ID: 977217309

View in Genome Browser
Species Human (GRCh38)
Location 4:94297737-94297759
Sequence GGCAAGTCCTGCTTTTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1035
Summary {0: 31, 1: 190, 2: 354, 3: 230, 4: 230}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217309_977217320 6 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002
977217309_977217321 7 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
977217309_977217318 -1 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
977217309_977217315 -3 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162
977217309_977217317 -2 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217317 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG 0: 201
1: 360
2: 460
3: 354
4: 240
977217309_977217322 26 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217309_977217319 5 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
977217309_977217314 -9 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG 0: 457
1: 585
2: 275
3: 104
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217309 Original CRISPR GGCAAGTCCTGCTTTTCTAG GGG (reversed) Intergenic
900840590 1:5045877-5045899 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
901491137 1:9596971-9596993 GCCAAGTCCTGCTGTGCAAGAGG + Exonic
901638974 1:10683767-10683789 GGGAAAGCCTCCTTTTCTAGAGG - Intronic
903853829 1:26323981-26324003 GGCAAGTCGTGCTCTTCTCTGGG - Intronic
904711407 1:32433203-32433225 TGCAAGTCCCGCTTTTCTGGGGG + Intergenic
904711441 1:32433324-32433346 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
904996668 1:34636644-34636666 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
905060748 1:35137137-35137159 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
905499580 1:38426098-38426120 GGCAAGTACCACTTTTCTGGGGG + Intergenic
905797522 1:40823986-40824008 GCCAGGTCCTGCTGCTCTAGAGG - Intronic
905831861 1:41075508-41075530 GGCAAGTCCTTTTTTTCTTCTGG - Intronic
906080682 1:43086375-43086397 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
906080714 1:43086492-43086514 GGCAAGTCCCACTTTTCTAAGGG + Intergenic
906489584 1:46257836-46257858 GGAAAGTCCTGCATTTGTAATGG + Intronic
906744741 1:48213813-48213835 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
906744774 1:48213938-48213960 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
907292403 1:53425209-53425231 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
907292434 1:53425334-53425356 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
907503774 1:54902601-54902623 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
907503808 1:54902722-54902744 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
907521047 1:55023622-55023644 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
908461905 1:64354664-64354686 GGCAAGTCCTGCTTTTCTAGAGG - Intergenic
908461915 1:64354728-64354750 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
908592183 1:65646689-65646711 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
908592197 1:65646753-65646775 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
908852200 1:68387263-68387285 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
908852215 1:68387327-68387349 GACAAGTCCTGCTTTTCTAGGGG + Intergenic
909035248 1:70589248-70589270 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
909035280 1:70589373-70589395 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
909222844 1:72984502-72984524 GGCAAGTCCCGTTTTCCTAGGGG - Intergenic
909223845 1:72992485-72992507 AGCAAGTCCTGCTTTTTTACAGG - Intergenic
909551219 1:76899502-76899524 GGCAAGTCCCGCTTTTCTGGGGG - Intronic
909776893 1:79493233-79493255 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
909788465 1:79643487-79643509 AGCAAGTCCCACTTTTCTAGGGG - Intergenic
909788497 1:79643607-79643629 GGCAAGTCCTGCTTTTCTGTGGG - Intergenic
909793175 1:79701034-79701056 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
909793209 1:79701158-79701180 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
909845463 1:80387905-80387927 GGCAAGTCCACATTTTTTAGAGG + Intergenic
909909738 1:81246307-81246329 GGCAAGTCCTGCTTTTCTATGGG + Intergenic
909978635 1:82072142-82072164 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
910049139 1:82956176-82956198 GGCAAGTCCCACTTTTCTGGCGG + Intergenic
910253763 1:85225716-85225738 GACCAGTTCTGCTTTTCTAGAGG - Intergenic
911510811 1:98805941-98805963 GGCAAGTACTGCTTTTCTGGGGG - Intergenic
911570192 1:99510590-99510612 GGCAAGTCCCACTTTTCTAGAGG + Intergenic
912296275 1:108473959-108473981 AGCAAGTCCCACTTTTCTAGAGG + Intergenic
916457378 1:164984788-164984810 GGCAACTCCTCCTTCTCTATAGG + Intergenic
918346920 1:183614708-183614730 AACAAGTCCCACTTTTCTAGGGG + Intergenic
918567878 1:185953029-185953051 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
918567896 1:185953093-185953115 GGCAAGTCCCGCTTTTCTGGGGG - Intronic
918714596 1:187770166-187770188 GGCAAGTCCCACTTTCCTAGGGG - Intergenic
919476169 1:198035632-198035654 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
920829205 1:209449954-209449976 GGCAAGTCCCACTTTCCTGGGGG + Intergenic
921212222 1:212910530-212910552 GGCAAGTCCCACTTTCCTAGGGG + Intergenic
921459991 1:215414700-215414722 GGCGAGTCCCACTTTTCTACGGG - Intergenic
921509066 1:216008995-216009017 AGCAAGTCCCACTTTTCTGGGGG + Intronic
921519934 1:216146568-216146590 GGCAAGTCCCGCTTTCCTAGGGG + Intronic
921733173 1:218598479-218598501 GACAAGTCCTGCTTTTCTAGGGG - Intergenic
921733189 1:218598543-218598565 GCCAAGTCCCGCTTTTCTGGGGG - Intergenic
922048180 1:221966808-221966830 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
922048213 1:221966933-221966955 AGCAAGTCCCGCTTTTCTGGGGG + Intergenic
922048229 1:221966997-221967019 GGTAAGTCCCACTTTTCTAAGGG + Intergenic
922049748 1:221977855-221977877 GGCAAGTCCTGCTTTTCTATGGG - Intergenic
922154271 1:223029113-223029135 AGCAAGTCCCGCTTTCCTAGGGG - Intergenic
922906183 1:229175346-229175368 AGCAAGTCCCGCTTTTCTATGGG + Intergenic
922934579 1:229413258-229413280 AGCAAATCCCGCTTTTCTGGGGG + Intergenic
922934642 1:229413501-229413523 GGCAAGTCTCACTTTTCTAGGGG + Intergenic
923009654 1:230078190-230078212 GGCAATTCCTACTTTATTAGTGG + Intronic
923075009 1:230602222-230602244 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
923214361 1:231834772-231834794 GGCAAGTACAGCTTTTCTAGGGG - Intronic
923244543 1:232119132-232119154 GGCAAGTCCTGCTTTTCTAGAGG + Intergenic
923408833 1:233688248-233688270 GGCAAGTCCTGTTTTTCTGGGGG - Intergenic
923408853 1:233688331-233688353 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
923408872 1:233688395-233688417 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
923408906 1:233688520-233688542 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
923770910 1:236936835-236936857 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
923770958 1:236937020-236937042 AGCAAGTCCCGCTTTTCTGGAGG - Intergenic
923962532 1:239102071-239102093 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
923962562 1:239102195-239102217 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
924180395 1:241434743-241434765 GGCAAGACCCGCTTTTCTGGAGG + Intergenic
924180428 1:241434868-241434890 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1063362873 10:5471631-5471653 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1063362905 10:5471756-5471778 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1063509817 10:6634367-6634389 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1063509829 10:6634431-6634453 GACAAGTCCCGCTTTTCTGGGGG - Intergenic
1063527872 10:6801780-6801802 GGCAAGTCCTGCTTTTCTAGAGG - Intergenic
1064663998 10:17631455-17631477 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1064887209 10:20123948-20123970 AGCAAGTCCCGCTTTTCTAGGGG - Intronic
1064887239 10:20124069-20124091 GGCAAGTTCCGCTTTTCTGTGGG - Intronic
1065437396 10:25717271-25717293 GGCAAGTACCGCTTTTCTAGGGG + Intergenic
1065443396 10:25773896-25773918 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1068058554 10:52038522-52038544 GGCAAGTCCCGCTTTTCTAGAGG - Intronic
1068179847 10:53503720-53503742 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1068230752 10:54167690-54167712 AGCAAGTCCCGCTTTTCTACAGG + Intronic
1068592540 10:58865711-58865733 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1070474739 10:76819609-76819631 AGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1071897931 10:90085755-90085777 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1071916017 10:90296044-90296066 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1071960855 10:90808180-90808202 GGCAAGTCCCACTTTTCTGGGGG + Intronic
1071960883 10:90808298-90808320 AGCAAGTCCCGCTTTTCTAGAGG + Intronic
1071960915 10:90808419-90808441 GGCAAGTCCTGCTTTTCTGGGGG + Intronic
1072011517 10:91306388-91306410 GGCAAGTAGTGCTTTTCTAGGGG - Intergenic
1073709656 10:106022175-106022197 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
1074018816 10:109563310-109563332 AGCAAGTACCGCTTTTCTGGGGG + Intergenic
1074740573 10:116481658-116481680 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1075248512 10:120845912-120845934 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1077590073 11:3484363-3484385 AGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1077611939 11:3648760-3648782 GGCAAGTCCCGCTTTTCTGGAGG + Intronic
1077679345 11:4224401-4224423 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1077688766 11:4320985-4321007 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1077766641 11:5165230-5165252 GGCAAATCCCACTTTTCTGGAGG - Intronic
1077851039 11:6074781-6074803 GGCAAGTCCCACTTTTCTATGGG - Intergenic
1077883171 11:6366889-6366911 GGCAAGTACTGCTTTTCTGGGGG + Intergenic
1078046340 11:7916939-7916961 GGCAAGTCCCACTTTTCTATGGG - Intergenic
1079447274 11:20568830-20568852 GGCAAGTCCCACTTTCCTAGGGG + Intergenic
1079672750 11:23188568-23188590 AGCAAGTCCCGCTTTCCTACAGG - Intergenic
1079727287 11:23891929-23891951 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1080028122 11:27633829-27633851 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
