ID: 977211835

View in Genome Browser
Species Human (GRCh38)
Location 4:94227187-94227209
Sequence CTGGTGTTTTTGAGGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977211830_977211835 17 Left 977211830 4:94227147-94227169 CCAGGCATTGGGAATATCATGTT 0: 1
1: 0
2: 1
3: 16
4: 265
Right 977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG 0: 1
1: 0
2: 2
3: 37
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977211835 Original CRISPR CTGGTGTTTTTGAGGAAAGT GGG Intronic
901630128 1:10643860-10643882 GTGGTGTTTTTGGCGATAGTTGG - Intronic
902741216 1:18439630-18439652 CTCGTTTTTTAGAGGGAAGTGGG + Intergenic
905664830 1:39756832-39756854 ATGCAGTTTTGGAGGAAAGTGGG - Intronic
908816823 1:68043497-68043519 CTGATGTTATTGCGGTAAGTGGG + Intergenic
912706312 1:111917539-111917561 CTGGTGCTTCGGAGGCAAGTAGG - Intronic
914980826 1:152412997-152413019 CTTGTTTTTTTTGGGAAAGTGGG + Intronic
915439298 1:155934532-155934554 CTGGCGTTTCTGAGGCAGGTAGG + Intergenic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915604607 1:156942616-156942638 GTGGTGTTTATGAGGACAGTGGG - Intronic
916975815 1:170076435-170076457 CTGGTGAATTTGAGGCAATTTGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918168778 1:181975380-181975402 CTGGTGTGTTTGAGGAATCCAGG + Intergenic
919593365 1:199531572-199531594 CTGGTGTATTAGTGGAAAGGAGG + Intergenic
921527716 1:216238736-216238758 ATAATGTTTTTTAGGAAAGTGGG + Intronic
921621750 1:217333123-217333145 CTGGTGTCTTTGTGGAAACTGGG + Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923356837 1:233164944-233164966 CTGGTGTTCTACAGGATAGTAGG + Intronic
924156049 1:241177665-241177687 CTGGTGGTTTTGACTAAAGGTGG + Intronic
1063125409 10:3132690-3132712 CTGATGTTTATGAAGAAAGAAGG + Intronic
1063392365 10:5658935-5658957 CTGATGTTTATGAAGAGAGTGGG - Intronic
1064500823 10:15971268-15971290 ATGGTGTTTTAGAGCAAAGTGGG - Intergenic
1065343936 10:24730541-24730563 CTCATATTTTTAAGGAAAGTTGG - Intergenic
1065481471 10:26198405-26198427 CTCGTTTTTTTGAGGAAACTTGG - Intronic
1065941073 10:30564309-30564331 CTGGTGGTATTGTGGAAAGAGGG + Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066552949 10:36579565-36579587 CTGGTGTTTTTTAGCACTGTAGG + Intergenic
1066797539 10:39139478-39139500 CTAGTTTTTATGAGGAAACTCGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1070421772 10:76244469-76244491 CTGGTGTTTTTGCGGCAGTTGGG + Intronic
1070458487 10:76641808-76641830 GAGGTGTTTTTGAGGAAGGGTGG - Intergenic
1071075526 10:81746853-81746875 GTGGAGTGTTTGAGGAGAGTGGG - Intergenic
1078701955 11:13694137-13694159 CTGCTGTTTTAGAGGAATTTGGG + Intronic
1080637195 11:34134435-34134457 CTGGTGTGTCTGAGGGAAGCTGG + Intronic
1083281598 11:61630075-61630097 CTGGTGTTTGTCAGGAGAGTGGG - Intergenic
1083764330 11:64834877-64834899 CTGGAGTCCTTGAGGAACGTAGG - Exonic
1085887166 11:80534681-80534703 CAGGTTATTTTGAGGAAACTTGG - Intergenic
1086040384 11:82469629-82469651 CTGGTATTTTTGAAGAGAATTGG - Intergenic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1089001910 11:115059196-115059218 CTGGTGTCTTAGAGGAGAGGAGG + Intergenic
