ID: 977191069

View in Genome Browser
Species Human (GRCh38)
Location 4:94001331-94001353
Sequence CTGTGTCCTCACATGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7163
Summary {0: 88, 1: 649, 2: 1429, 3: 2225, 4: 2772}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977191062_977191069 25 Left 977191062 4:94001283-94001305 CCAAGATGGTGCCTTATTGCTGG No data
Right 977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG 0: 88
1: 649
2: 1429
3: 2225
4: 2772
977191067_977191069 -7 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG 0: 88
1: 649
2: 1429
3: 2225
4: 2772
977191066_977191069 -4 Left 977191066 4:94001312-94001334 CCTCCAGAGGAAACAAGCACTGT No data
Right 977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG 0: 88
1: 649
2: 1429
3: 2225
4: 2772
977191064_977191069 14 Left 977191064 4:94001294-94001316 CCTTATTGCTGGCTGCGTCCTCC No data
Right 977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG 0: 88
1: 649
2: 1429
3: 2225
4: 2772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977191069 Original CRISPR CTGTGTCCTCACATGGTAGA AGG Intergenic
Too many off-targets to display for this crispr