1080028135 11:27633893-27633915 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1080227152 11:29974244-29974266 GGCAAGCATTGCTTTTCTGGGGG + Intergenic
1080339351 11:31241752-31241774 GGCAATTCCTGCGTTACTAGTGG + Intronic
1080656115 11:34259753-34259775 GACTAGTCCTAGTTTTCTAGGGG - Intronic
1081159435 11:39735006-39735028 GGCAAGCACTGCTTTTCTGGGGG + Intergenic
1081356619 11:42121614-42121636 AGCAAGTCCCACTTTCCTAGGGG + Intergenic
1084046967 11:66574606-66574628 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1084232065 11:67760538-67760560 GGCAAGTCCTGCTTTTCTGTGGG + Intergenic
1084232097 11:67760659-67760681 GGCAAGACCCACTTTTCTTGGGG + Intergenic
1084245791 11:67856135-67856157 AGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1084353799 11:68623653-68623675 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1084355350 11:68634708-68634730 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1084613505 11:70219159-70219181 AGCAAGTCCCACTTTTCTAGGGG - Intergenic
1084613533 11:70219280-70219302 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1084826878 11:71738379-71738401 AGCAAGTCCCGCTTTTCTTGGGG + Intergenic
1084826893 11:71738443-71738465 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1085987806 11:81807140-81807162 AGCAAGTACTGCTTTTCTAGGGG + Intergenic
1086136501 11:83447709-83447731 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1087098902 11:94346704-94346726 GGCAAGTCCCACTTCTCTAGAGG + Intergenic
1087127606 11:94642569-94642591 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1087196724 11:95310592-95310614 GGCAAGTCCCACTTTCCTAGGGG + Intergenic
1087314447 11:96588781-96588803 GGCAAGTTCCGCTTTTCTAGAGG + Intergenic
1087839756 11:102908903-102908925 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1089348908 11:117810322-117810344 GGCAAGTCCCGCTTTTCTAGGGG + Intronic
1089472280 11:118730854-118730876 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1089760711 11:120721069-120721091 GGAAAGACATGCTTTTCTGGAGG + Intronic
1089867260 11:121642642-121642664 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1089953024 11:122547480-122547502 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1089987156 11:122825285-122825307 GGCAAGTCCTGCTTTTCTGGAGG + Intergenic
1089987186 11:122825406-122825428 GGCAAGTCCCGCTTTTCCAGGGG + Intergenic
1090527017 11:127547592-127547614 GGCAAGTCCTGCTTTTCTGGAGG - Intergenic
1090546704 11:127773899-127773921 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1090546725 11:127774024-127774046 GGCAAGTCCTGCTTTTCTGGAGG - Intergenic
1090850785 11:130568992-130569014 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1090872140 11:130758136-130758158 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1090927169 11:131259272-131259294 GGCAAGTACCGCTTTTCTAGGGG - Intergenic
1091886318 12:4019559-4019581 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1092028989 12:5268258-5268280 GGAAAGTTCTGCTTTTCCAGTGG - Intergenic
1092416376 12:8293265-8293287 AGCAAGTCCCGCTTTTCTGAGGG - Intergenic
1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG + Intergenic
1092592912 12:9967629-9967651 GGCAAGTACCGCTCTTCTTGGGG - Intronic
1092626940 12:10337603-10337625 GGCAAGTCCCGCTTTTCTATGGG - Intergenic
1092723928 12:11466970-11466992 GGCAAATCCCACTTTTCTATGGG - Intronic
1092789477 12:12059231-12059253 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
1092789511 12:12059352-12059374 GGCAAGTCCGGCTTTTCTGGAGG + Intronic
1092925043 12:13264644-13264666 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1093071356 12:14709560-14709582 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1093268198 12:17026334-17026356 GGCAAGTCCCGCTTTTGTAGTGG - Intergenic
1093268230 12:17026459-17026481 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1093578544 12:20764001-20764023 GGCAAGTCCCACTTTTCTAGAGG + Intergenic
1093584688 12:20821586-20821608 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
1093584723 12:20821711-20821733 CGCAAGTCCCGCTTTTCTGGGGG - Intronic
1093813024 12:23510651-23510673 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
1093950851 12:25164075-25164097 GGCAAGTACCGCTTTTCTGGAGG + Intronic
1093950893 12:25164250-25164272 AGCAAGTACCACTTTTCTAGAGG + Intronic
1094316256 12:29139704-29139726 AGCAAGTACTGCTTTTCTAGGGG - Intergenic
1094316298 12:29139882-29139904 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1094400455 12:30056943-30056965 GGCAAGTACCACTTTTCTGGGGG + Intergenic
1094400470 12:30057004-30057026 GGCAAGTACCACTTTTCTGGTGG + Intergenic
1094400488 12:30057064-30057086 AGCAAGTACTGCTTTTCTGGGGG + Intergenic
1094400502 12:30057124-30057146 GGCAAGTACCACTTTTCTAGGGG + Intergenic
1094825561 12:34266621-34266643 ATCAAGTCCCGCTTTTCTAGGGG + Intergenic
1097398386 12:59102837-59102859 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1097417242 12:59327901-59327923 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1097592192 12:61587936-61587958 GGCAAGCACTGCTTTTCTGGGGG + Intergenic
1097950878 12:65427191-65427213 GGAAAGTCCTTCTTTTATTGGGG + Intronic
1098000602 12:65938029-65938051 GGCCAGACCTGCTTTGCAAGGGG - Intronic
1098173823 12:67771305-67771327 GGCAAGTTCCGCTTTTCTATGGG - Intergenic
1098402054 12:70086437-70086459 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1098654007 12:73006606-73006628 AGCAAATACTGCTTTTCTAGGGG - Intergenic
1098654036 12:73006725-73006747 GGCAAGTACCGCTTTTCTAGGGG - Intergenic
1099188510 12:79540866-79540888 GGCAAGTCCCGCTTTTCTACGGG + Intergenic
1099292311 12:80787901-80787923 GGCAAGTCCCGATTTTCTAAAGG - Intergenic
1099762374 12:86939708-86939730 GGCAAGTCCCGCTTTTCTATGGG + Intergenic
1100561099 12:95749914-95749936 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
1100561118 12:95749978-95750000 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
1100561132 12:95750042-95750064 GGCAAGTCCTGCTTTTCTAGAGG + Intronic
1100714445 12:97291030-97291052 GGCAAGAGCTGAATTTCTAGGGG - Intergenic
1100940065 12:99716048-99716070 AGCAAGTCCCGCTTTTCTGGGGG + Intronic
1101278625 12:103227516-103227538 GGCAAGTCCCACTTTTCTATGGG - Intergenic
1101711341 12:107269518-107269540 GGAAAGTCCTGAGTTTCTACAGG + Intergenic
1102547135 12:113665271-113665293 GGCAAGTCCTGTTTATGTATAGG - Intergenic
1105031985 12:132890419-132890441 GGCAAGTAATGCTTTTTTGGGGG + Intronic
1106554727 13:30799679-30799701 GGCAAGTCCAGCTTTTGTCCTGG + Intergenic
1106943252 13:34799706-34799728 AGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1107075357 13:36317346-36317368 AGCAAGTCCTGCTTTTCTAGAGG + Intronic
1107220547 13:37974083-37974105 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1107683335 13:42872102-42872124 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1108202446 13:48057218-48057240 GGCAAGTCCCACTTTTCTGGGGG + Intronic
1108512795 13:51170897-51170919 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1108744874 13:53382522-53382544 CCCAAGTCCTGCTTTCCCAGTGG - Intergenic
1108913621 13:55582984-55583006 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
1108913635 13:55583048-55583070 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1108919760 13:55659754-55659776 GGTAAGTCCTGCTTTTCTATGGG - Intergenic
1108947204 13:56041144-56041166 AGCAAGTTCCGCTTTTCTGGGGG + Intergenic
1108947242 13:56041331-56041353 TGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1108953162 13:56117219-56117241 GGCAAGTCCCGCTTTTCTACGGG - Intergenic
1109343371 13:61089317-61089339 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1109499086 13:63214092-63214114 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1109709850 13:66146003-66146025 GGCAAGTCCCACTTTCCTAGGGG - Intergenic
1109716965 13:66231172-66231194 GGCAAGTCCCACTTTTCTACGGG - Intergenic
1110650727 13:77938443-77938465 AGCAAGTACCACTTTTCTAGGGG - Intergenic
1110650743 13:77938503-77938525 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1110765255 13:79275062-79275084 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1110845092 13:80184413-80184435 TGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1110845123 13:80184534-80184556 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1110978228 13:81866959-81866981 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1111126233 13:83912937-83912959 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1111131039 13:83975924-83975946 GGCAAATCCTACTATTTTAGGGG - Intergenic
1111301802 13:86359195-86359217 GGCAAGTTCCACTTTTCTACGGG + Intergenic
1111362310 13:87191101-87191123 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1111362343 13:87191226-87191248 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1111459052 13:88517564-88517586 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1111459069 13:88517628-88517650 GGCAAGTCCGGCTTTTCTGAGGG - Intergenic
1111630246 13:90840445-90840467 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1111630275 13:90840570-90840592 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1111631903 13:90853302-90853324 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1111631920 13:90853366-90853388 GGCAAGTCCCGCTTTTCTGAGGG - Intergenic
1112236601 13:97643167-97643189 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1112236630 13:97643292-97643314 GGCAAGTCCTGCTTTTCTGGAGG + Intergenic
1112889563 13:104212950-104212972 AGCAAGTACTGGTTTTCTGGGGG - Intergenic
1113324098 13:109266220-109266242 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1113324116 13:109266284-109266306 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1113665028 13:112135618-112135640 GCCAAGACCTGCTTTCCTAGAGG + Intergenic
1114631013 14:24159729-24159751 AGCAACTCCTGCTTTCCCAGTGG - Intronic
1115240784 14:31249954-31249976 AGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1115904581 14:38191662-38191684 GGCAAGTCCCGCTTTTCTACGGG + Intergenic
1116179462 14:41516890-41516912 GGCAAGTCCTGCTTTTCTACGGG + Intergenic
1116534976 14:46017103-46017125 GGCAAGTCCCACTTTTCGGGGGG - Intergenic