1089112948 11:116071538-116071560 CTGGTGTGTTTGGGGAATGTAGG - Intergenic
1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG + Intronic
1090959881 11:131546784-131546806 TTGGGGTTTGTGAGGAAAGCAGG + Intronic
1091893782 12:4083985-4084007 CTGGAGTTATTAAGGAAAGGGGG - Intergenic
1092841259 12:12543292-12543314 CTGATGTGCTTGAGGATAGTGGG + Intronic
1092980289 12:13787940-13787962 CTGGTGTATTTGAGATAAGTTGG - Intronic
1093611984 12:21171931-21171953 AGGGTCTTTTTGAGGAAATTAGG - Intronic
1093824584 12:23668087-23668109 CTAGTGTTTATGAGGCAAGAGGG + Intronic
1095748680 12:45687655-45687677 CTGGTGTTTATAAGTGAAGTTGG - Intergenic
1095996242 12:48087841-48087863 CTGGTATATTTTAGGAATGTGGG - Intronic
1098978485 12:76929813-76929835 CTGGGATTTTTGAGAAAAGGTGG + Intergenic
1099252830 12:80279149-80279171 CAGGTGTTTTTGATAAAGGTAGG + Exonic
1100770008 12:97911280-97911302 CTGGTGATTTGGGGGAAAGGAGG + Intergenic
1101293530 12:103396669-103396691 CTACTGGTTTTGAGGCAAGTGGG + Intronic
1101709251 12:107249500-107249522 CTGGTGGTTTTGGTGAAGGTGGG - Intergenic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1102596785 12:113999041-113999063 CTGGTCATTTTGAAGAAAATGGG + Intergenic
1103256526 12:119546246-119546268 CTGGTGTTGTGGAGGAAAGTTGG + Intergenic
1103922802 12:124407877-124407899 CTGGGGTTGGTGTGGAAAGTGGG + Intronic
1105510340 13:21046738-21046760 GTGGTGTCTTTTAGGAAAATTGG - Intronic
1107334173 13:39335496-39335518 CTGCTGTTTGTCAGTAAAGTGGG + Intergenic
1107456767 13:40562733-40562755 CTGGTGTTTCTGCTGAAACTTGG - Intronic
1107888931 13:44897080-44897102 CTGGTGTTTTTGAAAGAGGTGGG - Intergenic
1109468437 13:62770707-62770729 GTGGTGGTGGTGAGGAAAGTTGG + Intergenic
1110064210 13:71082532-71082554 TTGGTGTCTTGGAGGAAAGCAGG - Intergenic
1110860943 13:80343555-80343577 CTGGAGATTGTGAGGAAAGGGGG - Intergenic
1110911173 13:80966148-80966170 CTGGTATTATTGATGAAAGTGGG + Intergenic
1112471434 13:99693349-99693371 CTGGTGATTTTAAGGGAAGGAGG - Intronic
1113325018 13:109272433-109272455 CTCGGAATTTTGAGGAAAGTGGG + Intergenic
1113876068 13:113595492-113595514 CTGGTGCTTTACAGGAAAGGCGG + Intronic
1115341298 14:32295414-32295436 CAGGCTTTTGTGAGGAAAGTGGG + Intergenic
1116623610 14:47238042-47238064 TTGGTGTCTTTCAGGAAGGTAGG - Intronic
1119363342 14:74070167-74070189 CTGTTATTTTGGAGGAAAATAGG - Intronic
1120699071 14:87678108-87678130 CTGGAGTCTTTGAGCAAAGGAGG + Intergenic
1120734787 14:88040841-88040863 CTGGTGATCTTGATGTAAGTTGG - Intergenic
1121103846 14:91267929-91267951 CTGGGGTTTTGGAGGAGAGGTGG + Intergenic
1122711442 14:103661373-103661395 TTGGTGTTTTTGAAGAATGCAGG + Intronic
1123902240 15:24888758-24888780 CTTGTGTTTACGAGGAAACTAGG - Intronic
1126405613 15:48319695-48319717 CTAGTGTTCTTGGGGAAAGTGGG + Intergenic
1127495856 15:59511548-59511570 CTGGTGTTTTCTGGAAAAGTTGG + Intronic
1127759315 15:62122172-62122194 CTGTTTATTTTGAGGAAATTTGG - Intergenic
1128925106 15:71648192-71648214 CTGGTGTTGTTGAGAGAATTAGG + Intronic
1131283512 15:91039627-91039649 CTGGTCCATTTGAGGAAAGATGG - Intergenic
1131498808 15:92939931-92939953 GTGGTGTTTTTTAGGAATGAAGG - Intronic
