ID: 977187826

View in Genome Browser
Species Human (GRCh38)
Location 4:93962416-93962438
Sequence TCACTTTTTTTTACAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977187820_977187826 -5 Left 977187820 4:93962398-93962420 CCCAGTATGTTTTTGTTTTCACT No data
Right 977187826 4:93962416-93962438 TCACTTTTTTTTACAGGTGGGGG No data
977187821_977187826 -6 Left 977187821 4:93962399-93962421 CCAGTATGTTTTTGTTTTCACTT No data
Right 977187826 4:93962416-93962438 TCACTTTTTTTTACAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977187826 Original CRISPR TCACTTTTTTTTACAGGTGG GGG Intergenic
No off target data available for this crispr