1116573247 14:46544925-46544947 GGCAAGTCCCACTTTTCTGAGGG + Intergenic
1116573281 14:46545052-46545074 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1116613320 14:47105198-47105220 GGCAAGTCCTGCTTTCCTAGGGG + Intronic
1116702593 14:48260065-48260087 GGCAAGTCCCGCATTTCTAGGGG - Intergenic
1116703521 14:48267277-48267299 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1116952732 14:50894253-50894275 GGCAAGTCCCGCTTTCCTAGGGG + Intronic
1117958115 14:61138155-61138177 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1117958151 14:61138280-61138302 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1118937517 14:70300948-70300970 AGCAAGTCCCGCTTTTCTGGAGG - Intergenic
1118937550 14:70301067-70301089 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1119022160 14:71125069-71125091 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1119022193 14:71125190-71125212 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1119022228 14:71125308-71125330 AGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1119316983 14:73704426-73704448 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1119543254 14:75454294-75454316 AGCACGTCCTGCTCTTCAAGGGG - Intronic
1120438268 14:84504982-84505004 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1120539744 14:85737601-85737623 GGCAAGTACCCCTTTTCTGGGGG - Intergenic
1120539776 14:85737714-85737736 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1120611426 14:86646350-86646372 GGCAAGACCTGCCTGGCTAGGGG - Intergenic
1120660173 14:87239790-87239812 GGCAAATCCCGCTTTTCTAGGGG - Intergenic
1121703427 14:95973860-95973882 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1121703443 14:95973924-95973946 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1121703460 14:95973988-95974010 GGCAAATCCTTCTTCTCTGGGGG + Intergenic
1122040794 14:98986202-98986224 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1123882664 15:24690151-24690173 GGCAAGTACTGCTTTTCTGGGGG - Intergenic
1123981926 15:25612564-25612586 GGGAATTCATACTTTTCTAGTGG + Intergenic
1125045571 15:35239768-35239790 AGCAAGTCCCGCTTTCCTAGGGG + Intronic
1125131749 15:36290527-36290549 AGCAAGTGCCGCTTTTCTACGGG - Intergenic
1126231505 15:46332056-46332078 GGAAAATCCTGCTTTTCAAAAGG - Intergenic
1126530338 15:49703754-49703776 GGCAAGTACCGCTTTTCTAAGGG - Intergenic
1126530364 15:49703873-49703895 GGCAAGTACCACTTTTCTAGGGG - Intergenic
1126689983 15:51281524-51281546 CTCAAGTCCTGCTTTTCCATAGG - Intronic
1126843511 15:52739442-52739464 GGCAAGTCCCGCTTTTCAAGGGG + Intergenic
1126843544 15:52739561-52739583 GGCAAGTCCCATTTTTCTGGGGG + Intergenic
1128909300 15:71497675-71497697 GGCAAGTAATGCTTTTCCACAGG - Intronic
1129411060 15:75350545-75350567 GGCAAGTTCTCCCTTTCTGGGGG + Intronic
1130854886 15:87832184-87832206 GGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1130947682 15:88561211-88561233 GGCAAGTCCTGCTTTTCTATGGG - Intergenic
1131447493 15:92512342-92512364 GGCAAGTACCGCTTTTCTAGGGG + Intergenic
1131683951 15:94751614-94751636 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1131683983 15:94751739-94751761 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1131882726 15:96876624-96876646 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1132262761 15:100441062-100441084 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
1132273875 15:100549584-100549606 GGCAAGTCTTGTTTTTCTCAAGG - Intergenic
1132340211 15:101073513-101073535 GGCAAGTCCCGCTTTTCTAGAGG + Intronic
1133738043 16:8630518-8630540 GGAAAGTCCTGCTTCTCAGGGGG + Intronic
1133765935 16:8837730-8837752 GGCAAGTCCCACTTTTCTGGCGG - Intronic
1133766902 16:8844436-8844458 GGCAAGTCCCGCTTTTCTGGGGG - Intronic
1133869819 16:9676221-9676243 AGCAAGTCCCGCTTTTCTACGGG - Intronic
1134022974 16:10934161-10934183 GGCAAGTGCTGCCCTTCCAGAGG - Intronic
1134342368 16:13357207-13357229 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1135247467 16:20869218-20869240 GGCAAGTCCCTGTCTTCTAGGGG + Intronic
1138732699 16:59212884-59212906 GTAAAGTCTAGCTTTTCTAGAGG + Intergenic
1138804724 16:60079747-60079769 AGCAAGTCCCACTTTTCTAGAGG + Intergenic
1139039412 16:62983761-62983783 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1139039448 16:62983884-62983906 GGCAAGTCCCGTTTTCCTGGGGG - Intergenic
1139039485 16:62984009-62984031 GGCAAGTCCCGTTTTCCTGGGGG - Intergenic
1139039521 16:62984134-62984156 GGCAAGTCCCGTTTTCCTGGGGG - Intergenic
1139039540 16:62984198-62984220 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1139039621 16:62984503-62984525 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1139039640 16:62984567-62984589 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1139943223 16:70621086-70621108 GACAAGTCCCGCTTTCCTAGGGG - Intronic
1139943907 16:70625416-70625438 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
1139943940 16:70625539-70625561 AGCAAGTCCCGCTTTTCTGGGGG - Intronic
1140015919 16:71184488-71184510 TCCAACTCCTTCTTTTCTAGTGG + Intronic
1141865403 16:86746666-86746688 GGCAAGTCCCACTTTCCTAAGGG - Intergenic
1144104427 17:11972763-11972785 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1144642685 17:16946298-16946320 GGCCTGTCCTGCTCTTCTTGGGG - Intronic
1146597690 17:34184253-34184275 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
1146762592 17:35491451-35491473 GGAAAGCCCTGCTTTGCTACAGG + Intronic
1151622260 17:75253494-75253516 GGCAAGTCCTGCTTTTCTGGGGG + Intronic
1151622292 17:75253619-75253641 GGTAAGTCCCGCTTTTCTAGGGG + Intronic
1151839938 17:76610545-76610567 GGTAAGTCCCGCTTTTCTATGGG - Intergenic
1151839955 17:76610609-76610631 GGCAAGTCCCGCTTTTCTGAGGG - Intergenic
1155173623 18:23285083-23285105 GGCAAGTCCTGCTTTTCTGGGGG + Intronic
1155697209 18:28697787-28697809 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1155697243 18:28697911-28697933 GGCAAGTCCCGCTTTTCTGGAGG - Intergenic
1155697259 18:28697975-28697997 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1155941307 18:31804625-31804647 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1155941340 18:31804746-31804768 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1156237178 18:35216862-35216884 GGCAAGTACCGCTTTTCTGAGGG + Intergenic
1156602355 18:38624304-38624326 GGCAAGTCCTTGTCTTCTGGAGG + Intergenic
1156897372 18:42261523-42261545 GGTAAGTCCTACTTTGCTACTGG + Intergenic
1156924259 18:42557216-42557238 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1157137340 18:45069517-45069539 GGCAAGTCCTATTCTACTAGAGG - Intergenic
1157426213 18:47586479-47586501 GGCAATTCATGCTTTCCAAGAGG - Intergenic
1158336164 18:56416524-56416546 GGCAAGTCCCGCTTTTCTGGAGG + Intergenic
1158336182 18:56416588-56416610 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1158336195 18:56416652-56416674 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1158394868 18:57071452-57071474 GGCAAGTCCCGCTTTTTTAGAGG - Intergenic
1159164285 18:64682713-64682735 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1159834852 18:73325676-73325698 GCCAAGTCCCGCTTTCCTAGGGG + Intergenic
1159879223 18:73842700-73842722 AGCAGTTCCTGCTTTTCTAAGGG - Intergenic
1160500183 18:79397710-79397732 GGAAAGACCTGCCTTTCTAAAGG - Intronic
1161121618 19:2530111-2530133 GCCCTGTCCAGCTTTTCTAGTGG - Intronic
1161556275 19:4944487-4944509 GGCTCATCCTGCTTTTCTGGGGG + Intronic
1161661526 19:5549532-5549554 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1161937149 19:7379040-7379062 GGCAACCCCAGCTTATCTAGGGG + Intronic
1162242387 19:9365542-9365564 GGCAAGTACTGCTTTTCTGGGGG - Intronic
1163487077 19:17594377-17594399 GGCAAGTCCCGCTTTTCTAAGGG + Intergenic
1163900491 19:20095734-20095756 GGCAAGTCCCACTTTTCTAGGGG - Intronic
1163906849 19:20155606-20155628 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
1164152777 19:22569269-22569291 GGCAAGTCCCACTTTCCTAGGGG + Intergenic
1164285371 19:23810760-23810782 GGGAGGTCCTGCTCTTCCAGAGG - Intronic
1164372577 19:27655109-27655131 GGCAACTCCTGGCTTTCTAATGG - Intergenic
1164459420 19:28434560-28434582 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1164459462 19:28434752-28434774 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1164459495 19:28434877-28434899 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1164602142 19:29569324-29569346 TGCAACTCCTGCTTTTCCTGGGG + Intergenic
1165497178 19:36159986-36160008 GGTAAGTCCCACTTTTCTAGGGG - Intergenic
1165497208 19:36160108-36160130 GGCAAGTCCCGCTTTTCTCGGGG - Intergenic
1165510519 19:36264196-36264218 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1165510551 19:36264321-36264343 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1165835135 19:38750508-38750530 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
1165835162 19:38750629-38750651 AGCAAGTCCCGCTTTTCTGGAGG + Intronic
1165849160 19:38839138-38839160 GGCCAGGCATGTTTTTCTAGTGG - Intronic
1166499144 19:43328242-43328264 GGTAAGTCCCGCTTTCCTAGGGG - Intergenic
1167046785 19:47054380-47054402 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1167046816 19:47054503-47054525 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1167099207 19:47393724-47393746 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1167901949 19:52628766-52628788 AGCAAGTCCCACTTTTCTAGGGG + Intronic
1168051389 19:53832308-53832330 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1168212315 19:54899604-54899626 GGCAAGTACCGCTTTTCTAGGGG - Intergenic
1168212346 19:54899722-54899744 GGCAAGTACTGCTTTTCTGGGGG - Intergenic
1168228175 19:55011432-55011454 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
925544302 2:5001784-5001806 AGCAAGTCCCACTTTTCTAGAGG + Intergenic
925829028 2:7877395-7877417 AGCAAGTCCCGCTTTCCTAGGGG - Intergenic
925829078 2:7877587-7877609 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
925829113 2:7877715-7877737 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
925829131 2:7877779-7877801 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
926407544 2:12570686-12570708 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