1131590044 15:93739416-93739438 GTGGTCATTTTGAGGAAAGAAGG + Intergenic
1133640999 16:7717278-7717300 CTGGTGTGGTTGCAGAAAGTTGG - Intergenic
1134414890 16:14034695-14034717 CTGGTGTTTTGGAGGAAATTTGG - Intergenic
1135157775 16:20068347-20068369 CTGGTGTTTTTAAGGGAACTTGG + Intronic
1138088103 16:54152425-54152447 CAGGTGGCTTGGAGGAAAGTGGG - Intergenic
1141125578 16:81398326-81398348 CTGGTGATATTGAGGAAATGAGG - Intergenic
1141941316 16:87278026-87278048 CTGGAGTTTCTGGGGAACGTGGG - Intronic
1142946172 17:3430145-3430167 TTGGTGTTTTTGTTGAAAATTGG - Intergenic
1142952489 17:3495023-3495045 CTGGGGGTTCTGAGGAGAGTTGG - Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1146268075 17:31466204-31466226 CTGGTGCACTTGAGGACAGTGGG + Intronic
1147651338 17:42063673-42063695 CTGGGGTCTTGGAGGAAAGGTGG + Intronic
1148007437 17:44445311-44445333 ATGGTGTTTTCCAGGAAATTAGG + Intronic
1148781299 17:50123564-50123586 TTGGTGGTTTTGAGGCAAGGTGG + Intronic
1149346298 17:55739747-55739769 CTGGTGTCTTTGCAGGAAGTAGG - Intergenic
1149972828 17:61236225-61236247 GTGGTGTTCTGTAGGAAAGTGGG + Intronic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1150879680 17:69009734-69009756 CTGGTGTTTTGTAGGAGAGATGG + Intronic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1203166318 17_GL000205v2_random:100113-100135 CTGGTGTCTTTGAGGTCAGTAGG - Intergenic
1154331348 18:13431474-13431496 GTGGTGTTTTGATGGAAAGTTGG + Intronic
1157431179 18:47627839-47627861 TCGGTGCTTTTGAGGAAAGGAGG - Intergenic
1157648662 18:49304356-49304378 TTGGTGTTTTAGGGGAAGGTAGG - Intronic
1157976624 18:52335116-52335138 GTGGGTTTTTTGAGGAAATTAGG - Intergenic
1158434261 18:57423951-57423973 CTGGTGTTTTTTAAAAAACTGGG - Intergenic
1160215783 18:76929022-76929044 CAGGTGTGTTTCAGGGAAGTGGG - Intronic
1160785061 19:896531-896553 ATTGTGTTTTGGGGGAAAGTGGG - Exonic
1162494452 19:11015632-11015654 CTGAAATTATTGAGGAAAGTAGG - Intronic
1162569115 19:11460579-11460601 CTGGTGTGTTTGGGAAAAATGGG - Intronic
1163894338 19:20044358-20044380 CTGGTATCTTTGAGGTCAGTAGG + Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165614084 19:37183277-37183299 CTGGTGTGTTTTAGCCAAGTTGG + Exonic
926922776 2:17955730-17955752 CTGGTGTCTGTGAGCAGAGTGGG + Intronic
927122756 2:19983723-19983745 CTAGTGATTTAGAGGAAATTAGG - Intronic
928151433 2:28833346-28833368 CTGGTATCTTTGAGGTAAGGAGG - Intronic
929280391 2:40072008-40072030 GTGGTGATTTGGAGGAAAGAGGG + Intergenic
929795941 2:45058420-45058442 ATGATGATTTTGGGGAAAGTGGG + Intergenic
931685242 2:64786860-64786882 CTGGTGTTTTGGGGGAATGAGGG + Intergenic
931960463 2:67476777-67476799 CTGGTGGTTATGTGGACAGTTGG - Intergenic
932881652 2:75507581-75507603 CTGGTGCCTTTGAGGTCAGTAGG - Intronic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
938123948 2:128657345-128657367 TTGGTGTTTTTGAAGAATTTGGG + Intergenic
938172278 2:129089983-129090005 CTGGTGTTTTCCAGAAACGTGGG + Intergenic
942106584 2:172639711-172639733 GTGGTATTTTTGAGGGACGTTGG + Intergenic
944489178 2:200239850-200239872 CTTGTGCTTTTGAGGCTAGTTGG + Intergenic
