ID: 977217310

View in Genome Browser
Species Human (GRCh38)
Location 4:94297738-94297760
Sequence CGGCAAGTCCTGCTTTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 13, 1: 152, 2: 413, 3: 413, 4: 271}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217310_977217317 -3 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217317 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG 0: 201
1: 360
2: 460
3: 354
4: 240
977217310_977217320 5 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002
977217310_977217315 -4 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162
977217310_977217322 25 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217310_977217321 6 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
977217310_977217314 -10 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG 0: 457
1: 585
2: 275
3: 104
4: 106
977217310_977217318 -2 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
977217310_977217319 4 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217310 Original CRISPR CGGCAAGTCCTGCTTTTCTA GGG (reversed) Intergenic
900840549 1:5045688-5045710 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
900840589 1:5045876-5045898 TGGCAAGTCCCGCTTTCCTAGGG + Intergenic
903853830 1:26323982-26324004 GGGCAAGTCGTGCTCTTCTCTGG - Intronic
904711406 1:32433202-32433224 CTGCAAGTCCCGCTTTTCTGGGG + Intergenic
904711440 1:32433323-32433345 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
904996669 1:34636645-34636667 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
905060749 1:35137138-35137160 CGGCAAGTACCGCTTTTCTGGGG - Intergenic
905499549 1:38425976-38425998 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
905499579 1:38426097-38426119 CGGCAAGTACCACTTTTCTGGGG + Intergenic
906080681 1:43086374-43086396 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
906080713 1:43086491-43086513 TGGCAAGTCCCACTTTTCTAAGG + Intergenic
906744742 1:48213814-48213836 AGGCAAGTCCCGCTTTTCTAGGG - Intergenic
906744775 1:48213939-48213961 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
907292402 1:53425208-53425230 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
907292433 1:53425333-53425355 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
907503775 1:54902602-54902624 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
907503809 1:54902723-54902745 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
907521046 1:55023621-55023643 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
907900963 1:58741063-58741085 TGGCTACTCCTGCTTTCCTAGGG + Intergenic
908461916 1:64354729-64354751 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
908461950 1:64354854-64354876 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
908592198 1:65646754-65646776 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
908592223 1:65646881-65646903 CGGCAAGTTCTGCTTTCCTGGGG - Intergenic
908592285 1:65647128-65647150 CGGCAAGTCTCGCTTTTCTGGGG - Intergenic
908852104 1:68386890-68386912 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
908852182 1:68387198-68387220 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
908852199 1:68387262-68387284 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
908852214 1:68387326-68387348 TGACAAGTCCTGCTTTTCTAGGG + Intergenic
909035247 1:70589247-70589269 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
909035279 1:70589372-70589394 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
909222845 1:72984503-72984525 CGGCAAGTCCCGTTTTCCTAGGG - Intergenic
909222862 1:72984566-72984588 CAGCAAGTCCCGCTTTCCTGGGG - Intergenic
909223899 1:72992678-72992700 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
909551220 1:76899503-76899525 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
909776894 1:79493234-79493256 AGGCAAGTCCCGCTTTTCTAGGG - Intergenic
909788466 1:79643488-79643510 CAGCAAGTCCCACTTTTCTAGGG - Intergenic
909788498 1:79643608-79643630 CGGCAAGTCCTGCTTTTCTGTGG - Intergenic
909793176 1:79701035-79701057 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
909793210 1:79701159-79701181 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
909909704 1:81246181-81246203 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
909909737 1:81246306-81246328 CGGCAAGTCCTGCTTTTCTATGG + Intergenic
909978636 1:82072143-82072165 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
909978668 1:82072268-82072290 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
911510812 1:98805942-98805964 TGGCAAGTACTGCTTTTCTGGGG - Intergenic
911570148 1:99510400-99510422 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
918346764 1:183614094-183614116 CGGCAAGTCCCGCTTTTCTGAGG + Intergenic
918346919 1:183614707-183614729 CAACAAGTCCCACTTTTCTAGGG + Intergenic
918567879 1:185953030-185953052 TGGCAAGTCCCGCTTTTCTAGGG - Intronic
918567897 1:185953094-185953116 TGGCAAGTCCCGCTTTTCTGGGG - Intronic
918567944 1:185953283-185953305 CAGCAAGTCTTGCTTTTCTGGGG - Intronic
918714597 1:187770167-187770189 TGGCAAGTCCCACTTTCCTAGGG - Intergenic
918714632 1:187770293-187770315 CGGCAAGTCCCGCTTTTCTGAGG - Intergenic
919476136 1:198035510-198035532 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
919476168 1:198035631-198035653 AGGCAAGTCCCACTTTTCTAGGG + Intergenic
919562911 1:199145172-199145194 CGTCAAGTCCTGCATTTATTTGG - Intergenic
919642109 1:200055484-200055506 CAGCCAGCCCTACTTTTCTATGG + Intronic
920829133 1:209449698-209449720 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
920829168 1:209449825-209449847 TGGCAAGTCCTGCTTTCCTGGGG + Intergenic
920829185 1:209449889-209449911 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
920829204 1:209449953-209449975 CGGCAAGTCCCACTTTCCTGGGG + Intergenic
921212204 1:212910466-212910488 CAGCAAGTCCCGCTTTCCTGGGG + Intergenic
921212221 1:212910529-212910551 CGGCAAGTCCCACTTTCCTAGGG + Intergenic
921408030 1:214802601-214802623 GAGCAAGCCCTGCTTTTCTAAGG + Intergenic
921459992 1:215414701-215414723 CGGCGAGTCCCACTTTTCTACGG - Intergenic
921509065 1:216008994-216009016 CAGCAAGTCCCACTTTTCTGGGG + Intronic
921519914 1:216146503-216146525 CGCCAAGTCCCGCTTTCCTGGGG + Intronic
921519933 1:216146567-216146589 CGGCAAGTCCCGCTTTCCTAGGG + Intronic
921696520 1:218217065-218217087 TGGCTTGTCCTGCTTTTCAATGG + Intergenic
921733174 1:218598480-218598502 CGACAAGTCCTGCTTTTCTAGGG - Intergenic
921733190 1:218598544-218598566 CGCCAAGTCCCGCTTTTCTGGGG - Intergenic
921733208 1:218598608-218598630 TGGCAAGTCCAGCTTTCCTGGGG - Intergenic
921733342 1:218599160-218599182 CAGCAAGTCCCACTTTTCTGGGG - Intergenic
922048179 1:221966807-221966829 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
922048212 1:221966932-221966954 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
922048228 1:221966996-221967018 CGGTAAGTCCCACTTTTCTAAGG + Intergenic
922049749 1:221977856-221977878 CGGCAAGTCCTGCTTTTCTATGG - Intergenic
922049796 1:221978044-221978066 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
922154272 1:223029114-223029136 CAGCAAGTCCCGCTTTCCTAGGG - Intergenic
922154298 1:223029238-223029260 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
922906156 1:229175220-229175242 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
922906182 1:229175345-229175367 CAGCAAGTCCCGCTTTTCTATGG + Intergenic
922934578 1:229413257-229413279 CAGCAAATCCCGCTTTTCTGGGG + Intergenic
922934610 1:229413375-229413397 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
922934641 1:229413500-229413522 TGGCAAGTCTCACTTTTCTAGGG + Intergenic
923075008 1:230602221-230602243 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
923214362 1:231834773-231834795 TGGCAAGTACAGCTTTTCTAGGG - Intronic
923257483 1:232233961-232233983 TGGCAAGTCCTGCTTTTCTATGG - Intergenic
923408834 1:233688249-233688271 CGGCAAGTCCTGTTTTTCTGGGG - Intergenic
923408854 1:233688332-233688354 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
923408873 1:233688396-233688418 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
923408907 1:233688521-233688543 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
923770911 1:236936836-236936858 CGGCAAGTCCTGCTTTTCTAGGG - Intergenic
923962531 1:239102070-239102092 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
923962561 1:239102194-239102216 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
924180427 1:241434867-241434889 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1063362872 10:5471630-5471652 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1063362904 10:5471755-5471777 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1063509830 10:6634432-6634454 CGACAAGTCCCGCTTTTCTGGGG - Intergenic
1063509876 10:6634618-6634640 CAGCAATTCCCGCTTTTCTGGGG - Intergenic
1063527927 10:6802028-6802050 CGGCAATTTCCGCTTTTCTGGGG - Intergenic
1064663999 10:17631456-17631478 AGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1064664033 10:17631582-17631604 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1064887210 10:20123949-20123971 CAGCAAGTCCCGCTTTTCTAGGG - Intronic
1064887240 10:20124070-20124092 CGGCAAGTTCCGCTTTTCTGTGG - Intronic
1065437395 10:25717270-25717292 CGGCAAGTACCGCTTTTCTAGGG + Intergenic
1065443397 10:25773897-25773919 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1065443415 10:25773961-25773983 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1068179848 10:53503721-53503743 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1068179877 10:53503846-53503868 CGGCAAGTCCTCCTTTTCTGGGG - Intergenic
1068230726 10:54167564-54167586 CGGCAAGTCCTGCTTTTCTGGGG + Intronic
1068592541 10:58865712-58865734 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1068592558 10:58865776-58865798 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1068592591 10:58865901-58865923 CAGCAAATCCTGCTTTTCTGGGG - Intergenic
1069140848 10:64823403-64823425 TGGCAAGTCTTACTTTTCTCTGG + Intergenic
1070346362 10:75546284-75546306 CAGCAAGGTCTGCTGTTCTATGG - Intronic
1070474604 10:76819160-76819182 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474624 10:76819224-76819246 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474644 10:76819288-76819310 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474663 10:76819352-76819374 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474683 10:76819416-76819438 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474702 10:76819480-76819502 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474721 10:76819544-76819566 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1070474738 10:76819608-76819630 CAGCAAGTCCCGCTTTCCTAGGG + Intergenic
1071897962 10:90085881-90085903 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1071915972 10:90295861-90295883 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1071916016 10:90296043-90296065 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1071960854 10:90808179-90808201 CGGCAAGTCCCACTTTTCTGGGG + Intronic
1071960914 10:90808418-90808440 CGGCAAGTCCTGCTTTTCTGGGG + Intronic
1072011518 10:91306389-91306411 CGGCAAGTAGTGCTTTTCTAGGG - Intergenic
1072407409 10:95168441-95168463 CCGCATGTCCTGGTTTTCTCAGG + Intergenic
1073542215 10:104323597-104323619 CTCAAAGTCCTGTTTTTCTAAGG - Intronic
1073709657 10:106022176-106022198 CGGCAAGTACCGCTTTTCTGGGG - Intergenic
1074018815 10:109563309-109563331 CAGCAAGTACCGCTTTTCTGGGG + Intergenic
1074740540 10:116481536-116481558 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1074740572 10:116481657-116481679 CGGCAAGTCCCACTTTTCTAGGG + Intergenic
1075248493 10:120845847-120845869 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1075248511 10:120845911-120845933 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1075651264 10:124129398-124129420 TGGCCAGCCCTGCTGTTCTAGGG - Intergenic
1076547007 10:131252082-131252104 CAGCAATTCCAGCTTTTTTAAGG + Intronic
1077590074 11:3484364-3484386 CAGCAAGTCCTGCTTTTCTGGGG - Intergenic
1077851040 11:6074782-6074804 TGGCAAGTCCCACTTTTCTATGG - Intergenic
1077851082 11:6074970-6074992 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1077883170 11:6366888-6366910 TGGCAAGTACTGCTTTTCTGGGG + Intergenic
1078046341 11:7916940-7916962 TGGCAAGTCCCACTTTTCTATGG - Intergenic
1078046357 11:7917004-7917026 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1079447257 11:20568765-20568787 CGGCAAGTCCTGCTTTCCTGGGG + Intergenic
