ID: 977183228

View in Genome Browser
Species Human (GRCh38)
Location 4:93903914-93903936
Sequence TCTCCTGGATGTAGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977183228_977183231 11 Left 977183228 4:93903914-93903936 CCAGCAGCACTACATCCAGGAGA No data
Right 977183231 4:93903948-93903970 AATCCAAGTCAGAGAGCCAGAGG No data
977183228_977183233 18 Left 977183228 4:93903914-93903936 CCAGCAGCACTACATCCAGGAGA No data
Right 977183233 4:93903955-93903977 GTCAGAGAGCCAGAGGTGATTGG No data
977183228_977183234 23 Left 977183228 4:93903914-93903936 CCAGCAGCACTACATCCAGGAGA No data
Right 977183234 4:93903960-93903982 AGAGCCAGAGGTGATTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977183228 Original CRISPR TCTCCTGGATGTAGTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr