ID: 977180066

View in Genome Browser
Species Human (GRCh38)
Location 4:93863199-93863221
Sequence CTGGTAAGAATGTGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977180061_977180066 21 Left 977180061 4:93863155-93863177 CCCAATTAGATGGCTATTATCAA No data
Right 977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG No data
977180062_977180066 20 Left 977180062 4:93863156-93863178 CCAATTAGATGGCTATTATCAAA No data
Right 977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG No data
977180060_977180066 30 Left 977180060 4:93863146-93863168 CCATTTCATCCCAATTAGATGGC No data
Right 977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977180066 Original CRISPR CTGGTAAGAATGTGGAAAAA AGG Intergenic
No off target data available for this crispr