ID: 977191070

View in Genome Browser
Species Human (GRCh38)
Location 4:94001336-94001358
Sequence TCCTCACATGGTAGAAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977191064_977191070 19 Left 977191064 4:94001294-94001316 CCTTATTGCTGGCTGCGTCCTCC No data
Right 977191070 4:94001336-94001358 TCCTCACATGGTAGAAGGCATGG No data
977191066_977191070 1 Left 977191066 4:94001312-94001334 CCTCCAGAGGAAACAAGCACTGT No data
Right 977191070 4:94001336-94001358 TCCTCACATGGTAGAAGGCATGG No data
977191062_977191070 30 Left 977191062 4:94001283-94001305 CCAAGATGGTGCCTTATTGCTGG No data
Right 977191070 4:94001336-94001358 TCCTCACATGGTAGAAGGCATGG No data
977191067_977191070 -2 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191070 4:94001336-94001358 TCCTCACATGGTAGAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977191070 Original CRISPR TCCTCACATGGTAGAAGGCA TGG Intergenic
No off target data available for this crispr