ID: 977191067

View in Genome Browser
Species Human (GRCh38)
Location 4:94001315-94001337
Sequence GACACAGTGCTTGTTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977191067_977191072 2 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191072 4:94001340-94001362 CACATGGTAGAAGGCATGGAAGG No data
977191067_977191073 3 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191073 4:94001341-94001363 ACATGGTAGAAGGCATGGAAGGG No data
977191067_977191069 -7 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG 0: 88
1: 649
2: 1429
3: 2225
4: 2772
977191067_977191070 -2 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191070 4:94001336-94001358 TCCTCACATGGTAGAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977191067 Original CRISPR GACACAGTGCTTGTTTCCTC TGG (reversed) Intergenic
No off target data available for this crispr