1079447273 11:20568829-20568851 TGGCAAGTCCCACTTTCCTAGGG + Intergenic
1079672813 11:23188818-23188840 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1079727288 11:23891930-23891952 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1079727322 11:23892051-23892073 CGGCAAGTCCTGCTTTTCTGTGG - Intergenic
1080028136 11:27633894-27633916 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1080227151 11:29974243-29974265 CGGCAAGCATTGCTTTTCTGGGG + Intergenic
1081159434 11:39735005-39735027 CGGCAAGCACTGCTTTTCTGGGG + Intergenic
1081356602 11:42121549-42121571 CAGCAAGTCCCGCTTTCCTGGGG + Intergenic
1081356618 11:42121613-42121635 CAGCAAGTCCCACTTTCCTAGGG + Intergenic
1084046966 11:66574605-66574627 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1084232064 11:67760537-67760559 CGGCAAGTCCTGCTTTTCTGTGG + Intergenic
1084245792 11:67856136-67856158 CAGCAAGTCCTGCTTTTCTGGGG - Intergenic
1084353798 11:68623652-68623674 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1084613506 11:70219160-70219182 CAGCAAGTCCCACTTTTCTAGGG - Intergenic
1084613534 11:70219281-70219303 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1084826877 11:71738378-71738400 CAGCAAGTCCCGCTTTTCTTGGG + Intergenic
1084826892 11:71738442-71738464 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1085278403 11:75314473-75314495 CAGCAAGTCCTGCCCTTCTGTGG - Intronic
1085987805 11:81807139-81807161 CAGCAAGTACTGCTTTTCTAGGG + Intergenic
1086136502 11:83447710-83447732 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1087127571 11:94642448-94642470 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1087127605 11:94642568-94642590 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1087196654 11:95310341-95310363 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1087196723 11:95310591-95310613 TGGCAAGTCCCACTTTCCTAGGG + Intergenic
1087314386 11:96588527-96588549 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1087314434 11:96588716-96588738 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1087839757 11:102908904-102908926 TGGCAAGTCCCACTTTTCTAGGG - Intergenic
1089348907 11:117810321-117810343 TGGCAAGTCCCGCTTTTCTAGGG + Intronic
1089472281 11:118730855-118730877 CGGCAAGTACCACTTTTCTGGGG - Intergenic
1089472315 11:118730976-118730998 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1089867261 11:121642643-121642665 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1089953023 11:122547479-122547501 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1089987185 11:122825405-122825427 TGGCAAGTCCCGCTTTTCCAGGG + Intergenic
1090316958 11:125800255-125800277 CAGCAACTCCTGCTTTTTTTTGG + Intergenic
1090850786 11:130568993-130569015 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1090850804 11:130569057-130569079 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1090872141 11:130758137-130758159 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1090872158 11:130758201-130758223 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1090872175 11:130758262-130758284 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1090927170 11:131259273-131259295 CGGCAAGTACCGCTTTTCTAGGG - Intergenic
1091886288 12:4019433-4019455 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1091886317 12:4019558-4019580 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1092416377 12:8293266-8293288 CAGCAAGTCCCGCTTTTCTGAGG - Intergenic
1092474231 12:8805723-8805745 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1092592913 12:9967630-9967652 CGGCAAGTACCGCTCTTCTTGGG - Intronic
1092592955 12:9967804-9967826 CGACAAGTACTGCTTTTCTTGGG - Intronic
1092626941 12:10337604-10337626 CGGCAAGTCCCGCTTTTCTATGG - Intergenic
1092626972 12:10337729-10337751 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1092723929 12:11466971-11466993 CGGCAAATCCCACTTTTCTATGG - Intronic
1092723962 12:11467096-11467118 TGGCAAGTCCCACTTTTCTGGGG - Intronic
1092739519 12:11614386-11614408 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1092789476 12:12059230-12059252 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1092925044 12:13264645-13264667 CGGCAAGTCCCACTTTTCTAGGG - Intergenic
1093071357 12:14709561-14709583 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1093071384 12:14709683-14709705 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1093268231 12:17026460-17026482 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
1093578501 12:20763811-20763833 CAGAAAGTCCCGCTTTTCTGGGG + Intergenic
1093584689 12:20821587-20821609 TGGCAAGTCCCGCTTTTCTAGGG - Intronic
1093584724 12:20821712-20821734 CCGCAAGTCCCGCTTTTCTGGGG - Intronic
1093813025 12:23510652-23510674 CGGCAAGTACCGCTTTTCTGGGG - Intergenic
1094316257 12:29139705-29139727 CAGCAAGTACTGCTTTTCTAGGG - Intergenic
1094400487 12:30057063-30057085 CAGCAAGTACTGCTTTTCTGGGG + Intergenic
1094400501 12:30057123-30057145 AGGCAAGTACCACTTTTCTAGGG + Intergenic
1094825560 12:34266620-34266642 CATCAAGTCCCGCTTTTCTAGGG + Intergenic
1097398308 12:59102528-59102550 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1097398385 12:59102836-59102858 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1097417243 12:59327902-59327924 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1097417262 12:59327966-59327988 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1097542415 12:60956744-60956766 AGGCAAGTCCCACTTTTCTGGGG - Intergenic
1097592191 12:61587935-61587957 CGGCAAGCACTGCTTTTCTGGGG + Intergenic
1098173824 12:67771306-67771328 CGGCAAGTTCCGCTTTTCTATGG - Intergenic
1098173852 12:67771431-67771453 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1098401979 12:70086180-70086202 CGACAAGTCCCGCTTTCCTGGGG + Intergenic
1098401998 12:70086244-70086266 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1098402017 12:70086308-70086330 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1098402035 12:70086372-70086394 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1098402053 12:70086436-70086458 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1098628819 12:72704114-72704136 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1098654008 12:73006607-73006629 CAGCAAATACTGCTTTTCTAGGG - Intergenic
1098654037 12:73006726-73006748 TGGCAAGTACCGCTTTTCTAGGG - Intergenic
1099188479 12:79540740-79540762 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1099188509 12:79540865-79540887 CGGCAAGTCCCGCTTTTCTACGG + Intergenic
1099292340 12:80788023-80788045 CAGCAAGTCCTGCTTTTCTGGGG - Intergenic
1099762341 12:86939583-86939605 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1099762373 12:86939707-86939729 CGGCAAGTCCCGCTTTTCTATGG + Intergenic
1100186113 12:92142447-92142469 CAGCAAGTCCTTCTATTATATGG + Exonic
1100561049 12:95749724-95749746 TGGCAAGTCCTGCTTTTCTGGGG + Intronic
1100561098 12:95749913-95749935 TGGCAAGTCCCGCTTTTCTGGGG + Intronic
1100561117 12:95749977-95749999 TGGCAAGTCCCGCTTTTCTGGGG + Intronic
1100940064 12:99716047-99716069 CAGCAAGTCCCGCTTTTCTGGGG + Intronic
1101278626 12:103227517-103227539 CGGCAAGTCCCACTTTTCTATGG - Intergenic
1101278654 12:103227642-103227664 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1101842405 12:108337647-108337669 GGGCAAGTCATGCCTTTCTCTGG - Intronic
1105396476 13:20041366-20041388 AGGCAACCCCTGCTTTTCTCTGG + Intronic
1106943235 13:34799641-34799663 CGGCAAGTCCTGCTTTCCTGGGG + Intergenic
1106943251 13:34799705-34799727 CAGCAAGTCCCGCTTTCCTAGGG + Intergenic
1107075326 13:36317220-36317242 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1107220548 13:37974084-37974106 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1107683336 13:42872103-42872125 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1107683352 13:42872167-42872189 CAGCAAGTGCTGCTTTCCTGGGG - Intergenic
1107683372 13:42872231-42872253 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1107965995 13:45598730-45598752 CGGCAAGTCCTTCTTTGAAAAGG - Intronic
1108202445 13:48057217-48057239 CGGCAAGTCCCACTTTTCTGGGG + Intronic
1108512761 13:51170768-51170790 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1108512794 13:51170896-51170918 TGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1108913636 13:55583049-55583071 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1108919761 13:55659755-55659777 TGGTAAGTCCTGCTTTTCTATGG - Intergenic
1108919789 13:55659882-55659904 CGGCAAGTCCTGCTTTTCTGAGG - Intergenic
1108947203 13:56041143-56041165 CAGCAAGTTCCGCTTTTCTGGGG + Intergenic
1108953163 13:56117220-56117242 CGGCAAGTCCCGCTTTTCTACGG - Intergenic
1108953192 13:56117345-56117367 CGGCAAGTCCCGCTTTTCTGAGG - Intergenic
1109343370 13:61089316-61089338 CGGCAAGTCCCACTTTTCTAGGG + Intergenic
1109400768 13:61825378-61825400 CGGCAAGATCTACTTTTTTAAGG + Intergenic
1109499051 13:63213971-63213993 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1109499085 13:63214091-63214113 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1109709851 13:66146004-66146026 CGGCAAGTCCCACTTTCCTAGGG - Intergenic
1109709882 13:66146129-66146151 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1109716966 13:66231173-66231195 TGGCAAGTCCCACTTTTCTACGG - Intergenic
1109716981 13:66231237-66231259 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1109717029 13:66231426-66231448 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1110650728 13:77938444-77938466 CAGCAAGTACCACTTTTCTAGGG - Intergenic
1110650744 13:77938504-77938526 CGGCAAGTACCACTTTTCTGGGG - Intergenic
1110765254 13:79275061-79275083 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1110845091 13:80184412-80184434 CTGCAAGTCCTGCTTTTCTGGGG + Intergenic
1110845122 13:80184533-80184555 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1110978227 13:81866958-81866980 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1111126234 13:83912938-83912960 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1111301770 13:86359069-86359091 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1111301801 13:86359194-86359216 CGGCAAGTTCCACTTTTCTACGG + Intergenic
1111362311 13:87191102-87191124 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1111362344 13:87191227-87191249 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
1111459053 13:88517565-88517587 TGGCAAGTCCCACTTTTCTAGGG - Intergenic
1111459070 13:88517629-88517651 CGGCAAGTCCGGCTTTTCTGAGG - Intergenic
1111459085 13:88517693-88517715 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1111459119 13:88517818-88517840 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1111630245 13:90840444-90840466 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1111630274 13:90840569-90840591 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1111631904 13:90853303-90853325 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1111631921 13:90853367-90853389 CGGCAAGTCCCGCTTTTCTGAGG - Intergenic
1112236600 13:97643166-97643188 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1112399586 13:99064203-99064225 CAGCAAGTCCCCATTTTCTATGG + Intronic
1112889564 13:104212951-104212973 CAGCAAGTACTGGTTTTCTGGGG - Intergenic
1113324033 13:109265972-109265994 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1113324097 13:109266219-109266241 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1113324115 13:109266283-109266305 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1113426465 13:110212573-110212595 CGGGAAGTCCTGGGTTTCCAGGG + Exonic
1115240785 14:31249955-31249977 CAGCAAGTCCCGCTTTCCTAGGG - Intergenic
1115240800 14:31250019-31250041 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1115240817 14:31250075-31250097 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1115240837 14:31250139-31250161 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1115240858 14:31250203-31250225 CGGCAAGTCCCACTTTCCTGGGG - Intergenic
1115904550 14:38191536-38191558 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1115904580 14:38191661-38191683 TGGCAAGTCCCGCTTTTCTACGG + Intergenic
1116179461 14:41516889-41516911 TGGCAAGTCCTGCTTTTCTACGG + Intergenic
1116534977 14:46017104-46017126 CGGCAAGTCCCACTTTTCGGGGG - Intergenic
1116535013 14:46017225-46017247 CAGCAAGTCCCGCTTCTCTGGGG - Intergenic
1116573246 14:46544924-46544946 CGGCAAGTCCCACTTTTCTGAGG + Intergenic
1116573280 14:46545051-46545073 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1116613301 14:47105133-47105155 CGGCAAGTCCCGCTTTCCTGGGG + Intronic
