ID: 977191073

View in Genome Browser
Species Human (GRCh38)
Location 4:94001341-94001363
Sequence ACATGGTAGAAGGCATGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977191066_977191073 6 Left 977191066 4:94001312-94001334 CCTCCAGAGGAAACAAGCACTGT No data
Right 977191073 4:94001341-94001363 ACATGGTAGAAGGCATGGAAGGG No data
977191064_977191073 24 Left 977191064 4:94001294-94001316 CCTTATTGCTGGCTGCGTCCTCC No data
Right 977191073 4:94001341-94001363 ACATGGTAGAAGGCATGGAAGGG No data
977191067_977191073 3 Left 977191067 4:94001315-94001337 CCAGAGGAAACAAGCACTGTGTC No data
Right 977191073 4:94001341-94001363 ACATGGTAGAAGGCATGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977191073 Original CRISPR ACATGGTAGAAGGCATGGAA GGG Intergenic
No off target data available for this crispr