ID: 977187638

View in Genome Browser
Species Human (GRCh38)
Location 4:93960120-93960142
Sequence TTGGCGAATCTGCAGTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977187638_977187642 -4 Left 977187638 4:93960120-93960142 CCAAATCACTGCAGATTCGCCAA No data
Right 977187642 4:93960139-93960161 CCAAGGGCTGAAGCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977187638 Original CRISPR TTGGCGAATCTGCAGTGATT TGG (reversed) Intergenic
No off target data available for this crispr