1116613319 14:47105197-47105219 TGGCAAGTCCTGCTTTCCTAGGG + Intronic
1116702594 14:48260066-48260088 CGGCAAGTCCCGCATTTCTAGGG - Intergenic
1116703522 14:48267278-48267300 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1116703548 14:48267399-48267421 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1116952679 14:50894063-50894085 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1116952713 14:50894188-50894210 TGGCAAGTCCCGCTTTCCTGGGG + Intronic
1116952731 14:50894252-50894274 CGGCAAGTCCCGCTTTCCTAGGG + Intronic
1117958116 14:61138156-61138178 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1117958152 14:61138281-61138303 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1118937551 14:70301068-70301090 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1119022159 14:71125068-71125090 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1119022192 14:71125189-71125211 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1119022227 14:71125307-71125329 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1119316929 14:73704221-73704243 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1119316982 14:73704425-73704447 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1120438269 14:84504983-84505005 CGGCAAGTACCACTTTTCTGGGG - Intergenic
1120438300 14:84505100-84505122 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1120539745 14:85737602-85737624 CGGCAAGTACCCCTTTTCTGGGG - Intergenic
1120539777 14:85737715-85737737 CGGCAAGTACCACTTTTCTGGGG - Intergenic
1120660174 14:87239791-87239813 TGGCAAATCCCGCTTTTCTAGGG - Intergenic
1120660208 14:87239912-87239934 CGCCAAGTCCCACTTTTCTGGGG - Intergenic
1121703426 14:95973859-95973881 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1121703442 14:95973923-95973945 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1121703459 14:95973987-95974009 CGGCAAATCCTTCTTCTCTGGGG + Intergenic
1122040775 14:98986137-98986159 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1122040793 14:98986201-98986223 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1123882665 15:24690152-24690174 CGGCAAGTACTGCTTTTCTGGGG - Intergenic
1125045501 15:35239513-35239535 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1125045535 15:35239639-35239661 CGGCAAGTCCCGCTTTCCTGGGG + Intronic
1125045554 15:35239703-35239725 TGGCAAGTCCTGCTTTCCTGGGG + Intronic
1125045570 15:35239767-35239789 CAGCAAGTCCCGCTTTCCTAGGG + Intronic
1125131750 15:36290528-36290550 CAGCAAGTGCCGCTTTTCTACGG - Intergenic
1125131806 15:36290775-36290797 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1126530339 15:49703755-49703777 TGGCAAGTACCGCTTTTCTAAGG - Intergenic
1126530365 15:49703874-49703896 CGGCAAGTACCACTTTTCTAGGG - Intergenic
1126843510 15:52739441-52739463 CGGCAAGTCCCGCTTTTCAAGGG + Intergenic
1126843543 15:52739560-52739582 CGGCAAGTCCCATTTTTCTGGGG + Intergenic
1126912578 15:53431464-53431486 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1130854846 15:87831997-87832019 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1130947683 15:88561212-88561234 CGGCAAGTCCTGCTTTTCTATGG - Intergenic
1130947713 15:88561337-88561359 CGGCAAGTCTCGCTTTTCTGGGG - Intergenic
1131447492 15:92512341-92512363 CGGCAAGTACCGCTTTTCTAGGG + Intergenic
1131683950 15:94751613-94751635 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1131882727 15:96876625-96876647 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1131882745 15:96876689-96876711 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1131882764 15:96876753-96876775 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1132262760 15:100441061-100441083 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1132340177 15:101073391-101073413 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1133651159 16:7815537-7815559 CGGCAATTCCCACTTTTCTGGGG + Intergenic
1133766903 16:8844437-8844459 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
1133766940 16:8844562-8844584 CGGCAAGTCCCGCTTTTCTGAGG - Intronic
1133869820 16:9676222-9676244 CAGCAAGTCCCGCTTTTCTACGG - Intronic
1133869847 16:9676347-9676369 TGGCAAGTCTTGCTTTTCTGAGG - Intronic
1134342369 16:13357208-13357230 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1134628445 16:15739632-15739654 CAGCTTGTCCTGGTTTTCTAAGG + Intronic
1135170874 16:20182248-20182270 TGGCAACTCCTTCTTTTCTTTGG - Intergenic
1135210076 16:20518019-20518041 CAGGAAGTCATTCTTTTCTATGG + Intergenic
1138804657 16:60079438-60079460 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
1139039413 16:62983762-62983784 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1139039449 16:62983885-62983907 CGGCAAGTCCCGTTTTCCTGGGG - Intergenic
1139039486 16:62984010-62984032 CGGCAAGTCCCGTTTTCCTGGGG - Intergenic
1139039522 16:62984135-62984157 CGGCAAGTCCCGTTTTCCTGGGG - Intergenic
1139039541 16:62984199-62984221 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139039558 16:62984260-62984282 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139039575 16:62984321-62984343 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139039592 16:62984382-62984404 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139039622 16:62984504-62984526 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139039641 16:62984568-62984590 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139039658 16:62984629-62984651 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1139226124 16:65234570-65234592 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1139943224 16:70621087-70621109 CGACAAGTCCCGCTTTCCTAGGG - Intronic
1139943240 16:70621151-70621173 CGGCAAGTCCTGCTTTCCTGGGG - Intronic
1139943908 16:70625417-70625439 CGGCAAGTCCCGCTTTTCTAGGG - Intronic
1139943941 16:70625540-70625562 CAGCAAGTCCCGCTTTTCTGGGG - Intronic
1141796486 16:86278734-86278756 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1141796506 16:86278798-86278820 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1141796526 16:86278862-86278884 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1141796546 16:86278926-86278948 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1141796566 16:86278990-86279012 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1141796585 16:86279054-86279076 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1141865404 16:86746667-86746689 CGGCAAGTCCCACTTTCCTAAGG - Intergenic
1141865421 16:86746731-86746753 CGACAAGTCCCGCTTTCCTGGGG - Intergenic
1144104395 17:11972640-11972662 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1144104426 17:11972762-11972784 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1144642686 17:16946299-16946321 CGGCCTGTCCTGCTCTTCTTGGG - Intronic
1145118484 17:20233924-20233946 AGACAAGTCCTGAGTTTCTATGG + Intronic
1145263415 17:21367925-21367947 CAGCAAGTCCTCCTGGTCTAGGG + Intergenic
1146597640 17:34184063-34184085 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1146597672 17:34184188-34184210 CGGCAAGTCCCACTTTCCTGGGG + Intergenic
1146597689 17:34184252-34184274 TGGCAAGTCCTGCTTTTCTAGGG + Intergenic
1151622259 17:75253493-75253515 CGGCAAGTCCTGCTTTTCTGGGG + Intronic
1151622291 17:75253618-75253640 CGGTAAGTCCCGCTTTTCTAGGG + Intronic
1151839939 17:76610546-76610568 CGGTAAGTCCCGCTTTTCTATGG - Intergenic
1151839956 17:76610610-76610632 CGGCAAGTCCCGCTTTTCTGAGG - Intergenic
1155173622 18:23285082-23285104 TGGCAAGTCCTGCTTTTCTGGGG + Intronic
1155697210 18:28697788-28697810 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1155697260 18:28697976-28697998 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1155916315 18:31561015-31561037 CGGAAATTCATGCTTTTCTAAGG + Intergenic
1155941306 18:31804624-31804646 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1155941339 18:31804745-31804767 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1156237177 18:35216861-35216883 AGGCAAGTACCGCTTTTCTGAGG + Intergenic
1156924260 18:42557217-42557239 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1158336116 18:56416337-56416359 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1158336181 18:56416587-56416609 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1158394895 18:57071574-57071596 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1159164254 18:64682590-64682612 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1159164284 18:64682712-64682734 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1159834801 18:73325487-73325509 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1159834851 18:73325675-73325697 AGCCAAGTCCCGCTTTCCTAGGG + Intergenic
1159879224 18:73842701-73842723 GAGCAGTTCCTGCTTTTCTAAGG - Intergenic
1161661507 19:5549467-5549489 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1161661525 19:5549531-5549553 TGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1162242388 19:9365543-9365565 CGGCAAGTACTGCTTTTCTGGGG - Intronic
1163487076 19:17594376-17594398 CGGCAAGTCCCGCTTTTCTAAGG + Intergenic
1163900492 19:20095735-20095757 CGGCAAGTCCCACTTTTCTAGGG - Intronic
1163900524 19:20095862-20095884 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
1163906798 19:20155414-20155436 CGGCAAGTCCCGATTTTCTGAGG + Intergenic
1163906830 19:20155541-20155563 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1163906848 19:20155605-20155627 TGGCAAGTCCTGCTTTCCTAGGG + Intergenic
1164152758 19:22569204-22569226 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1164152776 19:22569268-22569290 TGGCAAGTCCCACTTTCCTAGGG + Intergenic
1164459421 19:28434561-28434583 AGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1164459463 19:28434753-28434775 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
1164459496 19:28434878-28434900 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1165497179 19:36159987-36160009 TGGTAAGTCCCACTTTTCTAGGG - Intergenic
1165497209 19:36160109-36160131 TGGCAAGTCCCGCTTTTCTCGGG - Intergenic
1165510520 19:36264197-36264219 TGGCAAGTCCCACTTTTCTAGGG - Intergenic
1165510552 19:36264322-36264344 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1165835134 19:38750507-38750529 TGGCAAGTCCCGCTTTTCTGGGG + Intronic
1166499145 19:43328243-43328265 CGGTAAGTCCCGCTTTCCTAGGG - Intergenic
1166499211 19:43328489-43328511 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1167046786 19:47054381-47054403 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1167046817 19:47054504-47054526 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1167099206 19:47393723-47393745 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1167901922 19:52628645-52628667 CAGCAAGTTCCGCTTTTCTAGGG + Intronic
1167901948 19:52628765-52628787 CAGCAAGTCCCACTTTTCTAGGG + Intronic
1168051388 19:53832307-53832329 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1168212316 19:54899605-54899627 TGGCAAGTACCGCTTTTCTAGGG - Intergenic
1168212347 19:54899723-54899745 TGGCAAGTACTGCTTTTCTGGGG - Intergenic
1168228208 19:55011554-55011576 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
925221249 2:2143348-2143370 CGTCAGTTCCTGTTTTTCTAGGG - Intronic
925544274 2:5001658-5001680 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
925829029 2:7877396-7877418 TAGCAAGTCCCGCTTTCCTAGGG - Intergenic
925829044 2:7877460-7877482 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829061 2:7877524-7877546 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829079 2:7877588-7877610 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829096 2:7877652-7877674 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829114 2:7877716-7877738 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829132 2:7877780-7877802 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829147 2:7877844-7877866 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
925829178 2:7877968-7877990 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
926250837 2:11154980-11155002 CTGGAAGTCCGGCTTTTCCACGG - Intergenic
926407511 2:12570560-12570582 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
926407543 2:12570685-12570707 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
926407562 2:12570749-12570771 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
926413333 2:12627222-12627244 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
926464280 2:13168664-13168686 CGGCAAGTCCCACTTTTCTAGGG - Intergenic
926464313 2:13168789-13168811 CAGCAAGTCCCGCTTTTGTGGGG - Intergenic
926815745 2:16796625-16796647 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
926815795 2:16796811-16796833 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
928778115 2:34790799-34790821 CAGCAAGTACCGCTTTTCTGGGG + Intergenic
928779902 2:34805721-34805743 CGGCAAGTACCACTTTTCTAAGG - Intergenic
928779930 2:34805840-34805862 CAGCAAGTACTGCTTTTCTAGGG - Intergenic
928827829 2:35441718-35441740 CGGCATGTCCTGCTTTTCTGGGG - Intergenic
928928333 2:36599977-36599999 CGGCAAGTCCCGCTTTTCTGAGG + Intronic
929076926 2:38085653-38085675 CGGCAAGTCCTGCTTTTCTGGGG - Intronic
930906119 2:56570490-56570512 AGGTAAGTTCTGCTTATCTATGG + Intergenic
930954881 2:57193947-57193969 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
930954900 2:57194011-57194033 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
930954918 2:57194075-57194097 CGGCAAGTCCTGCTTTGCTAGGG + Intergenic
930958190 2:57229916-57229938 CGGCAAGTACCGCTTTTCTGGGG + Intergenic
931026576 2:58118036-58118058 CAGCAAGTCCCACTTTTCTAGGG - Intronic
931026593 2:58118100-58118122 TGGCAAGTCCCACTTTTCTGGGG - Intronic
931026628 2:58118225-58118247 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
931042459 2:58315009-58315031 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
931236645 2:60418286-60418308 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
931236662 2:60418348-60418370 CAGCAAGTCCCGCTTTCCTGGGG + Intergenic
931236680 2:60418412-60418434 CAGCAAGTCCCGCTTTCCTGGGG + Intergenic
931236714 2:60418540-60418562 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
931236731 2:60418604-60418626 CGGCAAGTCCTGCTTTCCTGAGG + Intergenic
931236748 2:60418668-60418690 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
931625522 2:64253342-64253364 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
931625539 2:64253403-64253425 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
931625558 2:64253467-64253489 CGGCAAGTCCTGCTTTCCTGGGG + Intergenic
931625573 2:64253531-64253553 TGGCAAGTCCCGCTTTCCTAGGG + Intergenic
931850184 2:66244787-66244809 CGGCAAGTTCCGCTTTTCTGGGG + Intergenic
931850214 2:66244912-66244934 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
931850231 2:66244976-66244998 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
932159688 2:69448448-69448470 CGGCAAGCACTGCTTTTCTGGGG - Intergenic
932295589 2:70621350-70621372 CGGCAAGTCCTGCTTTTCTGGGG + Intronic
932295618 2:70621471-70621493 TGGCAAGTCCCGCTTTTCTAGGG + Intronic
932295649 2:70621593-70621615 CAGCAAGTCCTGCTTTTCTAGGG + Intronic
932359020 2:71089768-71089790 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
932359036 2:71089832-71089854 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
932359055 2:71089896-71089918 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
932359099 2:71090084-71090106 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
932367837 2:71164373-71164395 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
932367867 2:71164498-71164520 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
932367916 2:71164684-71164706 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
932974168 2:76578644-76578666 CGGCAAGTCCCGCTTTTCTACGG - Intergenic
932974200 2:76578771-76578793 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
933012835 2:77089127-77089149 GGGCAAGTCCCGCTTTTCTGGGG + Intronic
933079042 2:77966021-77966043 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
933079061 2:77966085-77966107 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
933079079 2:77966149-77966171 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
933163509 2:79052240-79052262 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
933163541 2:79052361-79052383 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
933179992 2:79216658-79216680 CCACAAGTACCGCTTTTCTAGGG - Intronic
933180009 2:79216718-79216740 CTGCAAGTACCGCTTTTCTAGGG - Intronic
933329709 2:80879134-80879156 TGGCAAGTCCCACTTTCCTAGGG - Intergenic
933329758 2:80879320-80879342 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
933552590 2:83793597-83793619 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
934709020 2:96503241-96503263 GGGCAAGGCCTGCTTCTCAAGGG - Intronic
936175744 2:110218783-110218805 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
936175789 2:110218973-110218995 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
936673427 2:114685895-114685917 CTGCCAGACTTGCTTTTCTAAGG + Intronic
936883117 2:117279656-117279678 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
936883150 2:117279783-117279805 CGGCAAGTCCCACTTTCCTAGGG + Intergenic
939083342 2:137687658-137687680 TGGCAAGTTCCACTTTTCTAGGG - Intergenic
939083374 2:137687782-137687804 TAGCAAGTCCCGCTTTTCTGGGG - Intergenic
939445487 2:142304417-142304439 CGTGTAGTCATGCTTTTCTAGGG - Intergenic
940012342 2:149067981-149068003 CAGAAAGTCCTGTTTTTCTAAGG + Intronic
940017409 2:149121714-149121736 CGGCAGGTCCTGCTTCTCTGTGG - Intronic
940060664 2:149562935-149562957 CGGGAAGTGCTGCTTTTCTAGGG + Intergenic
940107149 2:150113620-150113642 TGGCAAGTACCTCTTTTCTAGGG + Intergenic
940529989 2:154868299-154868321 TGGCAAGTCCAACTTTTCTGGGG + Intergenic
940676016 2:156724845-156724867 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
941340168 2:164296705-164296727 CGGTAAGTCCCACTTTTCTGGGG + Intergenic
941340199 2:164296830-164296852 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
941340215 2:164296894-164296916 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
941353178 2:164460094-164460116 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
941353196 2:164460158-164460180 CGGCAAGTCCCGCTATCCTAGGG + Intergenic
941456389 2:165715179-165715201 TGGCAAGTCCCGCTTTCCTAGGG - Intergenic
941456407 2:165715243-165715265 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
941936101 2:170982387-170982409 CAGCAAGTCCCACTTTTCTAAGG - Intergenic
941936131 2:170982512-170982534 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
942096860 2:172542654-172542676 CAGCAAGTACCGCTTTTCTGGGG + Intergenic
942096892 2:172542773-172542795 CAGCAAGTACCACTTTTCTAGGG + Intergenic
942096905 2:172542833-172542855 TGGCAAGTACTGCTTTTCTAGGG + Intergenic
943421790 2:187675224-187675246 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
943449962 2:188034366-188034388 CGGCAAATGCCGCTTTTCTGGGG + Intergenic
943461375 2:188173811-188173833 CGGCAAGTACCGCTTTTCTGAGG - Intergenic
943806344 2:192131029-192131051 CAGCAAGTCCCGCTTTTCTGGGG + Intronic
943806435 2:192131398-192131420 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
943806452 2:192131462-192131484 TGGCAAGTCCCACTTTTCTAGGG + Intronic
943834922 2:192506932-192506954 CAGCAAGTCCCGCTTTTCTGCGG + Intergenic
943834954 2:192507053-192507075 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
943865179 2:192919171-192919193 TGGCAAGTACTGCTTTTCTGGGG + Intergenic
944387211 2:199180267-199180289 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
944387246 2:199180388-199180410 CGGCAAGTCCTGCTTTTCTAGGG + Intergenic
944393903 2:199247801-199247823 CAGGAAGTCCCGCTTTTCTGGGG + Intergenic
944393931 2:199247925-199247947 TGGCAAGTCCTGCTTTTCTATGG + Intergenic
944876334 2:203966686-203966708 CGGCAAGTCCCACTTTTCTAGGG - Intergenic
944876367 2:203966803-203966825 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
945153344 2:206811720-206811742 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
945173214 2:207018069-207018091 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
945173246 2:207018194-207018216 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
945301682 2:208220945-208220967 CAGCAAGTCCTGCTTTTCTGGGG - Intergenic
945301716 2:208221066-208221088 CGTCAAGTCCCGCTTTTCTAGGG - Intergenic
945361444 2:208900204-208900226 TGGCACGTACTGCTTTTCTGGGG + Intergenic
945375864 2:209078924-209078946 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
945375897 2:209079045-209079067 TGGCAAATCCCGCTTTTCTGGGG + Intergenic
945394123 2:209300307-209300329 TGGCAAGTCCCGCTTTCCTAGGG + Intergenic
945461601 2:210116138-210116160 CAGCAAGTACTGCCTGTCTACGG - Intronic
945683350 2:212939244-212939266 CAGCGAGTACTGCTTTTCTAAGG - Intergenic
945938067 2:215923203-215923225 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
945938097 2:215923328-215923350 CGGCAAGTCCCGCTTTTCTATGG + Intergenic
946215208 2:218178608-218178630 TGGCAAGTCCCACTTTTCTAGGG - Intergenic
946215303 2:218178983-218179005 CAGCAAGTCCCACTTTTCTGGGG - Intergenic
946781232 2:223194518-223194540 CGGCAAGTCCTGCTTTTCTGAGG - Intronic
946781265 2:223194643-223194665 CAGCAAGTCCCGCTTTTCTGGGG - Intronic
946886268 2:224226182-224226204 CATCAAGTCCTGCTTTTCTGGGG + Intergenic
946893027 2:224297495-224297517 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
946893059 2:224297616-224297638 CAGCAAGTCTCACTTTTCTAGGG + Intergenic
947677503 2:231996199-231996221 AGGCAATTCCTGTTTTTCTCAGG + Intronic
948390404 2:237607638-237607660 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
948390442 2:237607759-237607781 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1168739182 20:173672-173694 CAGCAAGTACCGCTTTTCTAGGG + Intergenic
1170069065 20:12344974-12344996 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
1170069081 20:12345038-12345060 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1170105990 20:12754718-12754740 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1170106030 20:12754883-12754905 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1170165655 20:13358838-13358860 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1170165703 20:13359026-13359048 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1170325687 20:15152553-15152575 TGGCAAGTCCCACTTTTCTAGGG - Intronic
1170325720 20:15152676-15152698 CGGCAAGTCCCACTTTTCTGGGG - Intronic
1170820888 20:19755754-19755776 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1170820922 20:19755880-19755902 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1170855250 20:20047147-20047169 TTGCCAGTCCTGTTTTTCTAAGG - Intronic
1173101643 20:40093983-40094005 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1173101673 20:40094108-40094130 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1173118640 20:40269953-40269975 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1173118674 20:40270078-40270100 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1173118692 20:40270142-40270164 TGGCAAGTCCCGTGTTTCTAGGG + Intergenic
1173211170 20:41033252-41033274 CACCAACTCCTGCTTTTCTTTGG + Intronic
1173781409 20:45760205-45760227 TGGCAAGTCCCGCTTTTCTGGGG + Intronic
1173781438 20:45760325-45760347 CGGCAAGTCCTGCTTTTCTAGGG + Intronic
1175423790 20:58852028-58852050 TCGCAGGTCCTGCTGTTCTAGGG - Intronic
1177031360 21:15984430-15984452 CGGCAAGTACCGCTTTTCTAGGG - Intergenic
1177100395 21:16893065-16893087 TGGCAAGTCCTGTTTTTCTGGGG + Intergenic
1177119332 21:17122345-17122367 CGGCAAGTACCGCTTTTCTGGGG + Intergenic
1178362671 21:31962437-31962459 CTGCAACTCCTGCTTCTTTAAGG - Intronic
1178371837 21:32033052-32033074 CAGCAAGGGCTGCTTTTCTGGGG + Intronic
1178677386 21:34642742-34642764 CGGCAAGTCCTGCCTGGCTCTGG + Intergenic
1178890953 21:36520834-36520856 AGGCCAGTCCTGCTTGACTATGG + Intronic
1179015472 21:37591633-37591655 CGGCAAGTACCGCCTTTCTGGGG - Intergenic
1179387290 21:40955660-40955682 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1179387319 21:40955784-40955806 TGGCAAGTCCCGCTTTTCTATGG + Intergenic
1179650552 21:42805661-42805683 CGGCAAGTACTGCTTTTCTGGGG - Intergenic
1180560676 22:16612227-16612249 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1180560695 22:16612291-16612313 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1180560713 22:16612355-16612377 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1180560729 22:16612419-16612441 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1182113732 22:27742949-27742971 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1182113752 22:27743015-27743037 CGGCAAGTCCTGCTTTCCTAGGG + Intergenic
1182732043 22:32503625-32503647 CGGCAAGTCTCGCTTTTCTGGGG + Intergenic
1182732071 22:32503747-32503769 CTGCTAGTCCCGCTTTCCTAGGG + Intergenic
949162333 3:895531-895553 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