926413394 2:12627474-12627496 GGCAAGTTCCACTTTTCTAGAGG + Intergenic
926464279 2:13168663-13168685 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
926464312 2:13168788-13168810 AGCAAGTCCCGCTTTTGTGGGGG - Intergenic
926815744 2:16796624-16796646 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
927080389 2:19622954-19622976 AGCAATTCCTGCTTTTCTTTTGG - Intergenic
927094795 2:19739391-19739413 AGCAACTCCTCCTCTTCTAGTGG - Intergenic
927154044 2:20211727-20211749 GCCTGGTCCTGCTTTTCCAGGGG + Intronic
928778087 2:34790681-34790703 GGTAAGTACCACTTTTCTAGGGG + Intergenic
928778116 2:34790800-34790822 AGCAAGTACCGCTTTTCTGGGGG + Intergenic
928779901 2:34805720-34805742 GGCAAGTACCACTTTTCTAAGGG - Intergenic
928779929 2:34805839-34805861 AGCAAGTACTGCTTTTCTAGGGG - Intergenic
928827828 2:35441717-35441739 GGCATGTCCTGCTTTTCTGGGGG - Intergenic
929076894 2:38085531-38085553 GGCAAGTCCTGCTTTTCTAGAGG - Intronic
929793281 2:45039162-45039184 GACAAGCCCCACTTTTCTAGGGG - Intergenic
929793312 2:45039287-45039309 GGCAAGTCCTGCTTTTCTGGAGG - Intergenic
929978395 2:46656495-46656517 GGAAAGTCCAGCTTGTCTGGTGG - Intergenic
930422683 2:51174507-51174529 GGAAATTCCTGCTTTCTTAGAGG + Intergenic
930954919 2:57194076-57194098 GGCAAGTCCTGCTTTGCTAGGGG + Intergenic
930958191 2:57229917-57229939 GGCAAGTACCGCTTTTCTGGGGG + Intergenic
930958217 2:57230033-57230055 GGCAAGTACCACTTTTCTGGGGG + Intergenic
931026575 2:58118035-58118057 AGCAAGTCCCACTTTTCTAGGGG - Intronic
931026592 2:58118099-58118121 GGCAAGTCCCACTTTTCTGGGGG - Intronic
931042460 2:58315010-58315032 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
931042492 2:58315132-58315154 GGCAACTCCCGCTTTTCTAGAGG + Intergenic
931236749 2:60418669-60418691 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
931625574 2:64253532-64253554 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
931850232 2:66244977-66244999 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
931948011 2:67332369-67332391 GGCAAGTGCCGCTTTTCTAGAGG + Intergenic
931948038 2:67332494-67332516 GGCAAGTCCAGCTTTTCTAGCGG + Intergenic
932159687 2:69448447-69448469 GGCAAGCACTGCTTTTCTGGGGG - Intergenic
932295590 2:70621351-70621373 GGCAAGTCCTGCTTTTCTGGGGG + Intronic
932295619 2:70621472-70621494 GGCAAGTCCCGCTTTTCTAGGGG + Intronic
932295650 2:70621594-70621616 AGCAAGTCCTGCTTTTCTAGGGG + Intronic
932359019 2:71089767-71089789 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
932367836 2:71164372-71164394 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
932854401 2:75218469-75218491 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
932974167 2:76578643-76578665 GGCAAGTCCCGCTTTTCTACGGG - Intergenic
933012876 2:77089310-77089332 ACCAAGTCCCACTTTTCTAGAGG + Intronic
933079043 2:77966022-77966044 GGCAAGTCCCGCTTTCCTGGGGG + Intergenic
933079080 2:77966150-77966172 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
933163542 2:79052362-79052384 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
933180008 2:79216717-79216739 TGCAAGTACCGCTTTTCTAGGGG - Intronic
933180038 2:79216832-79216854 GGCAAGTACTGCAGTTCTGGGGG - Intronic
933329708 2:80879133-80879155 GGCAAGTCCCACTTTCCTAGGGG - Intergenic
933552589 2:83793596-83793618 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
935091987 2:99904333-99904355 GGCAAATCCTTCATTTCTAACGG + Intronic
936175745 2:110218784-110218806 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
936175790 2:110218974-110218996 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
936876047 2:117190843-117190865 GTGAAGTGCTGCTTATCTAGTGG + Intergenic
936883151 2:117279784-117279806 GGCAAGTCCCACTTTCCTAGGGG + Intergenic
937361343 2:121231983-121232005 AGCAAGTGCTGCTTTCCAAGTGG + Intronic
939083341 2:137687657-137687679 GGCAAGTTCCACTTTTCTAGGGG - Intergenic
939083373 2:137687781-137687803 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
940107150 2:150113621-150113643 GGCAAGTACCTCTTTTCTAGGGG + Intergenic
940337319 2:152543114-152543136 TGCAAAGCCTGCTCTTCTAGGGG - Intronic
940529990 2:154868300-154868322 GGCAAGTCCAACTTTTCTGGGGG + Intergenic
940676015 2:156724844-156724866 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
940676045 2:156724965-156724987 AGCAAGTCCTGCTTTTCTGAAGG - Intergenic
941340200 2:164296831-164296853 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
941340216 2:164296895-164296917 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
941353197 2:164460159-164460181 GGCAAGTCCCGCTATCCTAGGGG + Intergenic
941456388 2:165715178-165715200 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
941936100 2:170982386-170982408 AGCAAGTCCCACTTTTCTAAGGG - Intergenic
941936130 2:170982511-170982533 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
942096861 2:172542655-172542677 AGCAAGTACCGCTTTTCTGGGGG + Intergenic
942096893 2:172542774-172542796 AGCAAGTACCACTTTTCTAGGGG + Intergenic
942096906 2:172542834-172542856 GGCAAGTACTGCTTTTCTAGGGG + Intergenic
942114836 2:172718004-172718026 GGAATGTCCTGCTTTTCCTGGGG + Intergenic
942516460 2:176758378-176758400 AGCAATTCCTGCCTTTCTTGTGG - Intergenic
942730485 2:179056447-179056469 AACAAGTCCCGCTTTTCTGGAGG - Intergenic
943421789 2:187675223-187675245 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
943449963 2:188034367-188034389 GGCAAATGCCGCTTTTCTGGGGG + Intergenic
943461374 2:188173810-188173832 GGCAAGTACCGCTTTTCTGAGGG - Intergenic
943806436 2:192131399-192131421 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
943806453 2:192131463-192131485 GGCAAGTCCCACTTTTCTAGGGG + Intronic
943834923 2:192506933-192506955 AGCAAGTCCCGCTTTTCTGCGGG + Intergenic
943834955 2:192507054-192507076 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
943865180 2:192919172-192919194 GGCAAGTACTGCTTTTCTGGGGG + Intergenic
944387212 2:199180268-199180290 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
944387247 2:199180389-199180411 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
944393932 2:199247926-199247948 GGCAAGTCCTGCTTTTCTATGGG + Intergenic
944876333 2:203966685-203966707 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
944876366 2:203966802-203966824 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
945153315 2:206811594-206811616 GGCAAGTCCCGCTTTTCTACAGG - Intergenic
945173215 2:207018070-207018092 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
945173247 2:207018195-207018217 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
945301681 2:208220944-208220966 AGCAAGTCCTGCTTTTCTGGGGG - Intergenic
945301715 2:208221065-208221087 GTCAAGTCCCGCTTTTCTAGGGG - Intergenic
945361445 2:208900205-208900227 GGCACGTACTGCTTTTCTGGGGG + Intergenic
945375898 2:209079046-209079068 GGCAAATCCCGCTTTTCTGGGGG + Intergenic
945394124 2:209300308-209300330 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
945683349 2:212939243-212939265 AGCGAGTACTGCTTTTCTAAGGG - Intergenic
945938098 2:215923329-215923351 GGCAAGTCCCGCTTTTCTATGGG + Intergenic
946167393 2:217873356-217873378 GGCAGGTCCCACCTTTCTAGAGG + Intronic
946215207 2:218178607-218178629 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
946215237 2:218178732-218178754 GGCAAGTCCTGCTTTTCTGGAGG - Intergenic
946215302 2:218178982-218179004 AGCAAGTCCCACTTTTCTGGGGG - Intergenic
946781231 2:223194517-223194539 GGCAAGTCCTGCTTTTCTGAGGG - Intronic
946781264 2:223194642-223194664 AGCAAGTCCCGCTTTTCTGGGGG - Intronic
946886302 2:224226304-224226326 GGCAAGTCCCACTTTTCTGGTGG + Intergenic
946893028 2:224297496-224297518 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
946893060 2:224297617-224297639 AGCAAGTCTCACTTTTCTAGGGG + Intergenic
948390405 2:237607639-237607661 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
948390443 2:237607760-237607782 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
948774588 2:240277309-240277331 GGCAAGTCCTGCTGTTATGCTGG + Intergenic
1169313939 20:4572314-4572336 GCCAAGTCCCTCTTTCCTAGTGG - Intergenic
1170069064 20:12344973-12344995 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1170069080 20:12345037-12345059 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1170106031 20:12754884-12754906 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1170165704 20:13359027-13359049 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1170325686 20:15152552-15152574 GGCAAGTCCCACTTTTCTAGGGG - Intronic
1170325719 20:15152675-15152697 GGCAAGTCCCACTTTTCTGGGGG - Intronic
1170820887 20:19755753-19755775 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1171212351 20:23326761-23326783 GCCAAGTCCTGGGTTTCCAGTGG - Intergenic
1171253780 20:23670582-23670604 AGGAAGTCCAGCTTCTCTAGAGG - Intergenic
1172951116 20:38724129-38724151 GCGAAGTGCTGCATTTCTAGGGG - Intergenic
1173101674 20:40094109-40094131 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1173118675 20:40270079-40270101 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1173118693 20:40270143-40270165 GGCAAGTCCCGTGTTTCTAGGGG + Intergenic
1173781439 20:45760326-45760348 GGCAAGTCCTGCTTTTCTAGGGG + Intronic
1173853768 20:46236360-46236382 GGGAAGTCCTGTCTTTCTGGAGG - Intronic
1174283567 20:49456447-49456469 GGCAAGTCCTTCTTTACCTGAGG - Intronic
1177100396 21:16893066-16893088 GGCAAGTCCTGTTTTTCTGGGGG + Intergenic
1177119333 21:17122346-17122368 GGCAAGTACCGCTTTTCTGGGGG + Intergenic
1177184601 21:17779834-17779856 GGCATGTGTTGCTTTTATAGGGG - Intergenic
1178371838 21:32033053-32033075 AGCAAGGGCTGCTTTTCTGGGGG + Intronic
1178976438 21:37225015-37225037 GGGAAGTCATGCATTTCCAGTGG + Exonic
1179015471 21:37591632-37591654 GGCAAGTACCGCCTTTCTGGGGG - Intergenic
1179387320 21:40955785-40955807 GGCAAGTCCCGCTTTTCTATGGG + Intergenic
1179650551 21:42805660-42805682 GGCAAGTACTGCTTTTCTGGGGG - Intergenic
1180560730 22:16612420-16612442 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1182113733 22:27742950-27742972 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1182113753 22:27743016-27743038 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
1182732072 22:32503748-32503770 TGCTAGTCCCGCTTTCCTAGGGG + Intergenic
