ID: 977189581

View in Genome Browser
Species Human (GRCh38)
Location 4:93982920-93982942
Sequence CTGAATGCACAGTTGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977189581_977189584 -5 Left 977189581 4:93982920-93982942 CCATTGGCCAACTGTGCATTCAG No data
Right 977189584 4:93982938-93982960 TTCAGACCTTCAGGCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977189581 Original CRISPR CTGAATGCACAGTTGGCCAA TGG (reversed) Intergenic
No off target data available for this crispr