949190579 3:1244390-1244412 CGGCAAGTCCCGCTTTCCTGGGG - Intronic
949190598 3:1244454-1244476 CGGCAAGTCCCGCTTTCCTGGGG - Intronic
949670913 3:6398491-6398513 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG + Intergenic
949827202 3:8177874-8177896 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
949827236 3:8177991-8178013 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
950926253 3:16745133-16745155 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
950926285 3:16745254-16745276 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
952663655 3:35879067-35879089 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
952663689 3:35879192-35879214 CAGTAAGTCCTGCTTTTCTGGGG - Intergenic
952895479 3:38075772-38075794 TGGCAAGTCCCGCTTTTCTAGGG - Intronic
952895510 3:38075897-38075919 TGGCAAGTCCCGCTTTTCTAGGG - Intronic
952896724 3:38082602-38082624 CGGCAAGTCCCGCTTTTCTAGGG - Intronic
952896775 3:38082784-38082806 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
953176935 3:40561748-40561770 CGGCAAGTCCCGCTTTTCTGTGG + Intronic
953176969 3:40561869-40561891 CAGCAAGTCCTGCTTTTCTAGGG + Intronic
953825912 3:46251008-46251030 TGGCAAGTCCCACTTTTCTAGGG - Intronic
954969459 3:54639165-54639187 CAGCAAGTCCCGCTTTCCTAGGG - Intronic
954969475 3:54639229-54639251 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
954969494 3:54639293-54639315 CGGCAAGTCCCGCTTTCCTGGGG - Intronic
956709012 3:72023986-72024008 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
957060100 3:75474794-75474816 CAGCAAGTCCTGTTTTTCTGGGG - Intergenic
957060118 3:75474859-75474881 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
958182036 3:90072417-90072439 GGGCACGTCCTGCTTTTCTGGGG - Intergenic
959288567 3:104444756-104444778 CGGCAAGTCCCGCTTTTCTATGG - Intergenic
959288594 3:104444879-104444901 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
959362958 3:105417895-105417917 CAGTAAGTCCTCCATTTCTAGGG - Intronic
959485962 3:106927383-106927405 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
959972469 3:112422314-112422336 CGGCAAGTCCTGCTTTCCTAGGG - Intergenic
959972501 3:112422439-112422461 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
960283094 3:115798242-115798264 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
960310337 3:116110079-116110101 CAGCAAGTCCCACTTTTCTAGGG - Intronic
960310395 3:116110326-116110348 CGGCAAGACCTGCTTTTCTGGGG - Intronic
961164961 3:124757219-124757241 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
961164979 3:124757283-124757305 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
961293267 3:125864547-125864569 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
961293285 3:125864612-125864634 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
961711865 3:128834034-128834056 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
961730358 3:128960698-128960720 CGGCTAGTCCCGCTTTTCTGGGG + Intronic
961730375 3:128960762-128960784 CGGCAAGTCCCGCTTTCCTGGGG + Intronic
961730394 3:128960826-128960848 CGGCAAGTCCCACTTTCCTGGGG + Intronic
961730412 3:128960890-128960912 CGGCAAGTCCCGCTTTTCTAGGG + Intronic
961880782 3:130059999-130060021 TGGCAAGTCCCGCTTTTCTGAGG + Intergenic
961880817 3:130060124-130060146 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
961880851 3:130060245-130060267 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
961893915 3:130151865-130151887 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
962660438 3:137596503-137596525 CGGCAAGTCCCTCTTTTCTGGGG + Intergenic
963058360 3:141205761-141205783 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
963058394 3:141205882-141205904 TGGCAAGTACCGCTTTTCTAGGG + Intergenic
963424998 3:145113927-145113949 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
963425031 3:145114052-145114074 CGACAAGTCCCACTTTTCTAGGG + Intergenic
963456878 3:145555916-145555938 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
963456912 3:145556037-145556059 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
963468393 3:145711296-145711318 TAGCAAGTCCTGCTTTTCTGGGG + Intergenic
963521393 3:146362948-146362970 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
963521425 3:146363070-146363092 TAGCAAGTCCTGCTTTTCTAGGG + Intergenic
963663073 3:148152400-148152422 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
963684106 3:148415261-148415283 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
964067583 3:152597874-152597896 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
964067609 3:152597991-152598013 TGGCAAGTCCCGCTTTTCTAAGG + Intergenic
964125722 3:153231639-153231661 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
964906730 3:161726654-161726676 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
964906765 3:161726775-161726797 TGGCAAGTCCGGCTTTTCTAGGG - Intergenic
964906802 3:161726895-161726917 CAGCAAGTCCCACTTTTCTGGGG - Intergenic
964983433 3:162713359-162713381 CGGCAAGTACTGCTTTTCTGGGG + Intergenic
965262862 3:166505544-166505566 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
965286914 3:166828698-166828720 CGGCAAGTCCCACTTTTCTAGGG - Intergenic
965286945 3:166828823-166828845 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
965336133 3:167432203-167432225 CGGCAAGTACCGCTTTTCTGGGG + Intergenic
965625089 3:170677266-170677288 TGGCAAGTCCTGCTTTTCTGGGG - Intronic
965626554 3:170688210-170688232 TGGCAAGTCCTGCTTTTCTAGGG - Intronic
965626585 3:170688331-170688353 CGGCAAGTCCTGCTTTTCTGGGG - Intronic
965640294 3:170822892-170822914 CGGCAAGTCCCGCTTTTCTAGGG - Intronic
965713149 3:171577228-171577250 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
965713182 3:171577353-171577375 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
965713199 3:171577417-171577439 TGGCAAGTCCTGCTTTTCTAGGG + Intergenic
965862183 3:173160652-173160674 CGGCAAGTACTGCTTTTCGGAGG - Intergenic
965891145 3:173514830-173514852 CAGCATTTCCTTCTTTTCTAGGG + Intronic
966066563 3:175828387-175828409 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
966066596 3:175828508-175828530 CAGCAAGTCCTGCTTTTCTAGGG + Intergenic
966085209 3:176062201-176062223 TGGTAAGTCCTGCTTTTCTGGGG + Intergenic
966085238 3:176062326-176062348 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
966105268 3:176326250-176326272 CAGCAAGTTCCGCTTTTCTAGGG - Intergenic
966105284 3:176326314-176326336 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
966105317 3:176326438-176326460 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
966233021 3:177670438-177670460 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
966278954 3:178208041-178208063 TGGCAAGTACTGCTTTTTTGGGG + Intergenic
966278988 3:178208160-178208182 AGGCAAGTACTGCTTTTCTGGGG + Intergenic
966279088 3:178208512-178208534 AGGCAAGCACTGCTTTTCTGGGG + Intergenic
966279118 3:178208630-178208652 CAGCAAGTACCACTTTTCTAGGG + Intergenic
966397477 3:179517933-179517955 TGGCAAGTACCGCTTTTCTGGGG + Intergenic
967151887 3:186658624-186658646 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
967212369 3:187180224-187180246 CAGCAAGTCCCGCCTTTCTAGGG - Intronic
967212402 3:187180349-187180371 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
967244401 3:187471129-187471151 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
967496002 3:190145440-190145462 CGGCAAGTCCTGCTTTTCTAGGG + Intergenic
967561203 3:190921187-190921209 CGGCAAGTCCTGCTTTCCTAGGG + Intergenic
967624881 3:191671328-191671350 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
967644030 3:191900106-191900128 CAGCAAGTCCCGCTTTTCTAGGG - Intergenic
967644064 3:191900227-191900249 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
967658359 3:192075982-192076004 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
967740249 3:192996509-192996531 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
967740282 3:192996634-192996656 CGGCAAGTCCTGCTTTTCTAGGG + Intergenic
967890144 3:194359117-194359139 CGGCACGACCTGCTTCTCTACGG + Exonic
968993167 4:3928289-3928311 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
969004022 4:4005020-4005042 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
969654342 4:8487661-8487683 TGGTAAGTCCCGCTTTTCTAGGG - Intronic
969654371 4:8487786-8487808 TGGCAAGTCCTGCTTTTCTGGGG - Intronic
969748845 4:9095203-9095225 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
969809896 4:9639781-9639803 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
969809914 4:9639846-9639868 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
970029419 4:11658401-11658423 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
970041908 4:11807322-11807344 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
970087367 4:12364779-12364801 CAGCAAGTCCTGCTTTTCTAGGG + Intergenic
970256629 4:14175253-14175275 AGGCAAGTCCCGCTTTTCTGAGG - Intergenic
970532521 4:16998640-16998662 AGGCAAGTCCCGCTTTTCTTGGG + Intergenic
970854281 4:20635093-20635115 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
971123382 4:23726705-23726727 CGGCAAGTCCCGCTTCCCTAGGG - Intergenic
971123414 4:23726830-23726852 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
971123443 4:23726955-23726977 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
971180333 4:24324168-24324190 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
971180365 4:24324294-24324316 CGGCAAGTCCCGCTTCCCTAGGG + Intergenic
971199892 4:24501878-24501900 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
971199972 4:24502187-24502209 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
972809032 4:42562480-42562502 CTGCACCTCCTGCTTTTCAATGG + Intronic
974428600 4:61769004-61769026 CGGCAAGTCCCGCTTTCCTAGGG - Intronic
974428618 4:61769068-61769090 CGGCAAGTCCCGCTTTCCTGGGG - Intronic
975865349 4:78718808-78718830 CAGCAAGTCCTGCTTTCCTGGGG - Intergenic
975934107 4:79558734-79558756 CAGCAAGTCCTGCTTTTCTAGGG - Intergenic
975934124 4:79558796-79558818 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
976558391 4:86475678-86475700 CGGCAAGTACTGCTTTTCTGGGG + Intronic
976558404 4:86475735-86475757 CGGCAAGTACCGCTTTTCTAGGG + Intronic
976662986 4:87559749-87559771 CGGCAGCTGCTGCTTTTCTGAGG + Intergenic
976884807 4:89969604-89969626 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
977010001 4:91624529-91624551 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
977010058 4:91624824-91624846 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
977013167 4:91659529-91659551 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
977013194 4:91659654-91659676 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
977041770 4:92026693-92026715 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
977041836 4:92026940-92026962 CGGCAAGTCCCACTTTCCTGGGG + Intergenic
977041853 4:92027004-92027026 CAGCAAGTCCTGCTTTTCTAGGG + Intergenic
977062798 4:92276609-92276631 CGGCAAGTCCCGCTTTTCTACGG - Intergenic
977062827 4:92276734-92276756 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
977075424 4:92443739-92443761 CGGCAAGTCCTGCTTTTCTGGGG - Intronic
977198624 4:94089297-94089319 TGGCAAGTCCTGCTTTCCTAGGG - Intergenic
977198641 4:94089361-94089383 CAGCAAGTCCTGCTTTCCTGGGG - Intergenic
977217310 4:94297738-94297760 CGGCAAGTCCTGCTTTTCTAGGG - Intergenic
977217327 4:94297802-94297824 CGGCAAGTTCCGCTTTCCTGGGG - Intergenic
977217344 4:94297866-94297888 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
977217379 4:94297991-94298013 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
977225595 4:94388388-94388410 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
978001347 4:103558568-103558590 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
978122722 4:105100073-105100095 CAGCAATTCCTTCTATTCTATGG - Intergenic
979054838 4:115980408-115980430 CAGCAAGTCCCTCTTTTCTGGGG - Intergenic
979146417 4:117253080-117253102 CAGCAAGTCCCACTTTCCTAGGG + Intergenic
979379647 4:119994564-119994586 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
979895355 4:126149809-126149831 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
979895372 4:126149873-126149895 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
980003578 4:127516279-127516301 CGGCAAGTACCGCTTTTCTGGGG - Intergenic
980112145 4:128645606-128645628 CGGCAAGTACTGCTTTTCTAGGG - Intergenic
980284733 4:130768264-130768286 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