946469791 2:219947898-219947920 CTGGTGTTTTGGAGTATACTGGG + Intergenic
947632950 2:231665614-231665636 CTGGGGCCTTTGGGGAAAGTAGG - Intergenic
947945608 2:234099298-234099320 CTGGTGTCTTTATGGAAAGAGGG + Intergenic
948756044 2:240160254-240160276 CTGCTGTTTTTCAGAAACGTGGG + Intergenic
1171042792 20:21781329-21781351 CTTGTTTTTCAGAGGAAAGTGGG - Intergenic
1172673793 20:36653070-36653092 ATGGTGTTTTTAAGGGAATTAGG - Exonic
1173888638 20:46484770-46484792 GTGATGATTTTGAGGACAGTGGG - Intergenic
1174104548 20:48153114-48153136 GTGGTGATTTTGGGGAAAATGGG - Intergenic
1174830255 20:53805704-53805726 CTGGTTTCTATGAGGAATGTGGG + Intergenic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1176335199 21:5590443-5590465 CTGGTGTCTTTGAGGTCAGTAGG + Intergenic
1176392558 21:6230505-6230527 CTGGTGTCTTTGAGGTCAGTAGG - Intergenic
1176405437 21:6358983-6359005 CTGGTGTCTTTGAGGTCAGTAGG + Intergenic
1176468861 21:7085669-7085691 CTGGTGTCTTTGAGGTCAGTAGG + Exonic
1176492422 21:7467447-7467469 CTGGTGTCTTTGAGGTCAGTAGG + Intergenic
1176508220 21:7670936-7670958 CTGGTGTCTTTGAGGTCAGTAGG - Intergenic
1177293619 21:19147490-19147512 CAGGTTTCTTTGGGGAAAGTTGG + Intergenic
1177991041 21:28036821-28036843 CTGGCCTTTCTGAGGAAAGCAGG + Intergenic
1179622458 21:42626311-42626333 CAGGTGTTTTTGGGGTATGTGGG - Intergenic
1184541536 22:45128834-45128856 CTGTGGATTTTGAGTAAAGTGGG - Intergenic
949592772 3:5510872-5510894 CTGGTGGTTCTGAGGAATCTGGG + Intergenic
950100427 3:10353287-10353309 CTGTTGCTTTAGAAGAAAGTGGG + Intronic
950681168 3:14586058-14586080 CTGGTGTGTTTGAAGAACGGAGG - Intergenic
950965642 3:17143993-17144015 CTGGGGTGTGTGAGGAAAGCTGG + Intergenic
951469876 3:23044592-23044614 GTGGTCATTTGGAGGAAAGTGGG - Intergenic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
955524188 3:59804166-59804188 CTGGTTCATTTGAGGAGAGTAGG + Intronic
955821544 3:62901272-62901294 CTGGTGTTTTGGAGGGTTGTGGG - Intergenic
957567544 3:81904331-81904353 CTCGTTTTTTGGATGAAAGTTGG - Intergenic
958435550 3:94091600-94091622 CTTGTATCTTTTAGGAAAGTTGG + Intronic
958833567 3:99117837-99117859 CTTCTGTTTGTGAGGAAGGTGGG + Intergenic
959452753 3:106523433-106523455 CTGGTGGTTCTGAGGAATCTGGG + Intergenic
959569767 3:107870557-107870579 CTGGTGATTTCTATGAAAGTTGG - Intergenic
959968763 3:112384885-112384907 CTGGTGTTTTTGAGAGATGAGGG - Intergenic
960391690 3:117084651-117084673 CTGGCATGTTTGAGGAAAATAGG - Intronic
961168703 3:124780727-124780749 CTGGGGGATGTGAGGAAAGTGGG - Intronic
962087363 3:132205814-132205836 CTGCTGTTTGGGAGGAAAGTTGG - Intronic
964217558 3:154303559-154303581 CTGCTGTTTTTTATTAAAGTAGG - Intronic
964447580 3:156776325-156776347 CTTGTGTTTCTGAGGAAGGTGGG + Intergenic
964506428 3:157405031-157405053 CTGGTGTCTGTGAGGGAAGTAGG - Intronic
971082639 4:23232114-23232136 CTGGATTTTTTGAGGACAGCTGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972156772 4:36172819-36172841 CTGGTGTTTCCCAGGAAAGCTGG - Intronic
975421483 4:74169118-74169140 CTGGTGTTTATGGGTAAATTAGG - Intronic
975760319 4:77613663-77613685 CTGGAGTGTCTGAGGAAAGGCGG + Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977247216 4:94646965-94646987 ATGGGTTTTTTGGGGAAAGTGGG - Intronic