1183343023 22:37292519-37292541 GGCAAGTCCTGGGTTTCCGGAGG + Intronic
949162304 3:895409-895431 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
949162332 3:895530-895552 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
949670914 3:6398492-6398514 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG + Intergenic
949827203 3:8177875-8177897 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
950926286 3:16745255-16745277 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
952343745 3:32466040-32466062 GGCAAGTCCCACTTTCCTGGAGG - Intronic
952663654 3:35879066-35879088 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
952663688 3:35879191-35879213 AGTAAGTCCTGCTTTTCTGGGGG - Intergenic
952895478 3:38075771-38075793 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
952895509 3:38075896-38075918 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
952896723 3:38082601-38082623 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
952896774 3:38082783-38082805 GGCAAGTCCCGCTTTTCTGGGGG - Intronic
953077356 3:39582622-39582644 AGCAAGTCCCGCTTTTCTAGAGG - Intergenic
953176936 3:40561749-40561771 GGCAAGTCCCGCTTTTCTGTGGG + Intronic
953176970 3:40561870-40561892 AGCAAGTCCTGCTTTTCTAGGGG + Intronic
953825911 3:46251007-46251029 GGCAAGTCCCACTTTTCTAGGGG - Intronic
954969458 3:54639164-54639186 AGCAAGTCCCGCTTTCCTAGGGG - Intronic
955253168 3:57304718-57304740 AGCAAGTACCGCTTTTCTGGAGG + Intronic
955547999 3:60052159-60052181 GGCCACTCTTGCTTCTCTAGGGG + Intronic
956549164 3:70439528-70439550 GGCAAGTACTGCTTTTCTGGAGG - Intergenic
956709013 3:72023987-72024009 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
957060099 3:75474793-75474815 AGCAAGTCCTGTTTTTCTGGGGG - Intergenic
957060117 3:75474858-75474880 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
957294998 3:78324672-78324694 TGCAAGTCCTGCTTTTCTAGAGG + Intergenic
957317521 3:78587880-78587902 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
958182035 3:90072416-90072438 GGCACGTCCTGCTTTTCTGGGGG - Intergenic
958731343 3:97963615-97963637 GAGAAGCCCTGGTTTTCTAGTGG - Intronic
959288566 3:104444755-104444777 GGCAAGTCCCGCTTTTCTATGGG - Intergenic
959485961 3:106927382-106927404 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
959485992 3:106927507-106927529 GGCAAGTCCCGCTTTTCTGGAGG - Intergenic
959972468 3:112422313-112422335 GGCAAGTCCTGCTTTCCTAGGGG - Intergenic
960283064 3:115798116-115798138 GGCAAGTCCCGCTTTTCTACAGG - Intergenic
960310336 3:116110078-116110100 AGCAAGTCCCACTTTTCTAGGGG - Intronic
960314710 3:116162343-116162365 GGCCAGAACTGGTTTTCTAGGGG - Intronic
961164960 3:124757218-124757240 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
961293268 3:125864548-125864570 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
961293286 3:125864613-125864635 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
961711799 3:128833786-128833808 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
961711864 3:128834033-128834055 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
961730413 3:128960891-128960913 GGCAAGTCCCGCTTTTCTAGGGG + Intronic
961880783 3:130060000-130060022 GGCAAGTCCCGCTTTTCTGAGGG + Intergenic
961880818 3:130060125-130060147 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
961880852 3:130060246-130060268 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
961893914 3:130151864-130151886 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
962660439 3:137596504-137596526 GGCAAGTCCCTCTTTTCTGGGGG + Intergenic
963058361 3:141205762-141205784 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
963058395 3:141205883-141205905 GGCAAGTACCGCTTTTCTAGGGG + Intergenic
963424999 3:145113928-145113950 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
963425032 3:145114053-145114075 GACAAGTCCCACTTTTCTAGGGG + Intergenic
963456877 3:145555915-145555937 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
963468394 3:145711297-145711319 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
963468425 3:145711422-145711444 GGCAAGTCCTGCTTTTCTGGTGG + Intergenic
963521426 3:146363071-146363093 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
963663103 3:148152521-148152543 GGCAAGTCCCACTTTCCTAGAGG + Intergenic
963684107 3:148415262-148415284 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
963684120 3:148415326-148415348 AGCAAGTCCCGCTTTTCTAGAGG + Intergenic
964067584 3:152597875-152597897 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
964067610 3:152597992-152598014 GGCAAGTCCCGCTTTTCTAAGGG + Intergenic
964125721 3:153231638-153231660 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
964260255 3:154827449-154827471 GTAAAGTCCTGCTTTTGGAGAGG + Intergenic
964300459 3:155279920-155279942 GGCAAGTACCACTTTTCTGGGGG - Intergenic
964906729 3:161726653-161726675 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
964906764 3:161726774-161726796 GGCAAGTCCGGCTTTTCTAGGGG - Intergenic
964906801 3:161726894-161726916 AGCAAGTCCCACTTTTCTGGGGG - Intergenic
964983434 3:162713360-162713382 GGCAAGTACTGCTTTTCTGGGGG + Intergenic
965070095 3:163908390-163908412 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
965105427 3:164346841-164346863 GGCAAGTCCCGCTTTTCTAGTGG - Intergenic
965105454 3:164346966-164346988 GGCAAGTCCTGCTTTTCTGGAGG - Intergenic
965262849 3:166505479-166505501 GGCAAGTCCCGCTTTTCTGGAGG - Intergenic
965262861 3:166505543-166505565 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
965286913 3:166828697-166828719 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
965286944 3:166828822-166828844 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
965336118 3:167432140-167432162 GGCAAGTCCTGCTTTTCTGGAGG + Intergenic
965336134 3:167432204-167432226 GGCAAGTACCGCTTTTCTGGGGG + Intergenic
965625088 3:170677265-170677287 GGCAAGTCCTGCTTTTCTGGGGG - Intronic
965626553 3:170688209-170688231 GGCAAGTCCTGCTTTTCTAGGGG - Intronic
965626584 3:170688330-170688352 GGCAAGTCCTGCTTTTCTGGGGG - Intronic
965640260 3:170822770-170822792 GGCAAGTCCCGCTTTTCTGGTGG - Intronic
965640293 3:170822891-170822913 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
965713200 3:171577418-171577440 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
965862182 3:173160651-173160673 GGCAAGTACTGCTTTTCGGAGGG - Intergenic
966066564 3:175828388-175828410 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
966066597 3:175828509-175828531 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
966085210 3:176062202-176062224 GGTAAGTCCTGCTTTTCTGGGGG + Intergenic
966085239 3:176062327-176062349 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
966105267 3:176326249-176326271 AGCAAGTTCCGCTTTTCTAGGGG - Intergenic
966105283 3:176326313-176326335 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
966233020 3:177670437-177670459 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
966278955 3:178208042-178208064 GGCAAGTACTGCTTTTTTGGGGG + Intergenic
966278989 3:178208161-178208183 GGCAAGTACTGCTTTTCTGGGGG + Intergenic
966279055 3:178208394-178208416 GGCAAGTACCACTTTTCTGGGGG + Intergenic
966279089 3:178208513-178208535 GGCAAGCACTGCTTTTCTGGGGG + Intergenic
966279119 3:178208631-178208653 AGCAAGTACCACTTTTCTAGGGG + Intergenic
966397478 3:179517934-179517956 GGCAAGTACCGCTTTTCTGGGGG + Intergenic
967151888 3:186658625-186658647 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
967212368 3:187180223-187180245 AGCAAGTCCCGCCTTTCTAGGGG - Intronic
967244372 3:187471007-187471029 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
967496003 3:190145441-190145463 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
967496027 3:190145562-190145584 AGCAAGTCCCGCTTTTCTAGAGG + Intergenic
967561204 3:190921188-190921210 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
967624880 3:191671327-191671349 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
967644029 3:191900105-191900127 AGCAAGTCCCGCTTTTCTAGGGG - Intergenic
967644063 3:191900226-191900248 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
967658325 3:192075860-192075882 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
967740250 3:192996510-192996532 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
967740283 3:192996635-192996657 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
967890145 3:194359118-194359140 GGCACGACCTGCTTCTCTACGGG + Exonic
968993168 4:3928290-3928312 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
969004021 4:4005019-4005041 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
969339731 4:6532539-6532561 GGCAAATCCCGCTTTTCTAGTGG - Intronic
969654341 4:8487660-8487682 GGTAAGTCCCGCTTTTCTAGGGG - Intronic
969654370 4:8487785-8487807 GGCAAGTCCTGCTTTTCTGGGGG - Intronic
969748846 4:9095204-9095226 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
969809897 4:9639782-9639804 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
969809915 4:9639847-9639869 AGCAAGTCCCGCTTTTCTGGGGG + Intergenic
970029418 4:11658400-11658422 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
970041881 4:11807198-11807220 GGCAAGTCCTGCTTTTCTGGAGG + Intergenic
970041909 4:11807323-11807345 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
970087368 4:12364780-12364802 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
970256628 4:14175252-14175274 GGCAAGTCCCGCTTTTCTGAGGG - Intergenic
970276559 4:14407186-14407208 TGCATGTCCTGCTTCTATAGTGG + Intergenic
970532522 4:16998641-16998663 GGCAAGTCCCGCTTTTCTTGGGG + Intergenic
970854280 4:20635092-20635114 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
971123381 4:23726704-23726726 GGCAAGTCCCGCTTCCCTAGGGG - Intergenic
971180366 4:24324295-24324317 GGCAAGTCCCGCTTCCCTAGGGG + Intergenic
971199973 4:24502188-24502210 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
974428599 4:61769003-61769025 GGCAAGTCCCGCTTTCCTAGGGG - Intronic
975934106 4:79558733-79558755 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
976558392 4:86475679-86475701 GGCAAGTACTGCTTTTCTGGGGG + Intronic