980284761 4:130768389-130768411 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
980388681 4:132119033-132119055 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
980527655 4:134013073-134013095 CAGCAAGTCCTGCTTTTCTTGGG + Intergenic
980527685 4:134013198-134013220 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
980575830 4:134682562-134682584 TGACAAGTCCCGCTTTTCTGGGG - Intergenic
980575865 4:134682683-134682705 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
980611974 4:135172028-135172050 CGGCAAGTCCCGCTCTTCTGGGG - Intergenic
980612019 4:135172214-135172236 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
980903676 4:138928678-138928700 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
980903712 4:138928800-138928822 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
981040042 4:140214542-140214564 CGGCAAGTCCTGCTTTTCTTGGG + Intergenic
981040075 4:140214667-140214689 CGGCAAGTCCTGCTTTTCTAGGG + Intergenic
981524901 4:145699724-145699746 TGGCAAGTCCCGCTTTTCTGGGG + Intronic
981524947 4:145699910-145699932 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
981524963 4:145699974-145699996 TGGCAAGTCCCTCTTTTCTATGG + Intronic
981539459 4:145833462-145833484 TGGCAAGTCCCGCTTTCCTGGGG + Intronic
981539488 4:145833587-145833609 CGGCAAGTCCCGCTTTTCTACGG + Intronic
982084145 4:151817235-151817257 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
982084178 4:151817356-151817378 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
982180663 4:152745981-152746003 CAGCAAGTCCCGCTTTTCCTAGG - Intronic
982180679 4:152746045-152746067 TGGCAAGTCCCGCTTTCCTGGGG - Intronic
982180696 4:152746109-152746131 TGGCAAGTCCCGCTTTCCTGGGG - Intronic
982180729 4:152746234-152746256 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
982396920 4:154923562-154923584 TGGCAAGTACCACTTTTCTAGGG - Intergenic
982396951 4:154923680-154923702 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
982414396 4:155113191-155113213 CGACAAGTCTCGCTTTTCTAGGG - Intergenic
982414428 4:155113312-155113334 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
982497368 4:156108432-156108454 CGGCAAGTCTCGCTTTTCTGGGG - Intergenic
982535186 4:156601084-156601106 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
982535219 4:156601209-156601231 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
982535235 4:156601273-156601295 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
983023641 4:162710037-162710059 CGGCAAGTCCCACTTTCCTGGGG + Intergenic
983055265 4:163094055-163094077 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
983055301 4:163094199-163094221 CAGCAAGTCCCGCTTTCCTGGGG + Intergenic
983055319 4:163094263-163094285 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
983345368 4:166521551-166521573 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
983360178 4:166717148-166717170 CGGCAAGTCCCACTTTTCTATGG + Intergenic
983414907 4:167440492-167440514 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
983414938 4:167440619-167440641 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
983447837 4:167877163-167877185 CATCAAGTCCCGCTTTTCTGGGG + Intergenic
983452098 4:167923757-167923779 TGGCAAGTCCCGCTTTTCGGAGG + Intergenic
983659352 4:170117291-170117313 CGGCAAGCCCTGCTTTTCTGGGG + Intergenic
983707482 4:170678498-170678520 CGGTAAGTCCCGCTTTTCTAGGG + Intergenic
983884066 4:172961425-172961447 CAGCAAGTACCGCTTTTCTGGGG - Intronic
984099266 4:175466207-175466229 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
984321945 4:178207985-178208007 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
984393796 4:179169520-179169542 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
984393830 4:179169645-179169667 TGGCAAGTCCCGCTTTTCTGAGG - Intergenic
984437042 4:179721387-179721409 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
984700382 4:182815194-182815216 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
984700458 4:182815502-182815524 CGGCAAGTCCCGCTCTCCTAGGG + Intergenic
985435504 4:189926746-189926768 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
985582035 5:703352-703374 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
985582078 5:703538-703560 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
985582141 5:703785-703807 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
985582157 5:703849-703871 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
985639482 5:1057024-1057046 CGGCCAGGCCTGCTTTACTCAGG - Intronic
985922136 5:2985744-2985766 AGGCCAGTCCTGATTTTGTAAGG + Intergenic
986193301 5:5516425-5516447 CAGCAAGTACCGCTTTTCTGGGG + Intergenic
986297484 5:6450744-6450766 CTGCCAGTCCTTCTTTTCTAAGG + Intronic
986388650 5:7264470-7264492 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
986555773 5:9008673-9008695 CAGCAAGTCCCACTTTTCTAGGG - Intergenic
986555808 5:9008798-9008820 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
986555899 5:9009370-9009392 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
986555931 5:9009495-9009517 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
986905553 5:12490767-12490789 CGGCAAGTCCTACTTTCCTGGGG + Intergenic
986905571 5:12490831-12490853 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
986905587 5:12490895-12490917 CAGCAAGTCCCGCTTTCCTAGGG + Intergenic
986919833 5:12667424-12667446 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
987281796 5:16420827-16420849 CAGCAAATCCCGCTTTTCTGGGG + Intergenic
987281829 5:16420952-16420974 CGGCAAGTCCTGCTTTTCTAGGG + Intergenic
987498332 5:18673553-18673575 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
987498364 5:18673678-18673700 CAGCAAGTCCCACTTTTCTGGGG - Intergenic
987755580 5:22095630-22095652 TGGCAAGTACTGCTTTTCTAGGG + Intronic
987822308 5:22981564-22981586 CAGTAAGTTCTGCTTTTATAAGG + Intergenic
992394440 5:76358268-76358290 CGGCAAGTCCCGCTTTTCTACGG + Intergenic
992960589 5:81954084-81954106 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
992960623 5:81954205-81954227 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
993095359 5:83473336-83473358 CGGCAAGTCCTGCATGTCCCTGG + Intronic
993192427 5:84699110-84699132 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
993192490 5:84699378-84699400 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
993192506 5:84699442-84699464 TGGCAAGTCCCGCTTTTCTGAGG + Intergenic
993836420 5:92824626-92824648 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
993836455 5:92824751-92824773 CGGCAAGTCCTACTTTTCTGGGG + Intergenic
993836483 5:92824876-92824898 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
993836513 5:92825000-92825022 CGGCAAGTCCCACTTTTCTAGGG + Intergenic
994294953 5:98080097-98080119 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
994294970 5:98080161-98080183 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
994532722 5:100988884-100988906 CAGCAAGTCCCGCTTTTCTAGGG - Intergenic
994532736 5:100988948-100988970 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
994532800 5:100989195-100989217 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
994532836 5:100989320-100989342 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
994775467 5:104032560-104032582 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
994775500 5:104032681-104032703 CGGCAAGTCCTACTTTTCTGGGG + Intergenic
994779241 5:104069378-104069400 TGGCAAGTCCCTCTTTTCGAGGG - Intergenic
994779287 5:104069567-104069589 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
995125485 5:108573791-108573813 TGGCAAGTACCGCTTTTCTGGGG - Intergenic
995899642 5:117051361-117051383 CGGCAAGTCCCACTTTTCTAGGG - Intergenic
996203507 5:120702497-120702519 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
996345012 5:122478259-122478281 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
996509674 5:124304624-124304646 AGGCAAGTACCGCTTTTCTAGGG + Intergenic
996527824 5:124497897-124497919 TGGCAAGTCCTGCTTTTCTAGGG + Intergenic
996745735 5:126844660-126844682 TGGCAAGTCCCGCTTTTCTACGG - Intergenic
996745764 5:126844785-126844807 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
997746187 5:136302281-136302303 CGGCAAGTCCCACTTTTCTGGGG + Intronic
997746206 5:136302342-136302364 GGGCAAGTCCCGCTTTTCTGGGG + Intronic
997746222 5:136302403-136302425 CGGCAAGTCCCGCTTTTCTAGGG + Intronic
997769879 5:136544363-136544385 TGGCAAGTCCCGCTTTCCTAGGG - Intergenic
997769897 5:136544427-136544449 CAGCAAGTCCCGCTTTCCTGGGG - Intergenic
997772879 5:136570208-136570230 TGGCAAGTCCCACTTTTCTATGG - Intergenic
997772907 5:136570333-136570355 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
997788741 5:136737883-136737905 TGGCAAGTACCGCTTTTCTGGGG + Intergenic
998390577 5:141784629-141784651 CCGCCAGGCCTGCTTTTCTCAGG + Intergenic
998996582 5:147873539-147873561 CGGCAAGTCCCAGTTTCCTAGGG - Intronic
998996600 5:147873603-147873625 CGGCAAGTCCCGCTTTCCTGGGG - Intronic
999619062 5:153454382-153454404 CGGCAAGTCCCACTTTCCTAGGG - Intergenic
999619095 5:153454503-153454525 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1000439470 5:161249273-161249295 CAGCAAGTCCTGCTTTTCTGAGG + Intergenic
1000519626 5:162280154-162280176 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1000519657 5:162280275-162280297 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1000935863 5:167302674-167302696 TGGCAAGTACCACTTTTCTAGGG - Intronic
1000935894 5:167302795-167302817 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
1001331725 5:170766991-170767013 CGGCAAGTCCCACTTTTCTGGGG - Intronic
1002611164 5:180419415-180419437 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1002611214 5:180419601-180419623 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1003430359 6:6032470-6032492 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
1003430376 6:6032534-6032556 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1003430395 6:6032598-6032620 CGGCAAGTCCCGCTATTCTGGGG - Intergenic
1003430429 6:6032723-6032745 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
1004105967 6:12668033-12668055 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1004106065 6:12668396-12668418 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1004283765 6:14301795-14301817 CGGCAAGTCCCGCTTTTCTATGG - Intergenic
1004508264 6:16264017-16264039 CGGCAAGTCCTGCTTTTCTGGGG - Intronic
1004768838 6:18759015-18759037 CAGCAAGTCCCACTTTTCTGGGG - Intergenic
1004836800 6:19539889-19539911 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1005014874 6:21366228-21366250 AGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1005014907 6:21366353-21366375 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1008476308 6:51939129-51939151 CAGCAAGTACTGCTTTTCTGGGG + Intronic
1008476345 6:51939250-51939272 TGGCAAGTACCGCTTTTCTGGGG + Intronic
1008850395 6:56015434-56015456 TGGCAAGTACCACTTTTCTAAGG - Intergenic
1008850427 6:56015553-56015575 TGGCAAGTACCGCTTTTCTAGGG - Intergenic
1008850457 6:56015674-56015696 TGGCAAGTACTGCTTTTCTGGGG - Intergenic
1008850489 6:56015793-56015815 CAGCAAGTACTGCTTTTCTGGGG - Intergenic
1008850522 6:56015913-56015935 CGGCAAGTACCGCTTTTCTGGGG - Intergenic
1009343379 6:62586833-62586855 CGGCAAGTCCTGCTTTTCTGTGG + Intergenic
1009343410 6:62586954-62586976 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1009359181 6:62792594-62792616 TGGCAAGTACCACTTTTCTAGGG + Intergenic
1009621917 6:66088293-66088315 CAGAATTTCCTGCTTTTCTATGG - Intergenic
1010586911 6:77665287-77665309 TGGCAAGTCCCACTTTTCTAGGG - Intergenic
1010586928 6:77665351-77665373 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1010586947 6:77665415-77665437 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1010827113 6:80487108-80487130 CGGCAAGTCCCGCTTCCCTAGGG - Intergenic
1010827145 6:80487234-80487256 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1010894805 6:81350140-81350162 CGGCAAGTCCCACTTTTCTATGG - Intergenic
1010894833 6:81350265-81350287 CGGCAAGTCCCGTTTTTCTGGGG - Intergenic
1011368098 6:86603020-86603042 CGGCAAGTACTGCTTTTCTGGGG - Intergenic
1011771138 6:90674864-90674886 TGACAAGTCCCGCTTTTCTAGGG - Intergenic
1012014604 6:93834837-93834859 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1012066730 6:94558577-94558599 TGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1012066752 6:94558661-94558683 CCGCAAGTCCCGCTTTTCTGGGG - Intergenic
1012315570 6:97780400-97780422 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1012674907 6:102102974-102102996 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1012689301 6:102293613-102293635 CAGCAAGTCTCGCTTTTCTGGGG + Intergenic
1012689352 6:102293805-102293827 CGGCAAGTCCTGCTTTCTACGGG + Intergenic
1013408140 6:109860693-109860715 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1013843950 6:114427336-114427358 CGGCAAGTCCCGCTTTTCTACGG - Intergenic
1013891441 6:115032683-115032705 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1013891475 6:115032809-115032831 CGGCAAGTCCTGCTTTCCTGGGG + Intergenic
1013891491 6:115032873-115032895 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1014360390 6:120467094-120467116 CAGCAAGTCCCACTTTTCTACGG - Intergenic
1014360418 6:120467219-120467241 TAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1014395764 6:120925688-120925710 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1014395794 6:120925806-120925828 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1014455075 6:121625136-121625158 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1014455092 6:121625200-121625222 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1014455142 6:121625389-121625411 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1014555595 6:122840647-122840669 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1014614906 6:123587142-123587164 TGGCAAGTCCCGCTTTTCTGGGG - Intronic
1014718374 6:124891291-124891313 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1014718407 6:124891416-124891438 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1014718423 6:124891480-124891502 TGGCAAGTCCCTCTTTTCTAGGG + Intergenic
1014794264 6:125706850-125706872 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1014891332 6:126849727-126849749 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1014891351 6:126849790-126849812 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1015165005 6:130193284-130193306 CAGCAAGTCCCACTTTTCTGGGG + Intronic
1015266484 6:131296248-131296270 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1015266543 6:131296494-131296516 CGGCAAATCCCACTTTCCTAGGG + Intergenic
1015269413 6:131324199-131324221 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1015271119 6:131339703-131339725 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1015271170 6:131339891-131339913 CAGCAAGTCCCGCTTTCCTGGGG + Intergenic
1015271188 6:131339955-131339977 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1015277938 6:131403810-131403832 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1015277974 6:131403934-131403956 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1015323570 6:131902445-131902467 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1015801628 6:137066234-137066256 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1016204307 6:141453674-141453696 CAGCAAGTTCCACTTTTCTAGGG + Intergenic
1016248592 6:142016559-142016581 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1016518572 6:144924059-144924081 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1016518637 6:144924309-144924331 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1016535982 6:145107995-145108017 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1016650571 6:146455438-146455460 CGACAAGTCCTGCTTTTCTGGGG - Intergenic
1016650600 6:146455563-146455585 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1016853027 6:148640621-148640643 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1017779528 6:157705370-157705392 CAGCAAGTCCCACTTTTCTAGGG - Intronic
1017779560 6:157705491-157705513 TGGCAAGTCCCATTTTTCTAGGG - Intronic
1017779590 6:157705612-157705634 TGGCAAGTCCCACTTTTCTGGGG - Intronic
1018084712 6:160291316-160291338 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1018084746 6:160291437-160291459 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1018495671 6:164343776-164343798 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1018495702 6:164343896-164343918 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1018521692 6:164656937-164656959 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1018521724 6:164657058-164657080 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1019480532 7:1264699-1264721 CTGCAGGTCCTGCTCTTCCATGG + Intergenic
1020315803 7:6904636-6904658 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1020315835 7:6904761-6904783 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1020324148 7:6961437-6961459 CAGCAAGTCCTGCTTTTCTGGGG - Intergenic
1020532954 7:9358293-9358315 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1020541339 7:9463270-9463292 CGGCAAGTCTCACTTTTCTGGGG - Intergenic
1021637094 7:22704236-22704258 CAGCAAGTACCGCTTTTCTGGGG + Intergenic
1021637111 7:22704296-22704318 TGGCAAGTGCCGCTTTTCTAGGG + Intergenic
1021810426 7:24397149-24397171 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1021810456 7:24397274-24397296 CAGCAAGTCCCGCTTTTCTACGG + Intergenic
1021978049 7:26028709-26028731 CGGCAAGTCCTGCTTTTCTAGGG - Intergenic
1021978067 7:26028773-26028795 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1021978100 7:26028898-26028920 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1022372661 7:29785842-29785864 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1022372693 7:29785967-29785989 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
1022710212 7:32842440-32842462 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1022710261 7:32842626-32842648 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1022854907 7:34304527-34304549 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1022854940 7:34304659-34304681 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1023699096 7:42875321-42875343 CGGCAAGTCCCGCTTTTCTATGG - Intergenic
1023699128 7:42875449-42875471 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1024697356 7:51870783-51870805 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1024697375 7:51870847-51870869 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1024697394 7:51870911-51870933 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1024697413 7:51870975-51870997 TGGCAAGTCCTGCTTTCCTGGGG + Intergenic
1024697430 7:51871039-51871061 TGGCAAGTCCCACTTTCCTAGGG + Intergenic
1024947928 7:54830315-54830337 CGGAATGTCCTTCTTTTCTAAGG - Intergenic
1025622646 7:63188207-63188229 CGGCTAGTAATGATTTTCTAAGG - Intergenic
1027358967 7:77388576-77388598 AGGCCAGTCCTTCTTTTCTACGG - Intronic
1028686338 7:93592405-93592427 CAGCAAGTCTGGATTTTCTATGG - Intronic
1028689949 7:93640796-93640818 CAGCAAGTCCTACTTTTCTGTGG + Intronic
1028689983 7:93640917-93640939 CAGCAAGTCCCGCTTTTCTAGGG + Intronic
1030441884 7:109596713-109596735 CGGCAAGTCCCACTTTTCTGCGG - Intergenic
1030751669 7:113238115-113238137 TGGCAAGTCCCTCTTTTCTAGGG - Intergenic
1030751687 7:113238179-113238201 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1030751738 7:113238365-113238387 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1031004462 7:116456515-116456537 CGGCAAGTCCCGCTTTTCTGGGG + Intronic
1031004480 7:116456579-116456601 CGGCAAGTCCCACTTTTCTAGGG + Intronic
1031353920 7:120767119-120767141 CGGCAATTCCTTCTTATCTGAGG - Intergenic
1031355414 7:120781894-120781916 CGGCAAGTACTGCTTTTCTAGGG - Intergenic
1031355445 7:120782013-120782035 TGGCAAGTACCGCTTTTCTGTGG - Intergenic
1031364946 7:120890387-120890409 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
1031364981 7:120890508-120890530 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1031399700 7:121316270-121316292 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1031399823 7:121316744-121316766 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1031685637 7:124729994-124730016 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1031728129 7:125263591-125263613 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1031728158 7:125263716-125263738 CGGCAAGTCCCTCTTTTCTGGGG - Intergenic
1031776095 7:125910853-125910875 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1031777094 7:125918423-125918445 TGGCAAGTCCTGCTTTTCTAAGG + Intergenic
1031777126 7:125918548-125918570 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1033211316 7:139462292-139462314 CAGCAAGCACTGCTTTTCTTGGG + Intronic
1033261720 7:139849722-139849744 CCCTAAGTCCTGCTTTTCCAGGG - Intronic
1033676160 7:143541919-143541941 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1033676194 7:143542044-143542066 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1033695639 7:143787395-143787417 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1033695673 7:143787520-143787542 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1033909722 7:146248340-146248362 CGGCAAGTCCCACTTTTCTGGGG - Intronic
1034085001 7:148314612-148314634 CGGCAAGTACCGCTTTTCTAGGG - Intronic
1036071115 8:5441304-5441326 CGGCAAGTACCGCTTTTCTAGGG - Intergenic
1036071148 8:5441423-5441445 TGGCAAGTACCGCTTTTCTGGGG - Intergenic
1036281231 8:7403181-7403203 CGGCAATTCCCGCTTTTCTGGGG + Intergenic
1036281257 8:7403306-7403328 CGGCAAGTCCCGCTTTTCTATGG + Intergenic
1036340209 8:7908266-7908288 CGGCAAGTCCCGCTTTTCTATGG - Intergenic
1036340235 8:7908391-7908413 CGGCAATTCCCGCTTTTCTGGGG - Intergenic
1036371916 8:8169528-8169550 CAGCAAGACCTGCTTTTCTGGGG + Intergenic
1036472554 8:9064195-9064217 CGGCAAGTATCGCTTCTCTAGGG - Intronic
1036472588 8:9064318-9064340 CGGCAAGTACCGCTTTTCTGGGG - Intronic
1036639219 8:10571965-10571987 CAGCAAGTCCCACTTTTCTAGGG + Intergenic
1036639257 8:10572094-10572116 CGGCAAATCCCACTTTTCTAGGG + Intergenic
1036878988 8:12496115-12496137 CAGCAAGACCTGCTTTTCTGGGG - Intergenic
1040430323 8:47334569-47334591 AGGCTACTCCTGCTTTTCTTTGG + Intronic
1042453285 8:68973871-68973893 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1043353872 8:79390780-79390802 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1043718150 8:83510057-83510079 CGGGAAGTCCTGCTTTTCTGGGG - Intergenic
1043837467 8:85063692-85063714 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1043837497 8:85063817-85063839 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1044148691 8:88746824-88746846 CAGCAAGTCCCGCTTTTCTAGGG - Intergenic
1044258805 8:90094837-90094859 CGGCAAGTCCCGCTTTTCTAGGG - Intronic
1044258832 8:90094962-90094984 CAGCAAGTCCCGCTTTTCTGGGG - Intronic
1044416839 8:91948872-91948894 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1044416858 8:91948936-91948958 CGGTAAGTCCCGCTTTCCTGGGG + Intergenic
1044416876 8:91948997-91949019 TGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1044416893 8:91949061-91949083 CAGCAAGTCCCACTTTCCTAGGG + Intergenic
1044921722 8:97175904-97175926 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1044921757 8:97176029-97176051 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1044921789 8:97176153-97176175 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1044924890 8:97201662-97201684 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1044924938 8:97201850-97201872 CGGCAAGTCCTGCTTTCCTGGGG + Intergenic
1044924953 8:97201914-97201936 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1045197238 8:99944565-99944587 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1045197271 8:99944690-99944712 CAGCAAGTCTCGCTTTTCTAGGG + Intergenic
1045644542 8:104286792-104286814 CGGCAAGTCCCGCTTTTCTTGGG + Intergenic
1046293888 8:112196729-112196751 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
1046293922 8:112196854-112196876 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1046386604 8:113514464-113514486 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1046442956 8:114282588-114282610 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1046443005 8:114282777-114282799 TGGCAAGTCCTGCTTTTCTACGG + Intergenic
1046511861 8:115213144-115213166 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1046511889 8:115213269-115213291 CGGCAAGTCCTGCTTTCCTAGGG + Intergenic
1046559043 8:115815505-115815527 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1046559077 8:115815631-115815653 CGGCAAGTCCCGCTTTCCTAGGG + Intergenic
1047699113 8:127432597-127432619 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1047699143 8:127432701-127432723 CGGCAAGTCCTGCTTTCCTGGGG + Intergenic
