCCCGCCCGAGCCCTCCGCGGG - Intronic
977176766 4:93828626-93828648 CGCCTGCCCGCGCCCTCCATTGG + Intergenic
990880257 5:60530572-60530594 CGCCCGCCCGCCCCTGCCATGGG + Intergenic
996530429 5:124521898-124521920 AGCCTCCCCCCCCCCTCCATGGG + Intergenic
999169494 5:149581478-149581500 CGCCCGCCAGCGCCCTCGGTGGG + Exonic
1003482463 6:6546250-6546272 CGCCTGTCCGCGGCCTAGATGGG + Intergenic
1018736185 6:166688631-166688653 CGCCTTCCCGCCCCCTACCTGGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019610814 7:1935840-1935862 CGGCTGCCAGCCCCCTCCCTTGG - Intronic
1020224839 7:6272270-6272292 CCCCGGCCCGCCCCCTCCCTCGG + Intronic
1020224951 7:6272573-6272595 CGCCTGCGCGCTCCCTCCGGCGG - Exonic
1025258413 7:57400373-57400395 CCCCTACCCACACCCTCCATTGG - Intergenic
1032199269 7:129807998-129808020 AGCAAGCCCGCCCCCTCCATTGG + Intergenic
1034197872 7:149262068-149262090 CGCCGCCCCGCGCCCTCCCGAGG - Intergenic
1038643859 8:29348172-29348194 GGCGCGCCCGCGCTCTCCATCGG + Intronic
1040474599 8:47764853-47764875 CACCTACCCGCACCCTCCCTCGG + Intergenic
1041244843 8:55880123-55880145 CGCGTGCCCGCGCCCACCCCTGG - Intronic
1049234645 8:141506502-141506524 GCCCTGCCCGCCCCCTCTATGGG - Intergenic
1049716275 8:144094676-144094698 CCCCTGCCCGCGCCCTCTGCCGG + Intergenic
1049765817 8:144354724-144354746 AGCCTGCCCACGACCTCCATCGG - Exonic
1050091254 9:2017458-2017480 CTCCTGCCCGCACCCTCCCCTGG + Intronic
1057704334 9:97386845-97386867 CGCCTACCCCCACCCTCCAGTGG + Intergenic
1060152829 9:121299741-121299763 CCCCGCCCCGCGCCCTCCCTGGG + Intronic
1060979866 9:127785840-127785862 CGGCTCCCCGCGCCCCCGATCGG + Intronic
1061372150 9:130203485-130203507 CCCCTGCCCTGGCCCTCCTTGGG - Intronic
1062628461 9:137453394-137453416 TGCCTGCACGCGCCTTCCACCGG - Intronic