976558405 4:86475736-86475758 GGCAAGTACCGCTTTTCTAGGGG + Intronic
976696327 4:87922818-87922840 AGCAAGTCCCGCTTTTCTGGCGG + Intergenic
976884774 4:89969482-89969504 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
977010110 4:91625075-91625097 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
977013156 4:91659464-91659486 AGCAAGTCCTGCTTTTCTACAGG - Intergenic
977041854 4:92027005-92027027 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
977062797 4:92276608-92276630 GGCAAGTCCCGCTTTTCTACGGG - Intergenic
977075398 4:92443615-92443637 GGCAAGTCCCGCTTTTCTAGAGG - Intronic
977198623 4:94089296-94089318 GGCAAGTCCTGCTTTCCTAGGGG - Intergenic
977217309 4:94297737-94297759 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
977225594 4:94388387-94388409 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
979054807 4:115980286-115980308 CGCAAGTCCTACATTTCTAGAGG - Intergenic
979146418 4:117253081-117253103 AGCAAGTCCCACTTTCCTAGGGG + Intergenic
979379685 4:119994750-119994772 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
979850526 4:125566418-125566440 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
979895354 4:126149808-126149830 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
979895371 4:126149872-126149894 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
980003546 4:127516160-127516182 AGCAAGTACCACTTTTCTAGGGG - Intergenic
980003577 4:127516278-127516300 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
980112144 4:128645605-128645627 GGCAAGTACTGCTTTTCTAGGGG - Intergenic
980284734 4:130768265-130768287 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
980284762 4:130768390-130768412 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
980527656 4:134013074-134013096 AGCAAGTCCTGCTTTTCTTGGGG + Intergenic
980527686 4:134013199-134013221 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
980575829 4:134682561-134682583 GACAAGTCCCGCTTTTCTGGGGG - Intergenic
980611973 4:135172027-135172049 GGCAAGTCCCGCTCTTCTGGGGG - Intergenic
980903713 4:138928801-138928823 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
981040043 4:140214543-140214565 GGCAAGTCCTGCTTTTCTTGGGG + Intergenic
981040076 4:140214668-140214690 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
981524948 4:145699911-145699933 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
981524964 4:145699975-145699997 GGCAAGTCCCTCTTTTCTATGGG + Intronic
981539489 4:145833588-145833610 GGCAAGTCCCGCTTTTCTACGGG + Intronic
982084144 4:151817234-151817256 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
982084177 4:151817355-151817377 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
982396919 4:154923561-154923583 GGCAAGTACCACTTTTCTAGGGG - Intergenic
982396950 4:154923679-154923701 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
982414395 4:155113190-155113212 GACAAGTCTCGCTTTTCTAGGGG - Intergenic
982414427 4:155113311-155113333 GGCAAGTCCCGCTTTCCTGGGGG - Intergenic
982497339 4:156108310-156108332 GGCAAGTCCTGCTTTTCCAGAGG - Intergenic
982535236 4:156601274-156601296 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
983055320 4:163094264-163094286 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
983360179 4:166717149-166717171 GGCAAGTCCCACTTTTCTATGGG + Intergenic
983447838 4:167877164-167877186 ATCAAGTCCCGCTTTTCTGGGGG + Intergenic
983659353 4:170117292-170117314 GGCAAGCCCTGCTTTTCTGGGGG + Intergenic
983707483 4:170678499-170678521 GGTAAGTCCCGCTTTTCTAGGGG + Intergenic
983884065 4:172961424-172961446 AGCAAGTACCGCTTTTCTGGGGG - Intronic
984099265 4:175466206-175466228 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
984321946 4:178207986-178208008 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
984393795 4:179169519-179169541 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
984437043 4:179721388-179721410 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
984700459 4:182815503-182815525 GGCAAGTCCCGCTCTCCTAGGGG + Intergenic
985390099 4:189484305-189484327 GGCAAGTCCTGCTTTTCTACTGG - Intergenic
985435505 4:189926747-189926769 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
985435539 4:189926872-189926894 GGCAAGTTCTGCTTTTCTGGAGG + Intergenic
985470290 5:37963-37985 GGAATGTCCTGCTATTCTGGAGG - Intergenic
985582079 5:703539-703561 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
985582142 5:703786-703808 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
985582158 5:703850-703872 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
985662231 5:1162974-1162996 GGCAACTTCTGCTTTTCTTGAGG + Intergenic
986555772 5:9008672-9008694 AGCAAGTCCCACTTTTCTAGGGG - Intergenic
986555807 5:9008797-9008819 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
986555898 5:9009369-9009391 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
986555930 5:9009494-9009516 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
986905588 5:12490896-12490918 AGCAAGTCCCGCTTTCCTAGGGG + Intergenic
986919802 5:12667298-12667320 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
987281797 5:16420828-16420850 AGCAAATCCCGCTTTTCTGGGGG + Intergenic
987281830 5:16420953-16420975 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
987498316 5:18673488-18673510 GTCAAGTCCCACTTTCCTAGGGG - Intergenic
987755581 5:22095631-22095653 GGCAAGTACTGCTTTTCTAGGGG + Intronic
992394441 5:76358269-76358291 GGCAAGTCCCGCTTTTCTACGGG + Intergenic
992960590 5:81954085-81954107 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
993192491 5:84699379-84699401 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
993192507 5:84699443-84699465 GGCAAGTCCCGCTTTTCTGAGGG + Intergenic
993192522 5:84699507-84699529 GGCAAGTCCCGCTTTCCTAGTGG + Intergenic
993322241 5:86486182-86486204 GGCATATCCTGATTTTCTAAAGG + Intergenic
993836421 5:92824627-92824649 AGCAAGTCCCGCTTTTCTGGGGG + Intergenic
993836484 5:92824877-92824899 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
993836514 5:92825001-92825023 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
994294954 5:98080098-98080120 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
994294971 5:98080162-98080184 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
994532721 5:100988883-100988905 AGCAAGTCCCGCTTTTCTAGGGG - Intergenic
994532735 5:100988947-100988969 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
994532799 5:100989194-100989216 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
994532835 5:100989319-100989341 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
994556723 5:101315881-101315903 GGCAAGTCCCGCTTTTCTGGAGG + Intergenic
994775501 5:104032682-104032704 GGCAAGTCCTACTTTTCTGGGGG + Intergenic
994989338 5:106979374-106979396 AGCAAGTCCCGCTTTTCTAGAGG + Intergenic
995125484 5:108573790-108573812 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
995201563 5:109430424-109430446 GGCACCTTCTGCATTTCTAGTGG - Intergenic
995899610 5:117051239-117051261 GGCAAGTCCCGCTTTTCTGGAGG - Intergenic
996203478 5:120702371-120702393 GGCAAGTCCCACTTTTCTACAGG - Intergenic
996345011 5:122478258-122478280 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
996358795 5:122623446-122623468 GGCAACTACCGCTTTTCTGGAGG - Intergenic
996509675 5:124304625-124304647 GGCAAGTACCGCTTTTCTAGGGG + Intergenic
996527825 5:124497898-124497920 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
996745734 5:126844659-126844681 GGCAAGTCCCGCTTTTCTACGGG - Intergenic
997253191 5:132407184-132407206 GGTAGGTTGTGCTTTTCTAGAGG + Intergenic
997263907 5:132483904-132483926 GCCAGGTCCTGCTTGCCTAGAGG + Exonic
997746188 5:136302282-136302304 GGCAAGTCCCACTTTTCTGGGGG + Intronic
997746207 5:136302343-136302365 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
997746223 5:136302404-136302426 GGCAAGTCCCGCTTTTCTAGGGG + Intronic
997769878 5:136544362-136544384 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
997772878 5:136570207-136570229 GGCAAGTCCCACTTTTCTATGGG - Intergenic
997788742 5:136737884-136737906 GGCAAGTACCGCTTTTCTGGGGG + Intergenic
998460347 5:142305271-142305293 GGCCACTCCTGCTCTTCCAGGGG - Intergenic
998564580 5:143205608-143205630 GGCAAGTCCTGCTATGTCAGAGG + Intronic
998996581 5:147873538-147873560 GGCAAGTCCCAGTTTCCTAGGGG - Intronic
999277075 5:150338614-150338636 GCCAAGTCTTGCTGTGCTAGAGG - Intronic
999619094 5:153454502-153454524 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1000439471 5:161249274-161249296 AGCAAGTCCTGCTTTTCTGAGGG + Intergenic
1000519625 5:162280153-162280175 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1000935893 5:167302794-167302816 GGCAAGTCCCGCTTTTCTGGGGG - Intronic
1001331693 5:170766872-170766894 GGCAAGTCCCGCTTTTCTAGAGG - Intronic
1002611163 5:180419414-180419436 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1003430358 6:6032469-6032491 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1003430394 6:6032597-6032619 GGCAAGTCCCGCTATTCTGGGGG - Intergenic
1004106066 6:12668397-12668419 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1004283764 6:14301794-14301816 GGCAAGTCCCGCTTTTCTATGGG - Intergenic
1004508236 6:16263895-16263917 GGCAAGTCCCACTTTTCTAGAGG - Intronic
1004575023 6:16886953-16886975 GGCAAGTCCCACTTTTCTAGAGG + Intergenic
1004768806 6:18758893-18758915 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1004836801 6:19539890-19539912 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1005014873 6:21366227-21366249 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1008476309 6:51939130-51939152 AGCAAGTACTGCTTTTCTGGGGG + Intronic
1008476346 6:51939251-51939273 GGCAAGTACCGCTTTTCTGGGGG + Intronic
1008850394 6:56015433-56015455 GGCAAGTACCACTTTTCTAAGGG - Intergenic
1008850426 6:56015552-56015574 GGCAAGTACCGCTTTTCTAGGGG - Intergenic
1008850456 6:56015673-56015695 GGCAAGTACTGCTTTTCTGGGGG - Intergenic
1008850488 6:56015792-56015814 AGCAAGTACTGCTTTTCTGGGGG - Intergenic
1008850521 6:56015912-56015934 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
1009343380 6:62586834-62586856 GGCAAGTCCTGCTTTTCTGTGGG + Intergenic