1047829758 8:128616704-128616726 CGGCAAGTCTCGCTTTTCTGGGG - Intergenic
1047856151 8:128915320-128915342 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1048097367 8:131311017-131311039 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1048097396 8:131311138-131311160 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1048135252 8:131741604-131741626 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1048135281 8:131741729-131741751 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1048168677 8:132085078-132085100 CGGCAAGTCCCACTTTTCTGGGG - Intronic
1048585622 8:135771861-135771883 CGGCAAGTCCCACTTTGCTAGGG - Intergenic
1048585684 8:135772107-135772129 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1048728616 8:137413005-137413027 TGGCGAGTCCTGCTTTTCTGAGG - Intergenic
1048764421 8:137829502-137829524 CAGCAAGTCCTGTTTTTCTGGGG - Intergenic
1048764437 8:137829566-137829588 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1048764472 8:137829691-137829713 TGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1049493661 8:142918028-142918050 CTGCAAGTCCTGCTGGTCTGAGG + Intergenic
1049869022 8:144958993-144959015 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1049869055 8:144959114-144959136 TGGCAAGTCCTGCTTTTCTAGGG - Intergenic
1050258312 9:3815895-3815917 CGGCAAGTCCCACCTTTCTGGGG - Intergenic
1050473933 9:6020918-6020940 CGGCAAGCACTGCTTTTCTGGGG + Intergenic
1050895891 9:10885833-10885855 CGGCAAGTACTGCTTTTCTTGGG + Intergenic
1051052406 9:12949278-12949300 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1051052423 9:12949342-12949364 AGGCAAGTCCTGCTTTCCTAGGG + Intergenic
1051849489 9:21490395-21490417 CGGCGAGTCCCGCTTTCCTAGGG - Intergenic
1051849533 9:21490583-21490605 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1051953588 9:22663184-22663206 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1052191590 9:25669776-25669798 TGGCAAGTACTGCTTTTCTGGGG + Intergenic
1052191619 9:25669894-25669916 TGGCAAGTACCGCTTTTCTAGGG + Intergenic
1052245722 9:26331646-26331668 CGTTAAGTCCTGATTTGCTAAGG - Intergenic
1052653077 9:31327204-31327226 CAGCAAGTACCGCTTTTCTGGGG + Intergenic
1053057739 9:35004157-35004179 CAGCAAGTACTGCTTTTCTAGGG + Intergenic
1053057767 9:35004274-35004296 CTGCAAGTACCACTTTTCTAGGG + Intergenic
1054807682 9:69409432-69409454 CGGCAAGTCCCACTTTTCTGGGG - Intergenic
1055232802 9:74086471-74086493 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1055232835 9:74086598-74086620 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1055232852 9:74086662-74086684 CGGCAAGTCCTGCTTTTCTAGGG + Intergenic
1055347916 9:75356462-75356484 CGGCAAGTACTGCTTTTCTAGGG - Intergenic
1055626456 9:78181548-78181570 TGGCAAGTCCCACTTTTCTGGGG + Intergenic
1055626489 9:78181673-78181695 CGGCAAGTCCCACTTTTCTAGGG + Intergenic
1055881536 9:81009932-81009954 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1055881551 9:81009995-81010017 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1055932866 9:81577634-81577656 CGGCAATAGCTGCTTTTCTCAGG - Intergenic
1056044908 9:82705246-82705268 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1056044948 9:82705374-82705396 CGGCAAGTCCCACTTTCCTGGGG - Intergenic
1056060926 9:82884636-82884658 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1056060972 9:82884822-82884844 CAGCAAGTCCCACTTTTCTACGG + Intergenic
1056257063 9:84810675-84810697 CGGGAAGTGCTGCTTATCTGGGG + Intronic
1056323580 9:85459226-85459248 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1056323627 9:85459412-85459434 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1056437428 9:86587961-86587983 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1056437463 9:86588089-86588111 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1056437481 9:86588153-86588175 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1056437500 9:86588217-86588239 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1056437519 9:86588281-86588303 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1056437537 9:86588345-86588367 CGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1056522161 9:87411599-87411621 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1056882779 9:90413597-90413619 CGGCAAGTCCTGCTTTCCTAGGG + Intergenic
1057377782 9:94540823-94540845 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1057683718 9:97215462-97215484 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1057683739 9:97215526-97215548 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1057683760 9:97215588-97215610 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1057981766 9:99670673-99670695 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1057981782 9:99670737-99670759 TGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1057981816 9:99670864-99670886 TGGCAAGTCCCGCTTTTCTACGG + Intergenic
1058026439 9:100145522-100145544 TGGCAAGTACCACTTTTCTAGGG - Intronic
1058026467 9:100145642-100145664 CAGCAAGTACTGCTTTTCTGGGG - Intronic
1058612190 9:106789134-106789156 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1059001844 9:110356654-110356676 CTCCAAGTCCAGCTTTTATAGGG - Intergenic
1059546384 9:115179455-115179477 CAGCAAGTCCTGCTTTTCTTGGG - Intronic
1059574344 9:115474085-115474107 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1059574394 9:115474271-115474293 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1059574412 9:115474335-115474357 CGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1059574428 9:115474399-115474421 TGGCAAGTCCTGCTTTCCTAGGG + Intergenic
1059606905 9:115843890-115843912 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1059606938 9:115844015-115844037 CGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1059863686 9:118490359-118490381 CGGCAAGTCCCGCTTTCCTAGGG - Intergenic
1059863715 9:118490484-118490506 CAGCAAGTCCTGCTTTTCTGGGG - Intergenic
1060225924 9:121790901-121790923 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1060318668 9:122535274-122535296 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1060738104 9:126079417-126079439 CGGCAAGTCCCACTTTTCTAGGG - Intergenic
1060738134 9:126079542-126079564 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1062470853 9:136703589-136703611 TGGCATGTCCTGCTGCTCTAAGG + Intergenic
1185858757 X:3559006-3559028 CAGCAAGTCCTGCTTTTCTAGGG - Intergenic
1185858789 X:3559130-3559152 TGGCAAGTCCCACTTTTCTGGGG - Intergenic
1185858820 X:3559255-3559277 CGACAAGTCCCGCTTTTCTGGGG - Intergenic
1185960856 X:4545021-4545043 CAGCAAGTCCCACTTTTCTAGGG - Intergenic
1185960872 X:4545085-4545107 TGGCAAGTCCTGCTTTCCTGGGG - Intergenic
1185960894 X:4545151-4545173 CGGTAAGTCCCGCTTTTCTAGGG - Intergenic
1185960956 X:4545398-4545420 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1185990835 X:4892502-4892524 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1185990863 X:4892627-4892649 CGGCAAGTCCCGCTTTTCTACGG + Intergenic
1186091386 X:6052484-6052506 CTTCAAGTCCTGCCTTTCTTGGG - Intronic
1186113092 X:6276933-6276955 CGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1186783835 X:12940729-12940751 CGGCAAGTTCCGCTTTTCTGTGG + Intergenic
1186783871 X:12940854-12940876 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1187086766 X:16049551-16049573 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1188333211 X:28897235-28897257 CGGCAAGTACAGCTTTTCTAGGG - Intronic
1188463584 X:30453814-30453836 TGGCAAGTCCCACTTTTCTAGGG - Intergenic
1188463611 X:30453938-30453960 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1188552465 X:31378617-31378639 CGGCAAGTACCGCTTTTCTCGGG + Intronic
1191957391 X:66659218-66659240 CAGCAACTCCTGCTCTTTTATGG - Intergenic
1193153731 X:78151270-78151292 CAGCTAGTCCTGCTCTTCTTTGG + Intergenic
1193885713 X:86982738-86982760 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
1193885746 X:86982859-86982881 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1193941223 X:87682581-87682603 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1193941282 X:87682828-87682850 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
1194186434 X:90777991-90778013 CAGCAAGTCCTGCTTTCCTAGGG - Intergenic
1194186492 X:90778232-90778254 CGGAAAGTCCTGCTTTTCAGGGG - Intergenic
1194293812 X:92104902-92104924 TGGCAAGTCCCGCTTTCCTAGGG - Intronic
1194308772 X:92277891-92277913 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
1194351043 X:92825333-92825355 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1194351077 X:92825460-92825482 CGGCAAGTCCCACTTTCCTGGGG + Intergenic
1194366869 X:93023822-93023844 CGACAAGTCCCACTTTTCTGGGG + Intergenic
1194366903 X:93023943-93023965 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1194503225 X:94703701-94703723 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1194559877 X:95407029-95407051 CTGAAACTCATGCTTTTCTATGG - Intergenic
1194660444 X:96624858-96624880 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1194822964 X:98528970-98528992 TGGCAAGTCCCGCTTTTCTAGGG - Intergenic
1194822982 X:98529034-98529056 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1194823016 X:98529159-98529181 CGTCAAGTCCCGCTTTTCTGGGG - Intergenic
1194874047 X:99164312-99164334 CTGCAAGCCCTGCTTTCCTGGGG - Intergenic
1195908872 X:109869887-109869909 CGGCAAGTCCCACTTTCCTAGGG - Intergenic
1195908890 X:109869949-109869971 CGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1196165270 X:112531295-112531317 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1196165297 X:112531420-112531442 CGGCAAGTCCCGCTTTTCTGGGG + Intergenic
1196221209 X:113113512-113113534 CAGCAAGTACCGCTTTTCTGGGG - Intergenic
1196330575 X:114467563-114467585 CGGCAAGTCCCACTTTTCTGGGG + Intergenic
1196341950 X:114606143-114606165 TGGCAAGTCCCGCTTTTCTATGG - Intronic
1196341993 X:114606330-114606352 CGGCAAGTCCCGCTTTTCTGGGG - Intronic
1196525681 X:116725645-116725667 TGGCAAGTACCACTTTTCTAGGG - Intergenic
1196533734 X:116817173-116817195 CGGCAAGTCCCACTTTCCTAGGG - Intergenic
1196533752 X:116817237-116817259 TGGCAAGTCCCGCTTTCCTGGGG - Intergenic
1196533771 X:116817301-116817323 CGGCAAGTCCCGCTTTCCTGTGG - Intergenic
1196572260 X:117280031-117280053 CAGCAAGTCCCGCTTTTCTGGGG + Intergenic
1196572325 X:117280277-117280299 CGGCAAGTCCCACTTTCCTGGGG + Intergenic
1196572342 X:117280341-117280363 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1196774055 X:119322442-119322464 CAGCAAGTCCCGCTTTTCTAGGG - Intergenic
1196774086 X:119322567-119322589 TGGCAAGTCCTGCTTTTCTGGGG - Intergenic
1196992925 X:121347801-121347823 CGGCAAGTACCGCTTTTCCAGGG - Intergenic
1197064678 X:122222907-122222929 CCGCAAGTCCCGCTTTTCTGGGG + Intergenic
1197352254 X:125393525-125393547 CAGCAAGTCCTGCTTTTCTAGGG - Intergenic
1197352283 X:125393650-125393672 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1197470727 X:126863963-126863985 CTGCAAGTCCCACTTTTCTGGGG + Intergenic
1197932841 X:131712900-131712922 CGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1197932871 X:131713021-131713043 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1198598189 X:138259512-138259534 CAGCAAGTCCTGCTTTTCTAGGG + Intergenic
1198598224 X:138259637-138259659 TGGTAAGTCCCGCTTTTCTAGGG + Intergenic
1198599599 X:138269036-138269058 CAGCAAGTCCCGCTTTTCTGGGG - Intergenic
1198599631 X:138269157-138269179 CGGCAAGTCCCGCTTTTCTGGGG - Intergenic
1199576221 X:149316485-149316507 CAGCAAGTCCCACTTTTCTGGGG + Intergenic
1199576254 X:149316610-149316632 CAGCAAGTCCCGCTTTTCTAGGG + Intergenic
1199576287 X:149316735-149316757 TGGCAAGTCCCACTTTTCTAGGG + Intergenic
1200533033 Y:4360067-4360089 CGGCAAGTCCTGCTTTCCTAGGG - Intergenic
1200611329 Y:5329443-5329465 TGGCAAGTCCCGCTTTCCTAGGG - Intronic
1200611347 Y:5329507-5329529 CGGCAAGTCCCTCTTTCCTGGGG - Intronic
1200659370 Y:5942013-5942035 CGGCAAGTCCCGCTTTCCTGGGG + Intergenic
1200659406 Y:5942140-5942162 CGGCAAGCCCTGCTTTCCTGGGG + Intergenic
1200675091 Y:6140078-6140100 CGACAAGTCCCACTTTTCTGGGG + Intergenic
1200675125 Y:6140199-6140221 TGGCAAGTCCCGCTTTTCTAGGG + Intergenic
1201581153 Y:15513172-15513194 CAGCAAGTCCTGCTTTTCTGGGG + Intergenic
1201936849 Y:19419355-19419377 TGGCAAGTCCTGCTTTTCTGGGG + Intergenic
1201936870 Y:19419459-19419481 CGGCAAGTCCCACTTTTCTAGGG + Intergenic
1202076753 Y:21044146-21044168 CAGCAAGTCCTGCTTTTCTAGGG - Intergenic
1202076779 Y:21044272-21044294 CAGCAAGGCCTGCTTTTCTGGGG - Intergenic