ID: 977183004

View in Genome Browser
Species Human (GRCh38)
Location 4:93900891-93900913
Sequence CATGACTTATGAGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977183004_977183005 -10 Left 977183004 4:93900891-93900913 CCAGTTTTTGCTCATAAGTCATG No data
Right 977183005 4:93900904-93900926 ATAAGTCATGTAAGCTGCTGTGG No data
977183004_977183006 -9 Left 977183004 4:93900891-93900913 CCAGTTTTTGCTCATAAGTCATG No data
Right 977183006 4:93900905-93900927 TAAGTCATGTAAGCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977183004 Original CRISPR CATGACTTATGAGCAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr