ID: 977187642

View in Genome Browser
Species Human (GRCh38)
Location 4:93960139-93960161
Sequence CCAAGGGCTGAAGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977187636_977187642 11 Left 977187636 4:93960105-93960127 CCGTCCACAGAGGGACCAAATCA No data
Right 977187642 4:93960139-93960161 CCAAGGGCTGAAGCATCCTTTGG No data
977187635_977187642 12 Left 977187635 4:93960104-93960126 CCCGTCCACAGAGGGACCAAATC No data
Right 977187642 4:93960139-93960161 CCAAGGGCTGAAGCATCCTTTGG No data
977187637_977187642 7 Left 977187637 4:93960109-93960131 CCACAGAGGGACCAAATCACTGC No data
Right 977187642 4:93960139-93960161 CCAAGGGCTGAAGCATCCTTTGG No data
977187638_977187642 -4 Left 977187638 4:93960120-93960142 CCAAATCACTGCAGATTCGCCAA No data
Right 977187642 4:93960139-93960161 CCAAGGGCTGAAGCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977187642 Original CRISPR CCAAGGGCTGAAGCATCCTT TGG Intergenic
No off target data available for this crispr