1009343411 6:62586955-62586977 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1009359182 6:62792595-62792617 GGCAAGTACCACTTTTCTAGGGG + Intergenic
1009598545 6:65767948-65767970 GGCTAGTCCCACTTGTCTAGGGG - Intergenic
1010586910 6:77665286-77665308 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1010586927 6:77665350-77665372 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1010625788 6:78135071-78135093 GTCCAGTCCTGCGTTCCTAGAGG - Intergenic
1010827112 6:80487107-80487129 GGCAAGTCCCGCTTCCCTAGGGG - Intergenic
1010846424 6:80714302-80714324 GACAGGTCCAGCTTTTCCAGGGG + Intergenic
1010894804 6:81350139-81350161 GGCAAGTCCCACTTTTCTATGGG - Intergenic
1011368082 6:86602960-86602982 GGCAAGTACCACTTTTCTGGGGG - Intergenic
1011368097 6:86603019-86603041 GGCAAGTACTGCTTTTCTGGGGG - Intergenic
1012014590 6:93834772-93834794 AGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1012066729 6:94558576-94558598 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1012315598 6:97780526-97780548 GGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1012674908 6:102102975-102102997 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1012689302 6:102293614-102293636 AGCAAGTCTCGCTTTTCTGGGGG + Intergenic
1012689353 6:102293806-102293828 GGCAAGTCCTGCTTTCTACGGGG + Intergenic
1013408107 6:109860571-109860593 GGCAAGTCCTGCTTTTCTAGAGG - Intergenic
1013408139 6:109860692-109860714 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1013843949 6:114427335-114427357 GGCAAGTCCCGCTTTTCTACGGG - Intergenic
1013891492 6:115032874-115032896 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1014360389 6:120467093-120467115 AGCAAGTCCCACTTTTCTACGGG - Intergenic
1014395795 6:120925807-120925829 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1014455074 6:121625135-121625157 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1014455091 6:121625199-121625221 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1014555637 6:122840834-122840856 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1014614876 6:123587020-123587042 AGCAAGTCCCGCTTTTCTAGAGG - Intronic
1014718408 6:124891417-124891439 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1014718424 6:124891481-124891503 GGCAAGTCCCTCTTTTCTAGGGG + Intergenic
1014794205 6:125706600-125706622 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1014891333 6:126849728-126849750 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1014891352 6:126849791-126849813 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1015165006 6:130193285-130193307 AGCAAGTCCCACTTTTCTGGGGG + Intronic
1015266544 6:131296495-131296517 GGCAAATCCCACTTTCCTAGGGG + Intergenic
1015269441 6:131324325-131324347 AGCAAGTCCCGCTTTTCCAGAGG + Intergenic
1015271189 6:131339956-131339978 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1015277939 6:131403811-131403833 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1015277975 6:131403935-131403957 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1015323621 6:131902633-131902655 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1015676537 6:135756245-135756267 GGCAAGTCAGGGTTCTCTAGCGG - Intergenic
1015801627 6:137066233-137066255 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1016114369 6:140262194-140262216 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
1016204308 6:141453675-141453697 AGCAAGTTCCACTTTTCTAGGGG + Intergenic
1016248621 6:142016685-142016707 GGCAAGTCCCACTTTTCTACAGG + Intergenic
1016518573 6:144924060-144924082 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1016518606 6:144924185-144924207 GGCAAGTCCCTCTTCTCTGGGGG + Intergenic
1016535950 6:145107873-145107895 GGCAAGTCCCACTTTTCTGGAGG - Intergenic
1016535981 6:145107994-145108016 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1016600086 6:145848599-145848621 GGCAAGTCCTGTGCTTCTATAGG + Intergenic
1016650492 6:146455129-146455151 AGCAAGTCCCACTTTTCTAACGG - Intergenic
1016853028 6:148640622-148640644 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1016853057 6:148640740-148640762 AGCAAGTCCCGCTTTTCTGGAGG + Intergenic
1017779527 6:157705369-157705391 AGCAAGTCCCACTTTTCTAGGGG - Intronic
1017779559 6:157705490-157705512 GGCAAGTCCCATTTTTCTAGGGG - Intronic
1017779589 6:157705611-157705633 GGCAAGTCCCACTTTTCTGGGGG - Intronic
1017929425 6:158939229-158939251 AGCACGTCCTGCTTTTCTCCTGG + Intergenic
1018084711 6:160291315-160291337 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1018084745 6:160291436-160291458 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1018495670 6:164343775-164343797 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1018521691 6:164656936-164656958 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1020315804 7:6904637-6904659 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1020315836 7:6904762-6904784 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1020324147 7:6961436-6961458 AGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1020532943 7:9358228-9358250 GGCATGTCCCACTTTTCTAGAGG - Intergenic
1020541338 7:9463269-9463291 GGCAAGTCTCACTTTTCTGGGGG - Intergenic
1021637095 7:22704237-22704259 AGCAAGTACCGCTTTTCTGGGGG + Intergenic
1021637112 7:22704297-22704319 GGCAAGTGCCGCTTTTCTAGGGG + Intergenic
1021810457 7:24397275-24397297 AGCAAGTCCCGCTTTTCTACGGG + Intergenic
1021978048 7:26028708-26028730 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1022372662 7:29785843-29785865 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1022372694 7:29785968-29785990 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1022710211 7:32842439-32842461 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1022854906 7:34304526-34304548 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1022854939 7:34304658-34304680 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1023699095 7:42875320-42875342 GGCAAGTCCCGCTTTTCTATGGG - Intergenic
1024697431 7:51871040-51871062 GGCAAGTCCCACTTTCCTAGGGG + Intergenic
1026385549 7:69843936-69843958 GGACAGTTCTGCTTTTCAAGTGG + Intronic
1028689950 7:93640797-93640819 AGCAAGTCCTACTTTTCTGTGGG + Intronic
1028689984 7:93640918-93640940 AGCAAGTCCCGCTTTTCTAGGGG + Intronic
1029500008 7:100923121-100923143 GGAAAGTACCGCTTTTCTGGGGG + Intergenic
1030441883 7:109596712-109596734 GGCAAGTCCCACTTTTCTGCGGG - Intergenic
1030751668 7:113238114-113238136 GGCAAGTCCCTCTTTTCTAGGGG - Intergenic
1031004463 7:116456516-116456538 GGCAAGTCCCGCTTTTCTGGGGG + Intronic
1031004481 7:116456580-116456602 GGCAAGTCCCACTTTTCTAGGGG + Intronic
1031355413 7:120781893-120781915 GGCAAGTACTGCTTTTCTAGGGG - Intergenic
1031355444 7:120782012-120782034 GGCAAGTACCGCTTTTCTGTGGG - Intergenic
1031364945 7:120890386-120890408 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1031364980 7:120890507-120890529 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1031399824 7:121316745-121316767 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1031422652 7:121568671-121568693 AGCAAGTCCCGCTTTTCTGGAGG - Intergenic
1031422678 7:121568794-121568816 AGCAAGTCCTGCTTTTCTGGAGG - Intergenic
1031525343 7:122817747-122817769 GGCAAGTCCTGCTTTTCTAGAGG + Intronic
1031728128 7:125263590-125263612 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1031776096 7:125910854-125910876 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1031776110 7:125910916-125910938 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1031777127 7:125918549-125918571 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1033211317 7:139462293-139462315 AGCAAGCACTGCTTTTCTTGGGG + Intronic
1033676159 7:143541918-143541940 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1033695674 7:143787521-143787543 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1033909692 7:146248226-146248248 GGCAAGTCCTGCTTTTCTAGAGG - Intronic
1034085000 7:148314611-148314633 GGCAAGTACCGCTTTTCTAGGGG - Intronic
1034085031 7:148314730-148314752 GGCAAGTACCGCTTTTCTGGAGG - Intronic
1036071114 8:5441303-5441325 GGCAAGTACCGCTTTTCTAGGGG - Intergenic
1036071147 8:5441422-5441444 GGCAAGTACCGCTTTTCTGGGGG - Intergenic
1036281258 8:7403307-7403329 GGCAAGTCCCGCTTTTCTATGGG + Intergenic
1036340208 8:7908265-7908287 GGCAAGTCCCGCTTTTCTATGGG - Intergenic
1036371917 8:8169529-8169551 AGCAAGACCTGCTTTTCTGGGGG + Intergenic
1036472553 8:9064194-9064216 GGCAAGTATCGCTTCTCTAGGGG - Intronic
1036639220 8:10571966-10571988 AGCAAGTCCCACTTTTCTAGGGG + Intergenic
1036639258 8:10572095-10572117 GGCAAATCCCACTTTTCTAGGGG + Intergenic
1036878987 8:12496114-12496136 AGCAAGACCTGCTTTTCTGGGGG - Intergenic
1037712611 8:21367370-21367392 GCCAAGTTCAGCTTTTCTATAGG + Intergenic
1040288390 8:46111949-46111971 GGGAAGGCCTGCGTTTCTCGTGG - Intergenic
1041764499 8:61404159-61404181 GGCAAGGGATGCTTTTCCAGAGG - Intronic
1042453314 8:68973997-68974019 GGCAAGTCCCACTTTTCTACAGG + Intergenic
1042707148 8:71675830-71675852 GGCAAGTCCCGCTTTTCTACAGG + Intergenic
1043045316 8:75315535-75315557 TGCAAATCTTGCTTTTCTAATGG - Intergenic
1043353871 8:79390779-79390801 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1043718117 8:83509935-83509957 AGCAAGTCCTGCTTTTCTGGCGG - Intergenic
1043837468 8:85063693-85063715 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1043837498 8:85063818-85063840 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1044148690 8:88746823-88746845 AGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1044258804 8:90094836-90094858 GGCAAGTCCCGCTTTTCTAGGGG - Intronic
1044416894 8:91949062-91949084 AGCAAGTCCCACTTTCCTAGGGG + Intergenic
1044921723 8:97175905-97175927 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1044921758 8:97176030-97176052 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1044921790 8:97176154-97176176 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1044924954 8:97201915-97201937 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1045197272 8:99944691-99944713 AGCAAGTCTCGCTTTTCTAGGGG + Intergenic
1045644590 8:104286980-104287002 GGCAAGTCCCGCTTTCCTAGAGG + Intergenic