980020748 4:127706935-127706957 CTGATGGTTTAGAAGAAAGTGGG + Exonic
980469770 4:133235780-133235802 AGTGTGTTTTTGAGGATAGTAGG - Intergenic
981575302 4:146197866-146197888 CTGGTGATTTTGTGGGCAGTTGG + Intronic
982371395 4:154637362-154637384 CTTGTGGTTCTGAGGAAAGAAGG + Intronic
982668282 4:158292119-158292141 AGGGTTTTTTTGAGCAAAGTGGG - Intergenic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
983855717 4:172641456-172641478 CTGGTGTGTTTTAGGATAGGAGG - Intronic
984147293 4:176078468-176078490 ATGGTGTTTAAGTGGAAAGTTGG + Intronic
984339851 4:178443123-178443145 CTGATGTATTGGAGGAAAATAGG + Intergenic
988268999 5:28990537-28990559 CTGGTGCTTCTGAGGAACTTAGG + Intergenic
990199226 5:53352683-53352705 CTGGGGTTTCTCAGGAAAATGGG - Intergenic
990373084 5:55140891-55140913 CAGGTGTTTTTGATTGAAGTTGG - Intronic
991629784 5:68645033-68645055 TTGTTGTTGTTGGGGAAAGTGGG - Intergenic
992260436 5:74965277-74965299 CTGGTGTTTCTCTGGAAGGTTGG - Intergenic
992846959 5:80760161-80760183 CTGATGTTTTGGGGGAAAGGAGG - Intronic
993434115 5:87870526-87870548 CTAGTGTGTTTGAGGATATTTGG + Intergenic
993679252 5:90854880-90854902 TCAGTGTTTTTGAGGAAAGTTGG - Intronic
994603134 5:101933404-101933426 TTGATGGTTTTGAGGAACGTTGG - Intergenic
995910743 5:117183615-117183637 CTGGTGTTTTGGAGGGATGTGGG + Intergenic
997719816 5:136069330-136069352 TTGGTTTTTGTGTGGAAAGTGGG + Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1001215100 5:169848628-169848650 CTGGTGATTTTGTTGAAATTGGG + Intronic
1003391539 6:5717429-5717451 CTGTTGTTTTTGAAGAAACTGGG + Intronic
1004313357 6:14565188-14565210 CTGGACTTTTTGAGGACAGTTGG + Intergenic
1004708244 6:18144684-18144706 CTGGTAATTTTGAGGAAAAGAGG + Intronic
1005279295 6:24254929-24254951 CAAGTGTTTTGGAGGAAATTGGG + Intronic
1007927878 6:45664264-45664286 CTGGTGTATTTGTGGAAAAGGGG + Intronic
1008007402 6:46425707-46425729 CTGTTTTTTTTAAGGTAAGTAGG - Intronic
1009508185 6:64512606-64512628 CTGTGTTATTTGAGGAAAGTGGG + Intronic
1010860488 6:80903753-80903775 CTGGTGCTTTTGTGCAAACTGGG - Intergenic
1012696118 6:102385578-102385600 CTGGTGCTTTAGAGGAGTGTAGG + Intergenic
1014117955 6:117687648-117687670 CATGTGTTTTTGAGGAACATAGG + Intronic
1014260263 6:119208528-119208550 TTCTTGTTTTTGAGTAAAGTAGG - Intronic
1014383531 6:120774088-120774110 CAGGTGATTTTGAGGCATGTGGG + Intergenic
1015397056 6:132746553-132746575 TGGCTCTTTTTGAGGAAAGTGGG + Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1015732166 6:136360462-136360484 CTGGGGTTATTCAAGAAAGTTGG + Intronic
1016936633 6:149452796-149452818 CTGGTGTTCTTGGGGAACTTGGG - Intronic
1018499652 6:164392707-164392729 TTGGTATATTTGAGGTAAGTTGG + Intergenic
1020985988 7:15134753-15134775 TTGGGGTTTTTGAGGAAGGAAGG + Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1024623276 7:51182196-51182218 CTGACGTTTTTGAGATAAGTTGG - Intronic
1026635653 7:72079655-72079677 CTGTTGTTTTTTAGGAACTTGGG + Intronic
1028239764 7:88405241-88405263 GTGGTGTGTTTGGGGAGAGTTGG - Intergenic
