ID: 977217308

View in Genome Browser
Species Human (GRCh38)
Location 4:94297736-94297758
Sequence GCAAGTCCTGCTTTTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217308_977217321 8 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG No data
977217308_977217318 0 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG No data
977217308_977217320 7 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG No data
977217308_977217319 6 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG No data
977217308_977217315 -2 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG No data
977217308_977217314 -8 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG No data
977217308_977217322 27 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG No data
977217308_977217317 -1 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217317 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217308 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG (reversed) Intergenic