1046293889 8:112196730-112196752 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1046293923 8:112196855-112196877 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1046334135 8:112760783-112760805 GGCCAGTGCTGCTCTTTTAGGGG + Intronic
1046386573 8:113514338-113514360 AGCAAGTCCCGGTTTTCTACAGG - Intergenic
1046439852 8:114242622-114242644 AGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1046443006 8:114282778-114282800 GGCAAGTCCTGCTTTTCTACGGG + Intergenic
1046511890 8:115213270-115213292 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
1046559078 8:115815632-115815654 GGCAAGTCCCGCTTTCCTAGGGG + Intergenic
1047699144 8:127432702-127432724 GGCAAGTCCTGCTTTCCTGGGGG + Intergenic
1047856152 8:128915321-128915343 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1048097368 8:131311018-131311040 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1048097397 8:131311139-131311161 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1048135253 8:131741605-131741627 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1048135282 8:131741730-131741752 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1048585621 8:135771860-135771882 GGCAAGTCCCACTTTGCTAGGGG - Intergenic
1048728615 8:137413004-137413026 GGCGAGTCCTGCTTTTCTGAGGG - Intergenic
1048764420 8:137829501-137829523 AGCAAGTCCTGTTTTTCTGGGGG - Intergenic
1048764436 8:137829565-137829587 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1048764471 8:137829690-137829712 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1049869021 8:144958992-144959014 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1049869054 8:144959113-144959135 GGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1050258311 9:3815894-3815916 GGCAAGTCCCACCTTTCTGGGGG - Intergenic
1050473934 9:6020919-6020941 GGCAAGCACTGCTTTTCTGGGGG + Intergenic
1050895892 9:10885834-10885856 GGCAAGTACTGCTTTTCTTGGGG + Intergenic
1051052424 9:12949343-12949365 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
1051242472 9:15074301-15074323 GACAATTACTGCTTTTCAAGTGG + Intergenic
1051849488 9:21490394-21490416 GGCGAGTCCCGCTTTCCTAGGGG - Intergenic
1051953587 9:22663183-22663205 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1052191591 9:25669777-25669799 GGCAAGTACTGCTTTTCTGGGGG + Intergenic
1052191620 9:25669895-25669917 GGCAAGTACCGCTTTTCTAGGGG + Intergenic
1052653078 9:31327205-31327227 AGCAAGTACCGCTTTTCTGGGGG + Intergenic
1052970330 9:34373386-34373408 GAAAAGTCCTGCTCTCCTAGAGG + Intronic
1053034259 9:34810566-34810588 CTCAGGTCCTCCTTTTCTAGGGG - Intergenic
1053057740 9:35004158-35004180 AGCAAGTACTGCTTTTCTAGGGG + Intergenic
1053057768 9:35004275-35004297 TGCAAGTACCACTTTTCTAGGGG + Intergenic
1054807681 9:69409431-69409453 GGCAAGTCCCACTTTTCTGGGGG - Intergenic
1055232836 9:74086599-74086621 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1055232853 9:74086663-74086685 GGCAAGTCCTGCTTTTCTAGGGG + Intergenic
1055626457 9:78181549-78181571 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1055626490 9:78181674-78181696 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1055809826 9:80138308-80138330 GGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1055881552 9:81009996-81010018 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1056044907 9:82705245-82705267 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1056060973 9:82884823-82884845 AGCAAGTCCCACTTTTCTACGGG + Intergenic
1056323628 9:85459413-85459435 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1056437427 9:86587960-86587982 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1056522233 9:87411908-87411930 AGCAAGTCCCACTTTTCTAGAGG + Intergenic
1056882780 9:90413598-90413620 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
1057234623 9:93348556-93348578 GGCAAGTCCCACTTTTCTAGAGG + Intergenic
1057377783 9:94540824-94540846 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1057981817 9:99670865-99670887 GGCAAGTCCCGCTTTTCTACGGG + Intergenic
1058026438 9:100145521-100145543 GGCAAGTACCACTTTTCTAGGGG - Intronic
1058026466 9:100145641-100145663 AGCAAGTACTGCTTTTCTGGGGG - Intronic
1058612215 9:106789260-106789282 AGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1059546357 9:115179329-115179351 GGCAAGTCCCGCTTTTCTAAAGG - Intronic
1059546383 9:115179454-115179476 AGCAAGTCCTGCTTTTCTTGGGG - Intronic
1059574345 9:115474086-115474108 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1059574429 9:115474400-115474422 GGCAAGTCCTGCTTTCCTAGGGG + Intergenic
1059606904 9:115843889-115843911 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1059863685 9:118490358-118490380 GGCAAGTCCCGCTTTCCTAGGGG - Intergenic
1060318667 9:122535273-122535295 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1060738103 9:126079416-126079438 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1060738133 9:126079541-126079563 GGCAAGTCCTGCTTTTCTGGGGG - Intergenic
1062470854 9:136703590-136703612 GGCATGTCCTGCTGCTCTAAGGG + Intergenic
1185858756 X:3559005-3559027 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1185863959 X:3606042-3606064 GGCAAGTCTTGTTTTTCTGAAGG - Exonic
1185960855 X:4545020-4545042 AGCAAGTCCCACTTTTCTAGGGG - Intergenic
1185960893 X:4545150-4545172 GGTAAGTCCCGCTTTTCTAGGGG - Intergenic
1185990864 X:4892628-4892650 GGCAAGTCCCGCTTTTCTACGGG + Intergenic
1186113091 X:6276932-6276954 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1186113127 X:6277053-6277075 GGCAAGTCCCGCTTTTCTGTAGG - Intergenic
1186783836 X:12940730-12940752 GGCAAGTTCCGCTTTTCTGTGGG + Intergenic
1186783872 X:12940855-12940877 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1186904081 X:14092610-14092632 GGTAAGTTCTGCTTTTCAAGTGG + Intergenic
1187100103 X:16183430-16183452 GGCAAGTCCCGCTTTTCTAGAGG - Intergenic
1187100133 X:16183552-16183574 GGCAAGTCCCGCTTTTCTGGAGG - Intergenic
1188333210 X:28897234-28897256 GGCAAGTACAGCTTTTCTAGGGG - Intronic
1188463583 X:30453813-30453835 GGCAAGTCCCACTTTTCTAGGGG - Intergenic
1188552466 X:31378618-31378640 GGCAAGTACCGCTTTTCTCGGGG + Intronic
1193247315 X:79244241-79244263 GGCAAGTCCTGTTTCTGTACTGG + Intergenic
1193560409 X:83010814-83010836 GTCCAGTCCGGATTTTCTAGGGG + Intergenic
1193855699 X:86599212-86599234 GCCAATTCCTTCCTTTCTAGGGG + Intronic
1193885747 X:86982860-86982882 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1193941283 X:87682829-87682851 AGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1194186433 X:90777990-90778012 AGCAAGTCCTGCTTTCCTAGGGG - Intergenic
1194293811 X:92104901-92104923 GGCAAGTCCCGCTTTCCTAGGGG - Intronic
1194308745 X:92277765-92277787 GGCAAGTCCCACTTTTCTAGAGG - Intronic
1194366904 X:93023944-93023966 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1194373378 X:93102019-93102041 GGCATCTCCAGCTATTCTAGAGG - Intergenic
1194503194 X:94703579-94703601 GGCAAGTCCCACTTTTCTAGAGG - Intergenic
1194660445 X:96624859-96624881 GGCAAGTCCCGCTTTTCTGGGGG + Intergenic
1194822963 X:98528969-98528991 GGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1194822981 X:98529033-98529055 GGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1194874046 X:99164311-99164333 TGCAAGCCCTGCTTTCCTGGGGG - Intergenic
1195303192 X:103552558-103552580 GGCATGTGCTGGTTTTATAGGGG - Intergenic
1195841266 X:109179353-109179375 GGCAAGTCCCACTTTTCTGGTGG + Intergenic
1195908871 X:109869886-109869908 GGCAAGTCCCACTTTCCTAGGGG - Intergenic
1196072855 X:111544826-111544848 AGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1196165325 X:112531546-112531568 AGCAAGTCCCGCTTTTCTAGAGG + Intergenic
1196221208 X:113113511-113113533 AGCAAGTACCGCTTTTCTGGGGG - Intergenic
1196299801 X:114040943-114040965 GGCAAGTCCCGCTTTTATAAAGG + Intergenic
1196299816 X:114041007-114041029 GGCAAGTCCCGCTTTTCTGGAGG + Intergenic
1196330576 X:114467564-114467586 GGCAAGTCCCACTTTTCTGGGGG + Intergenic
1196330589 X:114467628-114467650 GGCAAGTCCCACTTTTCTAGAGG + Intergenic
1196341949 X:114606142-114606164 GGCAAGTCCCGCTTTTCTATGGG - Intronic
1196525680 X:116725644-116725666 GGCAAGTACCACTTTTCTAGGGG - Intergenic
1196533733 X:116817172-116817194 GGCAAGTCCCACTTTCCTAGGGG - Intergenic
1196572343 X:117280342-117280364 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1196774054 X:119322441-119322463 AGCAAGTCCCGCTTTTCTAGGGG - Intergenic
1196992924 X:121347800-121347822 GGCAAGTACCGCTTTTCCAGGGG - Intergenic
1197064706 X:122223034-122223056 GGCAAGTCCCGCTTTTCTACTGG + Intergenic
1197352253 X:125393524-125393546 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1197470728 X:126863964-126863986 TGCAAGTCCCACTTTTCTGGGGG + Intergenic
1197793474 X:130278188-130278210 GGCAAGTACCACTTTCCTAGGGG + Intergenic
1197932842 X:131712901-131712923 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1197932872 X:131713022-131713044 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1198598190 X:138259513-138259535 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
1198598225 X:138259638-138259660 GGTAAGTCCCGCTTTTCTAGGGG + Intergenic
1198599598 X:138269035-138269057 AGCAAGTCCCGCTTTTCTGGGGG - Intergenic
1199576222 X:149316486-149316508 AGCAAGTCCCACTTTTCTGGGGG + Intergenic
1199576255 X:149316611-149316633 AGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1199576288 X:149316736-149316758 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1200388687 X:155919653-155919675 GGCTAGTCCTTGTTTTCGAGTGG + Intronic
1200533032 Y:4360066-4360088 GGCAAGTCCTGCTTTCCTAGGGG - Intergenic
1200611328 Y:5329442-5329464 GGCAAGTCCCGCTTTCCTAGGGG - Intronic
1200675126 Y:6140200-6140222 GGCAAGTCCCGCTTTTCTAGGGG + Intergenic
1200681410 Y:6216061-6216083 GGCATCTCCAGCTATTCTAGAGG - Intergenic
1201581184 Y:15513294-15513316 GGCAAGTCCCACTTTTCTAGAGG + Intergenic
1201936850 Y:19419356-19419378 GGCAAGTCCTGCTTTTCTGGGGG + Intergenic
1201936871 Y:19419460-19419482 GGCAAGTCCCACTTTTCTAGGGG + Intergenic
1202076752 Y:21044145-21044167 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1202076778 Y:21044271-21044293 AGCAAGGCCTGCTTTTCTGGGGG - Intergenic