1028646094 7:93098239-93098261 CTGGTGTTCTTTGGAAAAGTGGG + Intergenic
1030204585 7:106940599-106940621 CTGAAGCTTTAGAGGAAAGTGGG - Intergenic
1030476914 7:110047304-110047326 TTTGTTTTTTTGAGGAAATTTGG + Intergenic
1030897036 7:115073387-115073409 CGGAGGTTTTTGAGGAAAGTTGG - Intergenic
1032733091 7:134663903-134663925 CTGTTCTTTTTGAGGGAAATCGG + Intronic
1034139467 7:148802530-148802552 CTGGGGTTTCTCAGGAAACTCGG + Intergenic
1035594928 8:849414-849436 CAGGAGTTTTTGTGGAAATTGGG + Intergenic
1036588417 8:10146518-10146540 CTGGGGGTTTCGAGGAAACTAGG + Intronic
1036955516 8:13183944-13183966 CTGGACTTTTTTTGGAAAGTAGG + Intronic
1038059026 8:23891870-23891892 CTGGTCTTTTCCAGGAAGGTTGG + Intergenic
1041524555 8:58790653-58790675 CTGGTGTTGTGGAAGACAGTGGG - Intergenic
1042612633 8:70615165-70615187 CTGGGGTTTTTGAGCAAGGGAGG + Intronic
1044370103 8:91400227-91400249 CTAGTGTTTTTTTGGAAAGTAGG - Intergenic
1045405951 8:101867053-101867075 CTGGTGTGCTTGAGGAACGGTGG - Intronic
1045701416 8:104870937-104870959 CTGGTATTTTTTAGGACACTCGG - Intronic
1046394027 8:113615802-113615824 CGGGTGTTGTGGAGGTAAGTGGG - Exonic
1046509797 8:115187458-115187480 CTGGTCTATTTCAGGAGAGTAGG + Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1048018610 8:130519213-130519235 ATGGTGTTTTTGTGCAAACTAGG + Intergenic
1048773134 8:137916972-137916994 CTGGTGTTTTTGAGGGATTTGGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049524071 8:143111940-143111962 TTGGCGTTTATGGGGAAAGTTGG + Intergenic
1052333955 9:27300782-27300804 CTGGTGTTTTTATGAAAAGGAGG + Intergenic
1052369288 9:27645736-27645758 CTGGTGGTTCTGAGGAATCTGGG + Intergenic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1056844445 9:90025203-90025225 CTGGGCTTTTTCAGGAAATTTGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057837392 9:98456029-98456051 CTGGTCTCTTTGAGGAACCTGGG - Intronic
1058841950 9:108918421-108918443 ATGGTGCTTTTGTGGAAATTAGG - Intronic
1060444482 9:123675236-123675258 ATGCTGTTTTGGAGGAAAGGGGG - Intronic
1060532042 9:124353428-124353450 GTGGTGTTTTTGGGGGCAGTAGG - Intergenic
1203426441 Un_GL000195v1:44477-44499 CTGGTGTCTTTGAGGTCAGTAGG - Intergenic
1203439819 Un_GL000195v1:178588-178610 CTGGTGTCTTTGAGGTCAGTAGG + Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1185998364 X:4978837-4978859 CTGGGGATTTTGAGCACAGTAGG + Intergenic
1188305182 X:28553138-28553160 TTGGTGGTTTTGTGTAAAGTTGG - Intergenic
1188428505 X:30077196-30077218 ATGATTTTTTGGAGGAAAGTAGG + Intergenic
1189074755 X:37904452-37904474 CTGGTATTATTCAGGGAAGTAGG + Intronic
1189808348 X:44757644-44757666 ATAGAGTTTTTCAGGAAAGTTGG + Intergenic
1191252213 X:58265100-58265122 CTGGGGTCTTTGAGGAAGCTTGG + Intergenic
1191715098 X:64188791-64188813 CTGGGGTTTTTGTGGAGTGTAGG - Exonic
1194048218 X:89035369-89035391 CTGGTGCTTATGAAGAAATTTGG - Intergenic
1195215586 X:102698257-102698279 CTGGTGAGTTTGAAGCAAGTAGG - Intergenic
1196372144 X:114991188-114991210 CTGCTGATTTTGAAGAAACTTGG - Intergenic
1197841639 X:130753972-130753994 CTGGTGTTCTTCAGCAATGTAGG + Intronic
1201341691 Y:12941399-12941421 CTGGTGTCTTTGAGGTCAGTAGG + Intergenic