ID: 977209180

View in Genome Browser
Species Human (GRCh38)
Location 4:94198574-94198596
Sequence ATGCATAAGCAGAAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977209177_977209180 7 Left 977209177 4:94198544-94198566 CCAGTTGAGGGTATCCTGAAAAT No data
Right 977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG No data
977209178_977209180 -7 Left 977209178 4:94198558-94198580 CCTGAAAATTTAAGATATGCATA No data
Right 977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977209180 Original CRISPR ATGCATAAGCAGAAAAAGGA AGG Intergenic
No off target data available for this crispr